Search

BACKGROUND Risk factors, virological parameters, and outcomes associated with HHV-6 viremia in high-risk donor CMV-seropositive and recipient CMV-seronegative (D+R-) liver transplant recipients in the current era are incompletely defined. METHODS The study population consisted of patients in the preemptive therapy (PET) arm of a randomized, controlled trial of PET versus valganciclovir prophylaxis for CMV prevention in D+R- liver transplant recipients. Weekly blood samples through 100 d in the PET group were tested for HHV-6 viremia using a real-time quantitative polymerase chain reaction. Assessments included virological characteristics and relationship with CMV, risk factors, and impact of HHV-6 viremia with outcomes through 12 mo posttransplant. RESULTS HHV-6 viremia at any level developed in 42% (40 of 96). Older patient age (P = 0.03), longer hospitalization (P = 0.015), and ICU stay at transplantation (P = 0.029) were significantly associated with high-grade viremia. Concurrent HHV-6 and CMV viremia was associated with earlier onset of HHV-6 viremia (P = 0.004), higher HHV-6 area under the curve (P = 0.043), and higher peak HHV-6 viral load (P = 0.006) versus HHV-6 viremia alone. High-grade viremia was independently associated with biopsy-proven rejection within 12 mo (P = 0.045) posttransplant. CONCLUSIONS Among D+R- liver transplant recipients receiving valganciclovir as PET, high-grade HHV-6 viremia was associated with increased age and critical illness in ICU at time of transplant and was independently associated with allograft rejection.

Human herpesvirus‐6 (HHV‐6) may cause serious diseases in immunocompromised individuals. SARS‐CoV‐2/HHV‐6 coinfection has been emphasized in previous works, mostly case reports, small series, or epidemiological studies, but few are known about its real clinical outcomes. Here we present a real‐world pilot study aiming to understand the frequency and the clinical impact of HHV‐6 coinfection in moderate to critically ill patients hospitalized due to COVID‐19. SARS‐CoV‐2 and HHV‐6 were evaluated in nasopharyngeal samples at the hospital admission of suspected COVID‐19 patients. From 173 consecutive cases, 60 were SARS‐CoV‐2 positive and 13/60 (21.7%) were HHV‐6 positive after identified as the HHV‐6B species by a Sanger sequencing. The SARS‐CoV‐2+/HHV‐6+ group was younger but not significant for cardiovascular diseases, diabetes, obesity, and cancer, but significant among therapeutic immunosuppressed patients (as systemic lupus erythematosus and kidney transplant patients). In the medical records, only sparse data on cutaneous or neurological manifestations were found. Biochemical and hematological data showed only a trend towards hyperferritinemic status and lymphopenia. In conclusion, despite the impressive high frequency of HHV‐6 coinfection in SARS‐CoV‐2 positive cases, it did not impact general mortality. We suggest larger future prospective studies to better elucidate the influence of HHV‐6 reactivation in cases of COVID‐19, designed to specific assessment of clinical outcomes and viral reactivation mechanisms.

We investigated the association between human herpesvirus 6 (HHV‐6) and mesial temporal sclerosis (MTS) in 87 patients who had surgery for drug‐resistant epilepsy. Fifty‐four had MTS, 22 focal cortical dysplasia (FCD), four tumors, three vascular malformations, and three a history of encephalitis. We extracted DNA from fresh brain tissue immediately after surgery and performed viral detection with quantitative real‐time polymerase chain reaction (PCR) or digital droplet PCR specific for HHV‐6A and HHV‐6B. Tissue was studied with standard clinical techniques, including hematoxylin and eosin, glial fibrillary acidic protein, and NeuN stains. Twenty‐nine of 54 patients with MTS, six of 23 with focal cortical dysplasia (FCD), and one of three with a history of encephalitis were positive for HHV‐6 (P

Background Late onset intra-uterine growth restriction (IUGR) refers to impaired growth and development of the fetus, characterized by placental morphological abnormalities that affect the fetus supply of nutrients. Human Leukocyte Antigen-G (HLA-G) is physiologically expressed during pregnancy, but in normal placenta decreased during the last weeks of gestation possibly inducing childbirth. Several viruses involved in congenital infection, such as herpesviruses, exploit HLA-G expression as an immune-escape mechanism. To date, despite different congenital herpetic infections have been associated with late IUGR, no direct implication of HHV-6 infection, has been reported. Methods We evaluated HLA-G expression and HHV-6 infection in 11 placentas from late onset IUGR newborns and 11 placentas from uncomplicated pregnancies by histopathological and immunohistochemistry analysis. Results We found higher levels of HLA-G expression and HHV-6 presence in IUGR placenta samples compared with control placenta samples. Conclusions We report HHV-6 staining in IUGR placenta samples, characterized by high HLA-G expression. These preliminary data suggest a possible involvement of HHV-6 infection in HLA-G deregulation that might affect vessel remodeling and prevent the correct pregnancy outcome in IUGR condition. This article is protected by copyright. All rights reserved.

Background: Infection with human herpesvirus 6A (HHV-6A) has been suggested to increase multiple sclerosis (MS) risk. However, potential interactions between HHV-6A and environmental/lifestyle risk factors for MS have not previously been studied. Methods: We used two Swedish population-based case-control studies comprising 5993 cases and 5995 controls. Using logistic regression models, subjects with different HHV-6A antibody levels, environmental exposures, and lifestyle habits were compared regarding MS risk, by calculating odds ratios (ORs) with 95% confidence intervals (CIs). Potential interactions between high HHV-6A antibody levels and common environmental exposures and lifestyle factors were evaluated on the additive scale. Results: High HHV-6A antibody levels were associated with increased risk of developing MS (OR = 1.5, 95% CI = 1.4–1.6). Regarding MS risk, significant interactions were observed between high HHV-6A antibody levels and both smoking (attributable proportion (AP) = 0.2, 95% CI = 0.1–0.3), low ultraviolet radiation (UVR) exposure (AP = 0.3, 95% CI = 0.1–0.4), and low vitamin D levels (AP = 0.3, 95% CI = 0.0–0.6). Conclusion: High HHV-6A antibody levels are associated with increased MS risk and act synergistically with common environmental/lifestyle risk factors for MS. Further research is needed to investigate potential mechanisms underlying the interactions presented in this study.

Infections due to human herpesvirus 6 (HHV-6) are frequent during early childhood. Usually, they have a favorable clinical course. Conversely, HHV-6 congenital infections occur in about 1% of neonates and may present with more severe clinical pictures. HHV-6 can be found in lung tissues and bronchoalveolar lavage (BAL) samples from patients with pneumonia and in immunocompromised patients can cause mild to severe pneumonia. In neonates, the role of HHV-6 in the genesis of severe pneumonia is poorly defined still now. We describe a healthy infant with a late-onset (15 days of life) severe interstitial pneumonia and heavy HHV-6 genome load, persistently detected in its BAL fluid. The baby underwent high-frequency oscillatory ventilation, hydroxychloroquine, steroids, and ganciclovir for 6 weeks and at 9 months she died. Next-generation sequencing of genes known to cause neonatal respiratory insufficiency revealed the presence of a "probably pathogenetic" heterozygous variant in the autosomal recessive DRC1 gene, a heterozygous variant of unknown significance (VUS) in the autosomal recessive RSPH9 gene, and a heterozygous VUS in the autosomal recessive MUC5B gene. HHV-6 infection should be considered in the differential diagnosis of late-onset severe respiratory distress in neonates and the co-occurrence of genetic predisposing factors or modifiers should be tested by specific molecular techniques. The intensity of HHV-6 genome load in BAL fluid could be an indicator of the response to antiviral therapy.

