Search

Herpesviruses encode miRNAs that target both virus and host genes; however their role in herpesvirus biology is still poorly understood. We previously identified thirty five miRNAs encoded by OvHV-2; the causative agent of malignant catarrhal fever (MCF) and are investigating the role of these miRNAs in regulating expression of OvHV-2 genes that play important roles in virus biology. Analysis, using RNAHybrid predicted that two OvHV-2 encoded miRNAs, ovhv2-miR-17-10 and ovhv2-miR-61-1, target transcripts coding for the OvHV-2 bZIP protein Ov2. In other herpesvirus bZIP proteins are known to play important roles in lytic virus replication. Here we show by Flow cytometry and western blotting that ovhv2-miR-17-10 and ovhv2-miR-61-1, reduce the expression of Ov2 protein. The predicted target sites for both miRNAs within the Ov2 gene were disrupted whilst retaining the Ov2 coding sequence. Mutation of the ovhv2-miR-61-1 target sequence restored Ov2 protein expression levels to control levels confirming the identity of its target site. However, it was not possible to determine the binding site of ovhv2-miR-17-10 possibly due to potential G:U pairing introduced during the mutation process. The targeting of Ov2 by two virus-encoded miRNAs suggests an important regulatory role for Ov2 in OvHV-2 replication or reactivation.

We produced a genome wide CRISPR knockout library, btCRISPRko.v1, targeting all protein coding genes in the cattle genome and used it to identify host genes important for Bovine Herpes Virus Type 1 (BHV-1) replication. By infecting library transduced MDBK cells with a GFP tagged BHV-1 virus and FACS sorting them based on their GFP intensity, we identified a list of pro-viral and anti-viral candidate host genes that might affect various aspects of the virus biology, such as cell entry, RNA transcription and viral protein trafficking. Among them were VPS51, VPS52 and VPS53 that encode for subunits of two membrane tethering complexes EARP and GARP. Simultaneous loss of both complexes in MDBKs resulted in a significant reduction in the production of infectious cell free BHV-1 virions, suggesting the vital roles they play during capsid re-envelopment with endocytosed membrane tubules prior to endosomal recycling mediated cellular egress. We also observed potential capsid retention and aggregation in the nuclei of these cells, indicating that they might also indirectly affect capsid egress from the nucleus. The btCRISPRko.v1 library generated here greatly expanded our capability in BHV-1 related host gene discovery; we hope it will facilitate efforts intended to study interactions between the host and other pathogens in cattle and also basic host cell biology.

In this report we demonstrate that the herpes simplex virus type 1 reiteration element 1 (RE1) (nt: 117158–117353) in concert with its flanking sequences is both a cell specific and stimulus inducible regulatory domain. This region of the virus genome and specifically the RE1 supports differential reporter gene expression in both baby hamster kidney cells and disassociated rat trigeminal ganglia and is present within a region that is implicated in regulating latency of the virus in neuronal cells. Further we demonstrate that this locus is a transcriptional regulatory domain and a target for the transcription factor CCCTC binding protein.

Alcelaphine herpesvirus-1 (AlHV-1) is the causative agent of Malignant Catarrhal fever, a lymphoproliferative and degenerative disease of large ruminants and ungulate species. The Alcelaphine Herpesvirus-1 gene product encoded by open reading frame 57 (ORF 57) is the positional homologue of the ORF 57 of Herpes Virus Saimiri (HVS), Kaposi's Sarcoma associated herpesvirus (KSHV) and Murine Gammaherpesvirus 68 (MHV 68), the Epstein-Barr virus BMLF1 gene, the herpes simplex virus (HSV-1) ICP 27 and the IE 4 gene of Varicella Zoster virus (VZV). In these viruses the ORF 57 gene product is expressed very early and encodes a regulatory protein, which is essential for viral replication acting both at the transcriptional and post-transcriptional levels. The function of ORF 57 gene product in the life cycle of AlHV-1 however remains unknown. Here we examined the expression of this gene and the function of its product. We have demonstrated that it is expressed very early in infection and have shown that the ORF57 gene product activates the promoter of another classical transactivator gene ORF50. It activates ORF50 promoter driving expression of an intron-less reporter gene to 50 fold and does not have any effect on an intron-containing reporter gene driven by the ORF 50 promoter. The 50 fold increase in the luciferase activity was not correlated with a similar fold increase in the luciferase RNA levels indicating that ORF 57 protein acts at a post-transcriptional level to regulate gene expression.