Background Systemic reactivation of herpesviruses may occur in intensive care unit (ICU) patients and is associated with morbidity and mortality. Data on severe Coronavirus disease-19 (COVID-19) and concomitant reactivation of herpesviruses are lacking. Methods We selected patients admitted to ICU for confirmed COVID-19 who underwent systematic testing for Epstein–Barr virus (EBV), cytomegalovirus (CMV) and human-herpes virus-6 (HHV-6) DNAemia while in the ICU. We retrospectively analysed frequency, timing, duration and co-occurrence of viral DNAemia. Results Thirty-four patients were included. Viremia with EBV, CMV, and HHV-6 was detected in 28 (82%), 5 (15%), and 7 (22%) patients, respectively. EBV reactivation occurred early after ICU admission and was associated with longer ICU length-of-stay. Conclusions While in the ICU, critically ill patients with COVID-19 are prone to develop reactivations due to various types of herpesviruses.

Background Naive T-cell-depleted grafts have been employed as an ex vivo T-cell depletion (TCD) platform to prevent graft-versus-host disease (GvHD) and improve immune reconstitution by providing rapid donor memory T-cell reconstitution after allogenic hematopoietic stem cell transplantation (allo-HSCT). CD45RA- memory T cells confer protection against viruses such as cytomegalovirus, Epstein-Barr virus, and adenovirus; however, reports have shown an unexpectedly high incidence of human herpesvirus (HHV)-6B encephalitis among pediatric allo-HSCT patients. Methods We report the first 18 consecutive allo-HSCT, 16 haplo-HSCT, and two human leukocyte antigen-matched related donors implanted with naive TCD grafts. All donors were administered three cell products: first, a CD34+ stem cell product; second, a CD45RA+ TCD graft, followed by an adoptive natural killer (NK) cell infusion within 10 days after HSCT. The study's primary endpoint was the incidence of HHV-6B encephalitis. Results Engraftment was achieved in 94.5% of cases; 2-year overall survival, event-free survival, and GvHD/relapse-free survival were 87.2% (95% CI 78.6-95.8), 67.3% (95% CI 53.1-81.5), and 64% (95% CI 50.5-78.1), respectively. HHV-6B reactivation occurred in 7 of the haplo-HSCT patients, six of who received a cell infusion with an NK/CD4 ratio Conclusions In this clinical study, we show that early adoptive NK cell infusion after a 45RA+ TCD allo-HSCT graft is safe and can prevent HHV-6B encephalitis. We recommend infusing adoptive NK cells after allo-HSCT using CD45RA+ TCD grafts.

IRAK4 deficiency is an inborn error of immunity predisposing patients to invasive pyogenic infections. Currently, there is no established simple assay that enables precise characterization of IRAK4 mutant alleles in isolation. Anti-N-methyl-D-aspartate receptor (NMDAR) encephalitis is an autoimmune condition that is characterized by psychiatric symptoms, involuntary movement, seizures, autonomic dysfunction, and central hypoventilation. It typically occurs in adult females associated with tumors. Only a few infantile cases with anti-NMDAR encephalitis have been so far reported. We identified a 10-month-old boy with IRAK4 deficiency presenting with anti-NMDAR encephalitis and human herpes virus 6 (HHV6) reactivation. The diagnosis of IRAK4 deficiency was confirmed by the identification of compound heterozygous mutations c.29_30delAT (p.Y10Cfs*9) and c.35G>C (p.R12P) in the IRAK4 gene, low levels of IRAK4 protein expression in peripheral blood, and defective fibroblastic cell responses to TLR and IL-1 (TIR) agonist. We established a novel NF-κB reporter assay using IRAK4-null HEK293T, which enabled the precise evaluation of IRAK4 mutations. Using this system, we confirmed that both novel mutations identified in the patient are deleterious. Our study provides a new simple and reliable method to analyze IRAK4 mutant alleles. It also suggests the possible link between inborn errors of immunity and early onset anti-NMDAR encephalitis. Electronic supplementary material The online version of this article (10.1007/s10875-020-00885-5) contains supplementary material, which is available to authorized users.

Bell's Palsy is the most frequent acute neuropathy of cranial nerves; it has been associated in various reports to herpes viruses. In a prospective study we searched the presence of DNA from five herpes viruses (HSV-1 and 2, VZV, EBV and HHV-6) in 79 patients at the acute phase of Bell's Palsy. Results were related with various parameters; age, gender and clinical outcome. We found the significant presence (p˂0.001) of HSV-1 and VZV in 39% and 42% of patients. However, a large percentage of cases were negative. When comparisons were made between subgroups according to gender and age no differences were found with viral findings nor with clinical outcome of palsy, which was of clinical remission in most cases (78%). Our results suggest that herpes viruses might participate in the complex mechanisms of autoimmunity of Bell's Palsy but not as determinant etiological element.

Background It is well known that febrile seizures are commonly occur in children with exanthem subitum. In this study, we compared the clinical features and backgrounds of patients with complex febrile seizures with and without primary human herpesvirus 6B infection. Methods Sixty-two patients were enrolled after experiencing their first febrile seizure. Primary human herpesvirus 6B infection was confirmed when human herpesvirus 6B DNA was detected and human herpesvirus 6B antibody was negative in serum obtained during the acute phase of infection. Patient age, gender, and features of seizures were evaluated between patients with and without human herpesvirus 6B infection. Results Thirty patients with complex febrile seizure were diagnosed with primary human herpesvirus 6B infection. Those with primary human herpesvirus 6B infection (median, 13 months; range, seven to 39 months) were significantly younger than those without primary human herpesvirus 6B infection (median, 19 months; range, 10 to 59 months) (P = 0.001), and the proportion of males was significantly higher in patients without primary human herpesvirus 6B infection (male/female, 25/7) than in those with the infection (male/female, 14/16) (P = 0.017). An interval between fever onset and seizures of more than 24 hours was significantly more common in patients with primary human herpesvirus 6B infection (15 of the 30 patients) than in those without primary HHV-6B infection (two of 32 patients) (P Conclusions A younger age at onset, a different gender ratio compared with febrile seizure due to other causes, and the length of interval between fever and seizures were features of complex febrile seizure associated human herpesvirus 6B infection. These findings may suggest a mechanism of complex febrile seizure onset different from that due to other causes.

Human herpesvirus 6 (HHV-6) encephalitis has a high mortality rate. Among those who survive, ~80% develop some type of permanent neurologic disorder. Early diagnosis and treatment may help prevent long-term sequelae. There have been several case reports as well as retrospective and prospective studies associating HHV-6 encephalitis with some form of sodium imbalance, either hyponatremia or hypernatremia; however, the exact frequency post-HCT is unknown, with reports ranging from 30% to 100%. We performed a systematic review of the literature and found 34 cases of HHV-6 encephalitis reported in conjunction with sodium imbalance that documented the timing of that imbalance relative to the onset of encephalitis. Sodium imbalance occurred before or at the onset of HHV-6 encephalitis in all but 2 cases (94%). This finding supports previous suggestions that sodium imbalance can be considered an early indicator of the potential development or presence of HHV-6 encephalitis in at-risk patient populations.

Human herpesviruses 6A and 6B, often referred to collectively as human herpesvirus 6, are a pair of beta-herpesviruses known to cause a variety of clinical syndromes in both immunocompetent and immunocompromised individuals. Most humans are infected with human herpesvirus 6B, and many with human herpesvirus 6A. Primary infection typically occurs in early childhood, although large-scale reviews on the topic are limited. Herein, the authors explore the clinical manifestations of human herpesvirus 6-associated disease in both immunocompetent and immunocompromised pediatric patients, the risk factors for development of human herpesvirus 6-associated neurological disease, the risk of autoimmunity associated with development of active or latent infection, the relevance of human herpesvirus 6-specific diagnostic tests, and the medications used to treat human herpesvirus 6. The goal of this review is to improve the current understanding of human herpesvirus 6 in pediatric populations and to examine the most effective diagnostic and therapeutic interventions in this disease state.

Myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) is a multifactorial disorder with many possible triggers. Human herpesvirus (HHV)–6 and HHV-7 are two infectious triggers for which evidence has been growing. To understand possible causative role of HHV-6 in ME/CFS, metabolic and antiviral phenotypes of U2-OS cells were studied with and without chromosomally integrated HHV-6 and with or without virus reactivation using the histone deacetylase inhibitor trichostatin-A. Proteomic analysis was conducted by pulsed stable isotope labeling by amino acids in cell culture analysis. Antiviral properties that were induced by HHV-6 transactivation were studied in virus-naive A549 cells challenged by infection with influenza-A (H1N1) or HSV-1. Mitochondria were fragmented and 1-carbon metabolism, dUTPase, and thymidylate synthase were strongly induced by HHV-6 reactivation, whereas superoxide dismutase 2 and proteins required for mitochondrial oxidation of fatty acid, amino acid, and glucose metabolism, including pyruvate dehydrogenase, were strongly inhibited. Adoptive transfer of U2-OS cell supernatants after reactivation of HHV-6A led to an antiviral state in A549 cells that prevented superinfection with influenza-A and HSV-1. Adoptive transfer of serum from 10 patients with ME/CFS produced a similar fragmentation of mitochondria and the associated antiviral state in the A549 cell assay. In conclusion, HHV-6 reactivation in ME/CFS patients activates a multisystem, proinflammatory, cell danger response that protects against certain RNA and DNA virus infections but comes at the cost of mitochondrial fragmentation and severely compromised energy metabolism.

Drug‐induced hypersensitivity syndrome (DIHS)/drug reaction with eosinophilia and systemic symptoms (DRESS) is a severe adverse drug reaction characteristically associated with sequential reactivation of herpesviruses, such as human herpesvirus 6 (HHV‐6), Epstein‐Barr virus (EBV), and cytomegalovirus (CMV). Since systemic corticosteroids are thought to result in viral reactivation due to their immunosuppressive effects, we clarified the influence of systemic corticosteroid therapy on viral reactivation in DIHS/DRESS. Viral DNA in peripheral whole blood and serum sIL‐2R level were measured during the disease course in twenty DIHS/DRESS patients. Six of seven patients treated without corticosteroids experienced HHV‐6 viremia associated with elevated serum sIL‐2R levels. In contrast, high‐dose corticosteroids started within 1 week after onset tended to inhibit the occurrence of HHV‐6 reactivation with remarkable suppression of serum sIL‐2R level. Low‐dose corticosteroids or late‐start high‐dose corticosteroids did not suppress occurrence of HHV‐6 viremia and the increase of sIL‐2R levels. HHV‐6 load in the blood was clearly correlated with the serum sIL‐2R level. On the other hand, increased CMV load were found in patients treated with corticosteroids regardless of the start time. The frequency of detection of EBV DNA in peripheral blood was similarly observed in all groups. In conclusion, high‐dose corticosteroids started within 1 week tended to suppress HHV‐6 reactivation through suppression of T cell activation. However, CMV proliferation was promoted by corticosteroids regardless of the start time. These observations suggested that careful consideration should be given to the dose and timing of administration of systemic corticosteroids in the treatment of DIHS/DRESS.

Objectives: To review the diagnostic criteria for encephalitis and encephalopathy of presumed infectious etiology, as well as the diagnostic workup for viral encephalitis and its treatment approaches. The authors also intended to summarize relevant information on specific viruses frequently found in Brazil. Source of data: Literature search on Pubmed/MEDLINE using the following keywords: “viral”, “encephalitis”, “child”, or “adolescents”, filtering for articles on humans and in English. Summary of data: Viral encephalitis is the most common cause of encephalitis and is responsible for high rates of morbidity, permanent neurologic sequelae, and according to the virus, may have high mortality rates. The most common etiologies are herpesviruses 1 and 2 (HSV‐1 and HSV‐2), non‐polio enterovirus, and arboviruses (in Brazil, dengue, Zika, and chikungunya). Other relevant etiologies are seasonal influenza, cytomegalovirus (CMV), Epstein‐Barr virus (EBV), human herpesvirus 6 (HHV‐6), and the re‐emergent measles. Conclusion: Clinical data, laboratory results, and neuroimaging findings support the diagnosis of encephalitis and the specific viral etiology. To increase the likelihood of etiologic confirmation, it is important to know the best approach to collecting samples and to choose the best identification technique for each virus. The differential diagnosis of viral encephalitis includes other infections and immune‐mediated inflammatory central nervous system disorders. Resumo: Objetivos: Revisar os critérios diagnósticos para encefalite e encefalopatia de etiologia infecciosa presumida, assim como a investigação diagnóstica para encefalite viral e suas abordagens terapêuticas. Além disso, pretendemos resumir tópicos relevantes sobre os vírus específicos frequentemente encontrados no Brasil. Fonte de dados: Pesquisa bibliográfica feita nos bancos de dados Pubmed/Medline utilizando as seguintes palavras-chave: “viral”, “encephalitis”, “child” ou “adolescents”, limitando os artigos a estudos em humanos e escritos em inglês. Resumo dos dados: A encefalite viral é a causa mais comum de encefalite e é responsável por altas taxas de morbidade, sequelas neurológicas permanentes e, de acordo com o vírus, altas taxas de mortalidade. As etiologias mais comuns são herpes vírus 1 e 2 (HSV‐1 e HSV‐2), enterovírus não pólio e arbovírus (no Brasil, Dengue, Zika e Chikungunya). Outras etiologias relevantes são a influenza sazonal, o citomegalovírus (CMV), o vírus Epstein‐Barr (EBV), o herpes vírus humano 6 (HHV‐6) e o sarampo reemergente. Conclusão: Dados clínicos, resultados laboratoriais e de neuroimagem apoiam o diagnóstico de encefalite e a etiologia viral específica. Para aumentar a probabilidade de confirmação etiológica, é importante conhecer a melhor abordagem para coletar amostras e escolher a melhor técnica de identificação para cada vírus. O diagnóstico diferencial de encefalite viral inclui outras infecções e distúrbios inflamatórios do sistema nervoso central imunomediados. Keywords: Viral encephalitis, Diagnosis, Treatment, Palavras‐chave: Encefalite viral, Diagnóstico, Tratamento