The various members of the different pattern recognition receptor families are now recognized as playing a crucial role in the initial interactions between a pathogen and the host. This paper identifies all 10 members of the TLR family in sheep as well as key members of the C-type lectin and NLR families. Our data show that sheep possess the ‘human’ and not the ‘mouse’ pattern of TLRs and confirm the high degree of sequence identity between orthologous genes in the different species. In the absence of definitive antibodies, qRT-PCR assays were developed to quantify PRR transcript expression patterns in a range of normal sheep tissues as well as isolated dendritic cell (DC) and leukocyte subsets. These data show that the lymphoid organs (spleen and lymph nodes) express the widest range of PRRs and that organs such as the lung and kidney have distinctive arrays of PRRs that reflect their potential risk of pathogen exposure. In addition we show that the two DC subsets, defined by the differential expression of CD172a/CD45RA and their cytokine expression profiles, have different and characteristic PRR complements again possibly reflecting their distinctive function. These data are important for future studies on the role of PRRs in disease pathogenesis and control.

The aim of this study was to investigate the skin immunopathology of gene gun-delivered plasmid-encoded granulocyte-macrophage colony-stimulating factor (pGM-CSF) and hence explore the possible mechanisms of its adjuvant activity. Using sheep as the experimental model, expressible pGM-CSF was administered to the epidermis and the dermal/epidermal junction and its effects on the skin were assessed by histopathology, immunohistology and quantitative RT-PCR for a range of pro-inflammatory and immune response-polarizing cytokines. Both functional and non-functional plasmids caused an acute inflammatory response with the infiltration of neutrophils and micro-abscess formation; however, the response to pGM-CSF was more severe and was also associated with the accumulation of eosinophils, immature (CD1b(-)/CD172a(-)) dendritic cells and B cells. In terms of cytokine expression, an early TNF-alpha response was stimulated by gene gun delivery of plasmid-associated gold beads, which coincided with an immediate infiltration of neutrophils. However, only pGM-CSF triggered the short-lived expression of GM-CSF (peaking at 4 h) and significant long-term increases in both TNF-alpha and IL-1beta. pGM-CSF did not affect the expression of the immune response-polarizing cytokines, IL-10 and IL-12.

The most common complication of herpes zoster is post-herpetic neuralgia (PHN), which has been defined as severe pain occurring 1 month after rash onset or persisting for greater than 3 months. PHN is classed as a neuropathic pain that is associated with mechanical allodynia where normally innocuous tactile stimuli are perceived as painful. The development of therapies to treat PHN has been hampered by the lack of animal models, which mimic the clinical situation. We have previously reported that varicella zoster virus (VZV) infection in the rat results in mechanical allodynia and thermal hyperalgesia. Here, we report that following VZV infection of the left footpad rats develop a chronic mechanical allodynia, which is present for longer than 60 days post-infection and which resolves by 100 days PI. The model is robust and reproducible with animals consistently developing allodynia by 3 days PI and continuing to present with symptoms for at least 30 days. The reproducible nature of the induction and course of the allodynia allows the use of this model to determine the effect of various compounds on, and to investigate the pathogenic mechanisms underlying the development of VZV-induced allodynia. Comparative studies using HSV-1 show that the induction of the chronic allodynia is VZV-specific and is not a result is of virus replication-induced tissue damage or accompanying inflammation. Therefore, we propose that the rat VZV infection model could prove useful in studying the mechanisms underlying post-herpetic neuralgia.