Roles for viral infections and aberrant immune responses in driving localized neuroinflammation and neurodegeneration in multiple sclerosis (MS) are the focus of intense research. Epstein-Barr virus (EBV), as a persistent and frequently reactivating virus with major immunogenic influences and a near 100% epidemiological association with MS, is considered to play a leading role in MS pathogenesis, triggering localized inflammation near or within the central nervous system (CNS). This triggering may occur directlyviaviral products (RNA and protein) and/or indirectlyviaantigenic mimicry involving B-cells, T-cells and cytokine-activated astrocytes and microglia cells damaging the myelin sheath of neurons. The genetic MS-risk factor HLA-DR2b (DRB1*1501β, DRA1*0101α) may contribute to aberrant EBV antigen-presentation and anti-EBV reactivity but also to mimicry-induced autoimmune responses characteristic of MS. A central role is proposed for inflammatory EBER1, EBV-miRNA and LMP1 containing exosomes secreted by viable reactivating EBV+ B-cells and repetitive release of EBNA1-DNA complexes from apoptotic EBV+ B-cells, forming reactive immune complexes with EBNA1-IgG and complement. This may be accompanied by cytokine- or EBV-induced expression of human endogenous retrovirus-W/-K (HERV-W/-K) elements and possibly by activation of human herpesvirus-6A (HHV-6A) in early-stage CNS lesions, each contributing to an inflammatory cascade causing the relapsing-remitting neuro-inflammatory and/or progressive features characteristic of MS. Elimination of EBV-carrying B-cells by antibody- and EBV-specific T-cell therapy may hold the promise of reducing EBV activity in the CNS, thereby limiting CNS inflammation, MS symptoms and possibly reversing disease. Other approaches targeting HHV-6 and HERV-W and limiting inflammatory kinase-signaling to treat MS are also being tested with promising results. This article presents an overview of the evidence that EBV, HHV-6, and HERV-W may have a pathogenic role in initiating and promoting MS and possible approaches to mitigate development of the disease.

Human endogenous retrovirus W family envelope proteins (pHERV-W ENV/syncytin-1) have been repeatedly associated with multiple sclerosis (MS). Here, we have focused on the study of pHERV-W ENV/syncytin-1 expression levels in MS patients (relapsing and progressive forms) and in healthy donors (HD) and on exploring their possible relationship with Epstein-Barr virus (EBV) and human herpesvirus-6A/B (HHV-6A/B). We included blood samples from 101 MS patients and 37 HD to analyze antiviral antibody titers by ELISA and pHERV-W ENV/syncytin-1 expression levels by flow cytometry as well as by qPCR. Patients with relapsing MS forms showed significantly higher pHERV-W ENV/syncytin-1 protein and gene expression levels than HD. Progressive MS patients also showed significantly higher protein and gene expression levels than both HD and relapsing MS patients. Regarding antiviral antibodies titers, anti-HHV-6A/B IgM levels were positively correlated with pHERV-W ENV/syncytin-1 protein expression levels in patients with relapsing MS, while in the progressive forms patients this correlation was found with anti-HHVA/B IgG levels. Therefore, pHERV-W ENV could be involved in MS pathogenesis, playing a role in relapsing and progressive forms. Besides, anti-HHV-6A/B antibodies positively correlated with pHERV-W ENV expression. Further studies are needed to better understand this possible relationship.

Cell–cell fusion is a fundamental and complex process that occurs during reproduction, organ and tissue growth, cancer metastasis, immune response, and infection. All enveloped viruses express one or more proteins that drive the fusion of the viral envelope with cellular membranes. The same proteins can mediate the fusion of the plasma membranes of adjacent cells, leading to the formation of multinucleated syncytia. While cell–cell fusion triggered by alpha- and gammaherpesviruses is well-studied, much less is known about the fusogenic potential of betaherpesviruses such as human cytomegalovirus (HCMV) and human herpesviruses 6 and 7 (HHV-6 and HHV-7). These are slow-growing viruses that are highly prevalent in the human population and associated with several diseases, particularly in individuals with an immature or impaired immune system such as fetuses and transplant recipients. While HHV-6 and HHV-7 are strictly lymphotropic, HCMV infects a very broad range of cell types including epithelial, endothelial, mesenchymal, and myeloid cells. Syncytia have been observed occasionally for all three betaherpesviruses, both during in vitro and in vivo infection. Since cell–cell fusion may allow efficient spread to neighboring cells without exposure to neutralizing antibodies and other host immune factors, viral-induced syncytia may be important for viral dissemination, long-term persistence, and pathogenicity. In this review, we provide an overview of the viral and cellular factors and mechanisms identified so far in the process of cell–cell fusion induced by betaherpesviruses and discuss the possible consequences for cellular dysfunction and pathogenesis.

Background Clinically mild encephalopathy with a reversible splenial lesion (MERS) is the second commonest cause of encephalopathy. Several pathogens have been detected in patients with MERS type 2, such as influenza A and B, but little is known about the proportion of cases of MERS type 2 with this pathogenesis. Human herpesvirus 6 (HHV6) is the second commonest pathogen causing acute encephalopathy. However, HHV6 has not been previously reported in patients with MERS type 2. Patient Description In this report, we describe a five-year-old boy with MERS type 2 caused by HHV6 infection. The present case was diagnosed with MERS type 2 caused by HHV6 infection based on the characteristic clinical course, the results of the virus testing, and imaging findings. Discussion This is the first description of MERS type 2 caused by HHV6 infection. Although there is a report of MERS type 1 caused by HHV6 infection, there are no detailed reports in the literature about MERS type 2 associated with HHV6 infection. Thus the clinical findings associated with MERS type 2 caused by HHV6 infection are poorly understood. This report indicates that HHV6 can cause MERS type 2.

Systemic sclerosis (SSc) is a connective tissue disease secondary to three cardinal pathological features: immune-system alterations, diffuse microangiopathy, and fibrosis involving the skin and internal organs. The etiology of SSc remains quite obscure; it may encompass multiple host genetic and environmental -infectious/chemical-factors. The present review focused on the potential role of environmental agents in the etiopathogenesis of SSc based on epidemiological, clinical, and laboratory investigations previously published in the world literature. Among infectious agents, some viruses that may persist and reactivate in infected individuals, namely human cytomegalovirus (HCMV), human herpesvirus-6 (HHV-6), and parvovirus B19 (B19V), and retroviruses have been proposed as potential causative agents of SSc. These viruses share a number of biological activities and consequent pathological alterations, such as endothelial dysfunction and/or fibroblast activation. Moreover, the acute worsening of pre-existing interstitial lung involvement observed in SSc patients with symptomatic SARS-CoV-2 infection might suggest a potential role of this virus in the overall disease outcome. A variety of chemical/occupational agents might be regarded as putative etiological factors of SSc. In this setting, the SSc complicating silica dust exposure represents one of the most promising models of study. Considering the complexity of SSc pathogenesis, none of suggested causative factors may explain the appearance of the whole SSc; it is likely that the disease is the result of a multifactorial and multistep pathogenetic process. A variable combination of potential etiological factors may modulate the appearance of different clinical phenotypes detectable in individual scleroderma patients. The in-deep investigations on the SSc etiopathogenesis may provide useful insights in the broad field of human diseases characterized by diffuse microangiopathy or altered fibrogenesis.

Background The etiology of intussusception, the leading cause of bowel obstruction in infants, is unknown in most cases. Adenovirus has been associated with intussusception and slightly increased risk of intussusception with rotavirus vaccination has been found. We conducted a case-control study among children Methods From 2015 to 2017, we enrolled 1-to-1 matched intussusception cases and hospital controls; 249 pairs were included. Stool specimens were tested for 37 infectious agents using TaqMan Array technology. We used conditional logistic regression to estimate odds ratio (OR) and 95% confidence interval (CI) of each pathogen associated with intussusception in a pooled analysis and quantitative subanalyses. Results Adenovirus (OR, 2.67; 95% CI, 1.75–4.36) and human herpes virus 6 (OR, 3.50; 95% CI, 1.15–10.63) were detected more frequently in cases than controls. Adenovirus C detection Conclusions In this comprehensive evaluation, adenovirus and HHV-6 were associated with intussusception. Future research is needed to better understand mechanisms leading to intussusception, particularly after rotavirus vaccination.

Reactivation of human herpesvirus (HHV)-6B is relatively common after allogeneic hematopoietic stem cell transplantation (HSCT) and HHV-6B diseases may consequently develop. Among them, HHV-6B encephalitis is a serious and often fatal complication. The aim of these clinical practice recommendations is to provide diagnostic and therapeutic guidance for HHV-6B encephalitis after allogeneic HSCT. In this evidence-based review, we critically evaluated data from the published literature. The Grading of Recommendations Assessment, Development and Evaluation (GRADE) methodology was used to assist in generating recommendations. We have summarized the findings that contribute to decision-making and we have provided our recommendations. In cases where rigorous clinical data are unavailable, recommendations have been developed in discussions with physicians who have relevant expertize.

Background: Hypothyroidism due to Hashimoto's thyroiditis (HT) is the commonest autoimmune endocrine illness in which antibodies against thyroid organ result in inflammation. The disease has a complex etiology that involves genetic and environmental influences. Viral infections may be involved in triggering of the disease as their molecular mimicry enhance autoimmune responses. Human herpesvirus-6 (HHV-6) is recognized for its contribution to some autoimmune diseases. Objective: In the current study, the prevalence of HHV-6 active infection in patients with HT and with non-autoimmune thyroid disorders were compared with patients with euthyroidism. In addition, a correlation between presence of HHV-6 infections and HT was investigated. Methods: A total of 151 patients with clinically and laboratory confirmed HT, 59 patients with non-autoimmune thyroid disorders, and 32 patients with normal thyroid function were included in the study. For further confirmation of HT disease, all the precipitants were tested for anti-thyroid peroxidase (TPO), and anti-thyroglobulin (TG) antibodies. For detection of both HHV-6 types A and B, nested PCR and restriction enzyme digestion were used. HHV-6 DNA positive samples were further investigated by DNA sequencing analysis. Results: HHV-6A DNA was found in serum sample of 57 out of 151 patients (38%) with HT, which was significantly more often than in patients with non-autoimmune thyroid disorders (p = 0.001). However, HHV-6 DNA was not detected in serum samples of euthyroid subjects. Conclusions: The results support a possible role for active HHV-6A infection, demonstrated by the presence of HHV-6 DNA in sera, in the development of HT. Keywords: Human herpesvirus 6, Prevalence, Hashimoto disease, Autoimmune diseases

An immunocompetent toddler came to medication attention with gastroenteritis, complicated by encephalopathy and hepatitis. Multiplexed testing using a polymerase chain reaction meningitis panel was positive for human herpesvirus 6 (HHV-6). Clinical correlation, quantitative HHV-6 polymerase chain reaction, and metagenomic next-generation sequencing supported a likely diagnosis of primary HHV-6B infection.

Infection with Human Herpesvirus-6 (HHV-6) has been associated with different epilepsy syndromes, including febrile seizures and status epilepticus, acute symptomatic seizures secondary to encephalitis and temporal lobe epilepsy. This neurotropic DNA virus is ubiquitous and primary infection occurs in up to 80% of children by age two years. While two viral variants have been identified, HHV-6B is the one that has been primarily linked to disease in humans, including epilepsy. After initial viremia, the virus can establish chronic latency in brain tissue, peripherally in tonsils and salivary glands and infect several different cell lines by binding to the complement regulator CD-46. In this review we will focus on discussing the evidence linking HHV-6 infection to different epilepsy syndromes and analyzing proposed pathogenic mechanisms.

DRESS syndrome (rash with eosinophilia and systemic symptoms) is an uncommon and severe drug-induced reaction.An 8-year-old boy was diagnosed with tonsillopharyngitis, and treatment with amoxicillin was started. One day later, he presented bilateral malar rash which evolved to generalized erythroderma in two days. He was referred to the emergency room and then he was discharged after the treatment with amoxicillin was discontinued. Five days later, he still had fever, progressive facial and acral edema, and ecchymotic lesions. The laboratory studies showed 6220 leukocytes/mm3 (970 eosinophils/mm3). The pharyngeal culture tested positive to human herpesvirus 6 (HHV-6). The fever, rash and edema disappeared with supportive measures. Based on the results of the allergy tests, a diagnosis of delayed reaction to aminopenicillin associated to HHV-6 mimicking DRESS syndrome was made, with the recommendation to avoid penicillin antibiotics.The diagnosis of delayed reactions to aminopenicillin and DRESS syndrome requires a high index of suspicion in order to promptly withdraw the offending medication and to avoid delays in the diagnosis.Antecedentes: El síndrome DRESS (erupción que cursa con eosinofilia y síntomas sistémicos) es una reacción inducida por fármacos poco frecuente y grave. Caso clínico: Niño de ocho años a quien se prescribió tratamiento con amoxicilina debido a diagnóstico de amigdalofaringitis. Un día después del inicio del medicamento, el paciente presentó erupción malar bilateral que evolucionó a eritrodermia generalizada en dos días. Fue derivado al servicio de urgencias donde se interrumpió el tratamiento con amoxicilina y fue dado de alta. Cinco días después, todavía tenía fiebre, edema facial y acral progresivo y lesiones equimóticas. Los estudios de laboratorio mostraron 6220 leucocitos/mm3 (970 eosinófilos/mm3). El cultivo faríngeo fue positivo al virus de herpes humano 6. La fiebre, la erupción y el edema desaparecieron con medidas de apoyo. Con base en los resultados de las pruebas de alergia, se realizó un diagnóstico de reacción tardía a la aminopenicilina asociada con herpesvirus de humano 6 que simulaba síndrome DRESS. La recomendación fue evitar los antibióticos con penicilina. Conclusiones: El diagnóstico de reacciones tardías a la aminopenicilina y el síndrome DRESS requieren un alto índice de sospecha para retirar rápidamente la medicación desencadenante y evitar retrasos en el diagnóstico.

Viral infection is a serious complication that can greatly affect patient mortality and morbidity after allogenic hematopoietic stem cell transplantation (allo-HSCT). For the early identification of patients at high risk for viral infection, we evaluated the impact of lymphocyte area under the curve (AUC) value as a new predictive factor for early immune reconstitution after allo-HSCT against viral infection. This study included 286 patients who underwent their first allo-HSCT at Kyoto University Hospital between 2005 and 2017. Lymphocyte AUC from day 0 to day +15 was calculated in the analysis of human herpesvirus 6 (HHV-6), and lymphocyte AUC from day 0 to day +30 was calculated in the analysis of other viruses (cytomegalovirus [CMV], adenovirus, BK virus, JC virus, and varicella zoster virus). The risk factors for each viral reactivation/infection were assessed by multivariate analysis. The median age at transplantation was 51 years (range, 17 to 68 years). The median lymphocyte AUC was 63/μL (range, 0 to 5620/μL) at day +15 and 3880 (range, 0 to 118, 260/μL) at day +30. An increase in lymphocyte AUC was significantly associated with a high frequency of HHV-6 reactivation (P = .033) and a low frequency of CMV antigenemia (P = .014). No apparent association was found between lymphocyte AUC and reactivation/infection of other viruses. Aplastic anemia as a primary disease (hazard ratio [HR], 5.34; P < .001) and cord blood as a donor source (HR, 3.05; P = .006) were other risk factors for HHV-6 reactivation. Other risk factors for CMV antigenemia included the occurrence of acute graft-versus-host disease (HR 2.21; P < .001) and recipient age (HR 1.55; P = .017). Higher lymphocyte AUC at day +30 was significantly associated with low treatment-related mortality (HR, .47; P = .045). Lymphocyte AUC may be a good predictive factor for immune reconstitution against CMV reactivation. It also provides valuable information for predicting HHV-6 reactivation and treatment-related mortality.