This chapter discusses the various factors that contribute to the failure of host defense mechanism in eliminating microbes. One way of looking at persistent infections is to regard them as failures of the host defense mechanisms which are designed to eliminate invading microorganisms from tissues. Persistent infections usually represent a secondary event, following on from an initial acute infection. In certain acute infections the patient appears to recover, but there is later a relapse. Many of the severe infections causing illness and death in communities (poliomyelitis, plague, yellow fever, cholera) are not persistent and the microorganisms are eliminated from the body after recovery. Persistent infections are often important from the microbe's point of view, enabling it to be maintained in small or isolated host communities. Persistent infections also generally present problems in the development of vaccines. They are becoming relatively more important, both for the individual and for the community, as the nonpersistent infections are eliminated by public health measures and by vaccination. Not only may they reactivate and cause troublesome infections in immunocompromised or immunosuppressed patients, but some of them can cause malignant tumors.

This chapter describes the role of the innate and adaptive immune responses during infection. It highlights the importance of Pattern Recognition Receptor (PRR) in signalling cytokine production and the activation and proliferation of the macrophages, NK cells and dendritic cells (DCs). DCs provide the key link between the innate and adaptive immune systems by processing and presenting microbial antigens via the MHC system to CD8+ T cytotoxic and T helper lymphocytes. CD4+ T helper (Th) cells are defined by the cytokines they produce and their effector and regulatory function in vivo. An important function of Th cells is to provide help for B cell proliferation and maturation, for the proliferation of cytotoxic T cells and for activating macrophages at sites of infection. The significance of antibody and T cells in the immune response to selected pathogens is presented. In addition, sections on NK cells and the complement system have been updated.

This chapter focuses on some of the host and microbial factors influencing susceptibility to disease. These factors include genetic factors in the microorganism, genetic factors in the host, hormonal factors, and stress. The microorganism's ability to infect a given host is genetically determined and many microorganisms infect only one particular host species. Pathogenicity or virulence is also a function of the microbial genome. Virulence is being increasingly recognized to depend on coordinated expression of numerous genes, whose products mediate adherence, antiphagocytic activity, immune evasion, production of toxins, etc. Susceptibility to infectious disease is always influenced and is sometimes determined by the genetic constitution of the host. Inflammation makes an important contribution to tissue damage and pathology in infectious disease and injected corticosteroids (or ACTH) have a pronounced anti-inflammatory effect; their therapeutic use in infectious diseases depending on a reduction in the inflammatory pathological components at sites of infection. Increased circulating levels of corticosteroid hormones are necessary for a successful host response to infectious disease. A host of miscellaneous factors, such as smoking, seasonal changes mental state, influence the course of infectious diseases.

This chapter addresses the mechanisms by which pathogens evade the host immune responses. The concepts of induced tolerance and energy are discussed and this continues into coverage of the induction of a generalised immunosuppression by pathogens. Strategies used by the pathogen to evade an immune response, e.g. restricted expression of antigens, the structure of the bacterial cell wall, infection of sites where the immune response is ineffficient, the avoidance of the interferon response and the induction of inappropriate immune responses, e.g. non-neutralising antibodies and the Th1/TH2 balance are discussed. Finally antigenic variation both within the host (e.g. HIV, Trypanosomes) and the population (influenza) are discussed.

In this chapter we describe the key events associated with phagocytosis, a critical immune activity required for host innate resistance to infection. In response to phagocytosis, microbial pathogens have evolved a myriad of ways to interfere with this process and avoid killing. In fact, some bacteria have evolved the capacity to survive and proliferate within phagocytic cells. We provide selected examples of the different mechanisms involved in pathogen avoidance of phagocytosis, and also discuss how defects in phagocytic cells can predispose to infection.