Of the two human herpesvirus 6 (HHV-6) species, human herpesvirus 6B (HHV-6B) encephalitis is an important cause of morbidity and mortality after allogeneic hematopoietic stem cell transplant. Guidelines for the management of HHV-6 infections in patients with hematologic malignancies or post-transplant were prepared a decade ago but there have been no other guidelines since then despite significant advances in the understanding of HHV-6 encephalitis, its therapy, and other aspects of HHV-6 disease in this patient population. Revised guidelines prepared at the 2017 European Conference on Infections in Leukaemia covering diagnosis, preventative strategies and management of HHV-6 disease are now presented.

Human herpes virus-6 (HHV6)-associated myelitis and calcineurin inhibitor–induced pain syndrome (CIPS) are serious complications of allogeneic hematopoietic stem cell transplantation (allo-HSCT). Because these 2 complications cause similar sensory nerve–related symptoms, such as paresthesia, pruritus, and severe pain occurring around the engraftment, it can be difficult to differentially diagnose the 2 conditions. We retrospectively analyzed 435 recipients to distinguish clinical symptoms of these 2 complications. Twenty-four patients (5.5%) developed HHV6-associated encephalitis/myelitis; of these, 11 (2.5%) presented only with myelitis-related symptoms (HHV6-associated myelitis), which was confirmed by the detection of HHV6 DNA, and 8 (1.8%) had CIPS, with undetected HHV6 DNA. All patients with HHV6-associated myelitis or CIPS exhibited similar sensory nerve–related symptoms. Diagnostic images did not provide definite evidence specific for each disease. Symptoms of all patients with CIPS improved after switching to another immunosuppressant. Overall survival rate at 2 years for patients with HHV6-associated encephalitis/myelitis was significantly lower than that of CIPS (13.1% versus 29.2%; P = .049) or that of patients without HHV6-associated encephalitis/myelitis or CIPS (42.4%; P = .036), whereas there was no significant difference among the latter 2 groups (P = .889). The development of HHV6-associated encephalitis/myelitis but not CIPS was significantly associated with poor prognosis. Thus, transplant physicians should be aware that sensory nerve–related symptoms indicate early manifestations that might be correlated with reactivation of HHV6 or CIPS. Therefore, identification of HHV6 DNA is crucial for making a differential diagnosis and immediately starting appropriate treatments for each complication.

Summary Amyloid-β peptide (Aβ) fibrilization and deposition as β-amyloid are hallmarks of Alzheimer's disease (AD) pathology. We recently reported Aβ is an innate immune protein that protects against fungal and bacterial infections. Fibrilization pathways mediate Aβ antimicrobial activities. Thus, infection can seed and dramatically accelerate β-amyloid deposition. Here, we show Aβ oligomers bind herpesvirus surface glycoproteins, accelerating β-amyloid deposition and leading to protective viral entrapment activity in 5XFAD mouse and 3D human neural cell culture infection models against neurotropic herpes simplex virus 1 (HSV1) and human herpesvirus 6A and B. Herpesviridae are linked to AD, but it has been unclear how viruses may induce β-amyloidosis in brain. These data support the notion that Aβ might play a protective role in CNS innate immunity, and suggest an AD etiological mechanism in which herpesviridae infection may directly promote Aβ amyloidosis.

Human herpesvirus 6B (HHV-6B) is a ubiquitous pathogen that infects most individuals before the age of three years. HHV-6B reactivates in approximately 40% of transplant recipients where it has been associated with a number of important outcomes, especially in allogeneic transplant recipients. This article will review the epidemiology, clinical manifestations, diagnosis, and treatment of HHV-6B infection.

Multisystem inflammatory syndrome in children (MIS-C) is a serious, sometimes life-threatening late complication of coronavirus disease 2019 (COVID-19) with multiorgan involvement and evidence of immune activation. The pathogenesis of MIS-C is not known, nor is the pathogenesis of the severe organ damage that is the hallmark of MIS-C. Human herpesvirus 6 (HHV-6), the virus responsible for roseola, is a ubiquitous herpesvirus that causes close to universal infection by the age of 3 years. HHV-6 remains latent for life and can be activated during inflammatory states, by other viruses, and by host cell apoptosis. HHV-6 has been associated with end-organ diseases, including hepatitis, carditis, and encephalitis. In addition, ∼1% of people have inherited chromosomally integrated human herpesvirus 6 (iciHHV-6), which is HHV-6 that has been integrated into chromosomal telomeric regions and is transmitted through the germ line. iciHHV-6 can be reactivated and has been associated with altered immune responses. We report here a case of MIS-C in which an initial high HHV-6 DNA polymerase chain reaction viral load assay prompted testing for iciHHV-6, which yielded a positive result. Additional research may be warranted to determine if iciHHV-6 is commonly observed in patients with MIS-C and, if so, whether it may play a part in MIS-C pathogenesis.

Herpesviruses like Epstein-Barr virus, human herpesvirus (HHV)-6, HHV-1, VZV, and human endogenous retroviruses, have an age-old clinical association with multiple sclerosis (MS). MS is an autoimmune disease of the nervous system wherein the myelin sheath deteriorates. The most popular mode of virus mediated immune system manipulation is molecular mimicry. Numerous herpesvirus antigens are similar to myelin proteins. Other mechanisms described here include the activity of cytokines and autoantibodies produced by the autoreactive T and B cells, respectively, viral deja vu, epitope spreading, CD46 receptor engagement, impaired remyelination etc. Overall, this review addresses the host-parasite association of viruses with MS.

Like all herpesviruses, the roseoloviruses (HHV6A, -6B, and -7) establish lifelong infection within their host, requiring these viruses to evade host antiviral responses. One common host-evasion strategy is the downregulation of host-encoded, surface-expressed glycoproteins. Roseoloviruses have been shown to evade the host immune response by downregulating NK-activating ligands, class I MHC, and the TCR/CD3 complex. To more globally identify glycoproteins that are differentially expressed on the surface of HHV6A-infected cells, we performed cell surface capture of N-linked glycoproteins present on the surface of T cells infected with HHV6A, and compared these to proteins present on the surface of uninfected T cells. We found that the protein tyrosine phosphatase CD45 is downregulated in T cells infected with HHV6A. We also demonstrated that CD45 is similarly downregulated in cells infected with HHV7. CD45 is essential for signaling through the T cell receptor and, as such, is necessary for developing a fully functional immune response. Interestingly, the closely related betaherpesviruses human cytomegalovirus (HCMV) and murine cytomegalovirus (MCMV) have also separately evolved unique mechanisms to target CD45. While HCMV and MCMV target CD45 signaling and trafficking, HHV6A acts to downregulate CD45 transcripts. IMPORTANCE Human herpesviruses-6 and -7 infect essentially 100% of the world's population before the age of 5 and then remain latent or persistent in their host throughout life. As such, these viruses are among the most pervasive and stealthy of all viruses. Host immune cells rely on the presence of surface-expressed proteins to identify and target virus-infected cells. Here, we investigated the changes that occur to proteins expressed on the cell surface of T cells after infection with human herpesvirus-6A. We discovered that HHV-6A infection results in a reduction of CD45 on the surface of infected T cells and impaired activation in response to T cell receptor stimulation.

Purpose Although viral infections are frequent among patients with hematological malignancies (HM), data about herpesviridae in critically ill hematology patients are scarce. We aimed at determining the impact of herpesviridae reactivation/infection in this population. Material and methods We performed a single center retrospective study including all consecutive adult hematology patients admitted to our comprehensive cancer center ICU on a 6-year period. Clinical characteristics, microbiological findings, especially virus detection and outcome were recorded. Results Among the 364 included patients, HHV-6 was the predominant retrieved herpesviridae (66 patients, 17.9%), followed by HSV1/2 (41 patients, 11.3%), CMV (38 patients, 10.4%), EBV (24 patients, 6.6%) and VZV (3 patients). By multivariable analysis, HHV-6 reactivation was independently associated with hospital mortality (OR, 2.35; 95% CI, 1.03–5.34; P = 0.042), whereas antiviral prophylaxis during ICU stay had a protective effect (OR, 0.41; 95% CI, 0.18–0.95; P = 0.037). HHV-6 pneumonitis was independently associated with 1-year mortality (OR, 6.87; 95% CI, 1.09–43.3; P = 0.04). Conclusions Among critically ill hematology patients, HHV-6 reactivation and pneumonitis are independent risk factors for hospital and 1-year mortality, respectively. Impact of prevention and treatment using agents active against HHV-6 should be assessed to define a consensual diagnostic and therapeutic strategy.

Epstein–Barr virus (EBV), human herpesvirus 6A/B (HHV-6A/B) and multiple sclerosis (MS)-associated retrovirus (MSRV) have been described as possible MS triggers. We analysed antibody titres against EBV and HHV-6, and MSRV envelope (env) mRNA expression, in the serum of pregnant multiple sclerosis patients (P-MS) to study their possible link to the clinical activity of MS during pregnancy and postpartum and their possible role as relapse predictors. For that purpose, serum samples were collected from 71 pregnant women (50 pregnant MS and 21 pregnant healthy controls—P-HC) during pregnancy and postpartum. Relating to antibody titres, IgM antibody titres against HHV-6A/B were significantly higher in P-MS than in P-HC both in each pregnancy trimester and in the postpartum period. Moreover, IgM antibody titres against HHV-6A/B were higher in P-MS who suffered a relapse during the postpartum. Regarding MSRV env mRNA expression, the prevalence in the first trimester of pregnancy was significantly higher in P-MS who suffered relapses during pregnancy. Summing it up, high IgM antibody titres against HHV-6A/B and MSRV env mRNA expression during the first trimester of pregnancy could act as relapse predictors for the gestation/postpartum periods.

Human herpesvirus-6 (HHV-6) reactivation is an important complication in patients receiving umbilical cord blood transplantation (CBT). Chromosomally integrated human herpesvirus-6 (ciHHV-6) is a condition in which the complete HHV-6 genome is integrated into the host germline genome and is transmitted in a Mendelian manner. The influence of ciHHV-6 in recipients or donors in cases of CBT is unknown. We report the first case with ciHHV-6 that received CBT twice for acute lymphoblastic T-cell leukemia. HHV-6 DNA in peripheral blood leukocytes (PBLs) was examined over time through two CBTs. After the first CBT, the HHV-6 viral load was significantly reduced by conversion to PBLs derived from the first donor. During the second CBT, an increase in HHV-6 DNA in PBLs and plasma were observed. However, HHV-6 mRNA was not detected in either the sample before 2nd CBT or at the time of HHV-6 DNA elevation. It is considered that the HHV-6 DNA detected in PBLs and plasma samples might be the HHV-6 genome released due to tissue damage. This case suggests that physicians should be aware of HHV-6 DNA variability during allogeneic hematopoietic stem cell transplantation in ciHHV-6 patients.

Patient: Female, 51-year-old Final Diagnosis: Drug-induced hypersensitivity syndrome, consistent with DRESS • human herpesvirus 6 reactivation Symptoms: Liver dysfunction • appearance of a skin rash • eosinophilia • fever Medication: — Clinical Procedure: — Specialty: Allergology • Infectious Diseases Objective: Rare disease Background: Infection with human herpesvirus 6 (HHV-6) is a recognized risk factor for the development of drug-induced hypersensitivity syndrome (DIHS). DIHS is a systemic autoimmune condition that presents with mucocutaneous lesions of varying severity and comprises 3 subtypes: toxic epidermal necrolysis, Stevens–Johnson syndrome, and drug reaction with eosinophilia and systemic symptoms (DRESS). Here, we describe the case of a 51-year-old woman with a diagnosis of DIHS associated with carbamazepine, reactivation of HHV-6, and acute liver failure, which was consistent with DRESS. Case Report: We present the case of a 51-year-old Japanese woman who had been taking carbamazepine for epilepsy for the past 3 weeks. She presented with a fever, liver dysfunction, eosinophilia, and the sudden appearance of a skin rash. Steroid therapy was started for suspected drug-induced liver injury. The skin eruption disappeared, and liver dysfunction showed an improving trend. However, after stopping steroid, the pyrexia and eosinophilia reappeared. Therefore, prednisolone was re-administrated. HHV-6 DNA was detected, so HHV-6 reactivation was confirmed. Carbamazepine was stopped, and the clinical manifestations improved. She was ultimately diagnosed with DIHS, consistent with DRESS, associated with carbamazepine and HHV-6 reactivation, and liver dysfunction was assessed histologically. Therefore, the drug-related hepatotoxicity of carbamazepine played a role in causing liver damage rather than HHV-6 infection at that time. Conclusions: We describe a case of DIHS that was also associated with acute liver failure, consistent with DRESS. The case highlights the importance of making the correct diagnosis, as well as the management of mucocutaneous lesions and other systemic conditions (including acute liver failure).

Background Distinctions between HHV-6 primary infection in seronegative patients and HHV-6 reactivation in seropositive patients remains largely undescribed in pediatric liver transplant (LT) recipients. Methods We implemented pretransplant serology testing of HHV-6 in a large pediatric hospital and retrospectively assessed the incidence, manifestations and outcomes of HHV-6 infections over a 3-year period. Results Among 101 pediatric LT recipients, 96 had pretransplant HHV-6 serologies; 34 (35.4%) were seronegative and 62 (64.6%) seropositive. Posttransplantation, 8/25 (32%) seronegative patients had HHV-6 DNAemia (primary infection) compared to 2/48 (4%) seropositive patients (p=0.002). Compared to seropositive patients, seronegative patients with HHV-6 DNAemia were younger, and had symptoms of fever and/or elevated aminotransferases in association with higher viral loads, in the first month post-transplant. More than 90% of seronegative patients and 77.8% of seropositive patients had HHV-6 detected by PCR in liver biopsy obtained for concerns of allograft rejection, but most had no detectable concomitant DNAemia. Active replication of virus in the liver was confirmed by in situ hybridization in select cases. While HHV-6 infection occurred among patients on prophylaxis doses of antivirals for CMV, HHV-6 DNAemia and presenting symptoms resolved on treatment doses. Conclusions HHV-6 DNA-emia occurred more frequently in seronegative pediatric LT recipients, usually in the early posttransplant period, and was subsequently detected in allograft biopsies. HHV-6 cannot be ruled out as a cause of hepatitis in the absence of allograft tissue testing and specialized virological assays, as HHV-6 may disrupt local allograft immune homeostasis while evading traditional screening methods using blood or plasma. The assessment of pre-transplant HHV-6 serological status may be important for risk stratification and post-transplant management of pediatric LT recipients