This chapter discusses the general principles of vaccines, its complications and side effects, and the development of new vaccines. Effective resistance to infection or disease depends on the vaccine having certain properties – such as inducing the right type of immune resistance, inducing an immune response in the right place, inducing an immune response to the right antigens, and immunity to toxins. Virulent microorganisms are inactivated to make killed vaccine. If inactivation has been incompletely carried out, vaccination introduces infection. Nonmicrobial antigens in vaccines can cause allergic responses. Large numbers of killed salmonellas are present in the vaccine for typhoid, and this vaccine therefore contains large amounts of endotoxin, which can present toxicity. Live vaccines often cause illness in children with immunodeficiencies. Several procedures for the development of synthetic peptides as vaccines also have been described. Successful new vaccines will come from encouraging laboratory advances in immunology and biotechnology and at the same time attending to practical problems, such as vaccine supply, quality testing, licensing, and financing.

This chapter addresses the factors involved in recovery from infection. Antibody and cellular responses (CMI) are considered. The mechanisms by which antibodies neutralise viruses/prevent infection are described, as is the involvement of antibody in bacterial and protozoal diseases. The role of CMI in recovery from specific bacterial, protozoal and viral infections is considered. The mechanisms of cell killing by cytotoxic T-cells is described and the role of NK cells and macrophages in pathogen clearance is discussed, as is the role of inflammation. Mechanisms by which the complement system acts and its role in vivo is discussed, as is the interferon response. Recovery from S. typhimurium is used to illustrate the multimechanistic nature of recovery. The role of temperature in recovery and pathogen factors that induce fever are considered. Tissue repair mechanisms are discussed, as is finally resistance to infection.

In this chapter, we describe the early stages of the pathogenic cycle involving entry into the host. For example, some bacteria may enter into epithelial cells, proliferate and then spread at the epithelial surface before being transmitted to another host. Some pathogens then migrate past the epithelial layer to deeper tissues causing invasive infections. Examples of some of the major bacterial, viral and fungal pathogens affecting the epithelial surfaces in the body are provided. The body produces a strong inflammatory immune response to pathogens at the epithelial surface. An introduction to the components of the inflammatory response including the phagocytic cells and the lymphatic system is provided. In addition, the nutritional requirements for invading bacteria including the importance of iron is discussed.

Many infections are associated with damage inflicted either directly or indirectly by invading pathogens. Although some infections do not result in host damage, it is often a natural consequence of the activities of virulence factors produced by the pathogens in order to facilitate survival, and proliferation in the host or onward transmission to another host. The damage often manifests itself as the symptoms of disease which can be useful for diagnosis and for informing appropriate treatments. A wide array of different types of toxins which cause damage to the host are produced by different bacterial pathogens. Here we provide examples of well-characterised toxins and describe their mechanisms of action, and potential function with regard to pathogenesis. In addition we describe indirect damage to the host in the form of inflammation or immunopathology, typically the result of the host's own immune response. Finally, we discuss diarrhoea as a special case and list some of the major pathogens and the toxins associated with this devastating disease.

Ovine herpesvirus 2 (OvHV-2) causes malignant catarrhal fever in cattle, pigs and deer. We have observed intact circular and linear OvHV-2 genomes in infected T cell lines derived from cows and rabbits. Bovine T cell lines were predominantly latently infected but rabbit T cell lines supported OvHV-2 productive cycle gene expression and virus capsids were demonstrated for the first time.

Central to infection by a majority of DNA viruses is the expression of encoded proteins that modify cell cycle. Viruses such as SV40 and Adenovirus viruses encode proteins that interact directly, or indirectly, with key cell cycle proteins such as CBP300 and the retinoblastoma gene product. However, neurons do not have a cell cycle as we generally describe it and this is also reflected in the difficulty in obtaining immortalised neuronal cultures. The replication strategies of viruses that infect post-mitotic cells such as neurons may be different from infection of other somatic cells. The life cycle for viral latency or slow infection of neurons appears to involve silencing or restricting expression of the viral genome until such times as dictated by the environment. These signals from the environment usually reflect cell stress, otherwise the cell appears to tolerate the existence of the virus genome. We will review the genomic structure of alphaherpesviruses in neurons and transcriptional control mechanisms that may regulate expression. Where appropriate we will contrast and compare virus and endogenous neuronal gene expression.

A domain, previously termed RE1, exists within the herpes simplex virus type 1 genome potentially influencing expression of immediate early genes and the latency associated transcripts. This domain consists of 10 tandem copies of a CT-rich sequence. We demonstrate that this domain binds multiple host-cell factors that may allow RE1 to act either as a transcriptional regulator and/or to affect nucleosomal and DNA structure in the latent genome.

This report describes two subpopulations of B cells in sheep. These subpopulations have distinct recirculation characteristics and tissue distributions. Phenotypically the populations are distinguished by their differential expression of the complement receptors, CD21 (CR2) and CD11b/CD18 (CR3). CD11b+ B cells are surface (s)IgMhi, co-express CD11c but are L-selectin negative. They populate the splenic marginal zone but are absent from splenic and ileal Peyer's patch (IPP) follicles and both afferent and efferent lymph compartments. Fluorescent tracing experiments showed that the CD11b+ B cells are non-recirculating as they did not appear in lymph after intravenous inoculation but are restricted to the blood and spleen. The CD11b-negative population expresses a conformational determinant of CD21 that is recognized by the monoclonal antibody Du 2-74. These cells are sIgMlo and co-express L-selectin. They populate the splenic and IPP follicles, are absent from the splenic marginal zone and are the only B cells in afferent lymph, efferent lymph and all lymph nodes. Fluorescence tracing experiments showed that the CD21 B cells are recirculating cells with their entry into efferent lymph being detectable by 16 h and peaking at 24-30 h. These data suggest that there are at least two lineages of B cells in the sheep with different phenotypic, functional and recirculation characteristics.

Herpesviruses encode microRNAs (miRNAs) that target both virus and host genes; however, their role in herpesvirus biology is understood poorly. We identified previously eight miRNAs encoded by ovine herpesvirus-2 (OvHV-2), the causative agent of malignant catarrhal fever (MCF), and have now investigated the role of these miRNAs in regulating expression of OvHV-2 genes that play important roles in virus biology. ORF20 (cell cycle inhibition), ORF50 (reactivation) and ORF73 (latency maintenance) each contain predicted targets for several OvHV-2 miRNAs. Co-transfection of miRNA mimics with luciferase reporter constructs containing the predicted targets showed the 5′ UTRs of ORF20 and ORF73 contain functional targets for ovhv-miR-2 and ovhv2-miR-8, respectively, and the 3′ UTR of ORF50 contains a functional target for ovhv2-miR-5. Transfection of BJ1035 cells (an OvHV-2-infected bovine T-cell line) with the relevant miRNA mimic resulted in a significant decrease in ORF50 and a smaller but non-significant decrease in ORF20. However, we were unable to demonstrate a decrease in ORF73. MCF is a disease of dysregulated lymphocyte proliferation; miRNA inhibition of ORF20 expression may play a role in this aberrant lymphocyte proliferation. The proteins encoded by ORF50 and ORF73 play opposing roles in latency. It has been hypothesized that miRNA-induced inhibition of virus genes acts to ensure that fluctuations in virus mRNA levels do not result in reactivation under conditions that are unfavourable for viral replication and our data supported this hypothesis.