BACKGROUND Human herpesvirus 6 (HHV-6) reactivation is relatively common after allogeneic hematopoietic stem cell transplantation (allo-HSCT). However, the incidence of HHV-6 reactivation and the clinical outcomes following unmanipulated haploidentical HSCT (haplo-HSCT) remain unknown. METHOD We prospectively monitored blood HHV-6 DNA using real-time quantitative polymerase chain reaction weekly until day 100 post unmanipulated haplo-HSCT in patients with hematological malignancies. RESULTS From November 2016 to March 2017, 102 patients (58 male and 44 female, median age 25(2-58) years old) were enrolled. Within 100 days post-transplantation, 27 patients (27/136, 19.9%) developed HHV-6 viremia with a median onset time of 14 (7-98) days. The cumulative incidence of HHV-6 reactivation on day 100 post-HSCT was 25.5 ± 4.3% in haplo-HSCT. The median HHV-6 copy number was 1.45 × 103 (5.48 × 102 -2.00 × 104 ) copies/ml. The HHV-6 viremia duration time was 7 days in 23 patients, 14 days in one patient and 21 days in one patient. In multivariate analysis, prior HHV-6 reactivation was an independent risk factor for grade 2-4 graft-versus-host disease (GVHD). But it did not influence the overall survival (OS)(HR 1.624, 95%CI 0.768-3.432, P = .204), disease-free survival (DFS) (HR 1.640, 95%CI 0.799-3.367, P = .177) and non-relapse mortality (NRM) (HR 1.644, 95%CI 0.670-4.038, P = .278). CONCLUSION The reactivation of HHV-6 after unmanipulated haploidentical transplantation predicts the occurrence of grade 2-4 a-GVHD, but it may not influence the overall survival (OS), disease-free survival (DFS) and non-relapse mortality (NRM).

Human herpes virus-6 (HHV-6) reactivates in ~75% of cord blood transplant (CBT) recipients at a median of 2-3 weeks post-transplant1-3 . This contrasts with peripheral blood or bone marrow allografts where HHV-6 reactivation is uncommon4 . In a previous study of 23 CBT recipients, 52% of patients had detectable HHV-6 by whole blood qPCR at a median of 3.9y (range 1.3-7.1) post-transplant5 . Because whole blood qPCR can be positive with both latent virus and viremia, these results do not distinguish between the two scenarios. While long-term intracellular persistence of the latent virus is expected, persistent viremia (i.e., extracellular virus) may suggest the graft's inability to clear viremia. We report our long-term findings using serum, rather than whole blood, to distinguish latent from replicating HHV-6.

This review presents the data on the spreading of all known human herpesviruses (НHVs) in female urogenital tract. According to the WHO almost 500 million people worldwide suffer from genital infection caused by НHVs. НHVs were detected in various inflammatory diseases of female upper and lower genital tract (vaginitis and cervicitis), in extrauterine pregnancy (in fallopian tubes), in infertility (cervical channel, endometrium and ovaries). Herpes simplex virus 1 (HSV‑1) was identified for the first time in oocytes after failed in vitro fertilization (IVF). НHVs produce negative effect on the entire reproductive process from conception to childbirth. It was established that HSV, cytomegalovirus (CMV) and human herpesvirus 6 (HHV-6) markedly increase the risk of spontaneous abortion, preterm birth and stillbirth. Intrauterine НHV infection is a major cause of congenital malformations. Data on humoral and cell immunity in genital herpesvirus infections (НHVI) are also reviewed. Intravaginal HSV‑2 infection changes cell composition of vaginal mucosa, i.e., together with cells mobilized from the blood, protective role is performed by resident memory T‑cells (TRM), natural killer cells (NK‑cells) and regulatory T‑cells (Treg) whose function consists in maintaining the balance of the activities of lymphocytes. Constant НHVI spreading is largely explained by transition of primary infection to potentially reactivating latent form, since latent virus is unavailable to immune recognition and medicines. The genome editing system CRISPR/Cas9 can recognize and modify not only active but also latent viruses. The promising pilot results with the use of this system offer the possibility of developing innovative technologies for НHV elimination and НHVI eradication.

Pityriasis rosea (PR) is a dermatological disease with an erythemato-papulosquamous manifestation, distributed on the trunk and extremities affecting healthy people, especially children and young people between 10 and 35 years of age. The evolution is 6 to 8 weeks and may remain for 3 to 6 months. It regresses spontaneously and can leave changes in the skin color but reversibly. Acyclovir is indicated to minimize clinical manifestations with the suspected of viral association (HHV-6 and 7). Another group of the human herpesvirus family (HHV-1 and 2), causes herpes simplex that is controlled with the antivirals, including acyclovir, as well as the amino acid L-lysine, both showing positive and similar results in reducing the number of annual manifestations and the healing time of the lesions. The aim of this study is to report a case of PR in a child, to review the literature on the etiopathogenesis of the disease and on the effects of L-lysine as well as another amino acid in the treatment. An 11-year-old girl, phototype II, presented lesions diagnosed as PR. The cycle would be 6 to 8 weeks on average. A solution of L-lysine was prescribed for 30 days, on an empty stomach. After the fourth day of therapy, the cycle of new eruptions was interrupted, initial lesions regressed, accelerating the repair of larger lesions resulting in an improvement of the clinical condition. We concluded that the administration of L-lysine, in therapeutic doses, can be a safe alternative for the PR control.

Background In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. Methods The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. Results The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. Conclusion With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

Drug reaction with eosinophilia and systemic symptoms (DRESS) syndrome is a severe cutaneous drug reaction characterized by fever, lymphadenopathy, hematologic abnormalities, multisystem involvement, and viral reactivation. Although most patients with DRESS syndrome are able to fully recover, a subset of patients go on to have a prolonged course with recurrence, and/or autoimmune complications. Severe systemic involvement is associated with significant morbidity and mortality. Viral reactivation, especially of human herpes virus 6, Epstein-Barr virus, and cytomegalovirus, is a common feature of DRESS, with a high viral load and antibody titers being associated with poor outcomes. Aside from prompt discontinuation of the offending drug, treatment for patients with significant disease consists of systemic therapy with corticosteroids.

Human herpesvirus 6A (HHV-6A) and human herpesvirus 6B (HHV-6B), collectively termed HHV-6A/B, are neurotropic viruses that permanently infect most humans from an early age. Although most people infected with these viruses appear to suffer no ill effects, the viruses are a well-established cause of encephalitis in immunocompromised patients. In this review, we summarize the evidence that the viruses may also be one trigger for febrile seizures (including febrile status epilepticus) in immunocompetent infants and children, mesial temporal lobe epilepsy, multiple sclerosis (MS), and, possibly, Alzheimer’s disease. We propose criteria for linking ubiquitous infectious agents capable of producing lifelong infection to any neurologic disease, and then we examine to what extent these criteria have been met for these viruses and these diseases.

Human herpesvirus 6 (HHV-6) can integrate its genome in human chromosomes and be germline transmitted (inherited chromosomally integrated HHV-6). We report a case of chromosomally integrated HHV-6 inherited from the mother unexpectedly diagnosed in a septic neonate. Since HHV-6 has recently been included in multiplex polymerase chain reaction assays for meningitis/encephalitis, diagnosing inherited chromosomally integrated HHV-6 status is essential to avoid misdiagnosis of active HHV-6 infection and unnecessary antiviral treatment.