Jaagsiekte retrovirus (JSRV) is an exogenous type D-related retrovirus specifically associated with a contagious lung cancer of sheep (sheep pulmonary adenomatosis; SPA). Recently, epithelial tumour cells in the lungs of SPA-affected sheep were identified as major sites of JSRV replication by immunological techniques and RT-PCR amplification of part of JSRV gag. JSRV was not detected outside the lungs and their draining lymph nodes. However, low levels of JSRV expression in non-respiratory tissues could have been masked by co-amplification of endogenous JSRV-related sequences, which were differentiated from JSRV by the lack of a Scal restriction site in the PCR product. To further investigate the pathogenesis of SPA, an exogenous virus-specific hemi-nested PCR was developed utilizing primers in the U3 region of JSRV LTR, where major differences between endogenous and exogenous sequences exist. This technique was shown to beor = 10(5)-fold more sensitive than the previous gag PCR/ScaI digestion method. Using this new assay the tissue distribution of JSRV in sheep with natural and experimentally induced SPA was analysed. Proviral DNA and JSRV transcripts were found in all tumours and lung secretions of SPA-affected sheep (n = 22) and in several lymphoid tissues. The mediastinal lymph nodes draining the lungs were consistently demonstrated to be infected by JSRV (10/10). JSRV transcripts were also detected in spleen (7/9), thymus (2/4), bone marrow (4/8) and peripheral blood mononuclear cells (3/7). Proviral DNA was also detected in these tissues although in a much lower proportion of cases. JSRV was not detected in 27 samples from unaffected control animals (n = 15).

Sheep pulmonary adenomatosis (SPA) is a naturally occurring contagious lung tumour of sheep which has been associated aetiologically with a type D- and B-related retrovirus (Jaagsiekte retrovirus; JSRV). To improve understanding of the aetio-pathogenesis of SPA, the distribution and the sites of JSRV replication in sheep with naturally or experimentally induced SPA or in unaffected controls were identified. New immunological reagents were produced and a blocking enzyme-linked immunosorbent assay (B-ELISA) and an immunohistochemical technique for the detection of JSRV major capsid protein at the tissue and cellular levels were developed. JSRV was detected only in the respiratory tract of sheep affected by pulmonary adenomatosis and specifically in the transformed epithelial cells of the alveoli of SPA-affected sheep.

Summary A 36-year-old donkey developed dyspnoea, pyrexia, hypoalbuminaemia and oedema. Following continued clinical deterioration the donkey was humanely destroyed. Grossly, there were numerous nodules (5–10 mm) scattered throughout the lung. Microscopically, the lung was infiltrated by an angiocentric and bronchocentric to diffuse mixed population of small mature and atypical lymphocytes, histiocytes, plasma cells and fewer eosinophils. The infiltrate was composed of numerous small mature and fewer atypical CD3+ T lymphocytes. Low numbers of CD20+ and CD79a+ B cells, some atypical, accompanied the T cells. These infiltrates were consistent with an angiocentric lymphoma and resembled lymphomatoid granulomatosis, an Epstein-Barr virus (EBV)-associated human tumour. Immunohistochemistry for EBV latent membrane protein and polymerase chain reaction analysis for equine gamma herpesvirus DNA were negative. To the authors’ knowledge this is the first case of angiocentric lymphoma reported in a donkey and the first case of lymphomatoid granulomatosis-type disease in an animal in which possible concurrent infection with a gamma herpesvirus has been investigated.

Postherpetic neuralgia (PHN), a common complication of herpes zoster, which results from reactivation of varicella zoster virus, is a challenging neuropathic pain syndrome. The incidence and severity of herpes zoster and PHN increases with immune impairment or age and may become a greater burden both in terms of health economics and individual suffering. A clearer understanding of the underlying mechanisms of this disease and translation of preclinical outcomes to the clinic may lead to more efficacious treatment options. Here we give an overview of recent findings from preclinical models and clinical research on PHN.

Pattern recognition receptors (PRRs) play a crucial role in the initiation of the adaptive immune response. Immunological competence of foetal lambs occurs progressively throughout gestation, and in order to understand the role played by PRRs in foetal immunological competence, we quantified transcript expression, in the skin and spleen, of the TLRs, key C-type lectins and CARD15 during the critical second trimester. These data show that lambs express the same spectrum of PRRs as the adult but that the level of expression for most is dependent on developmental age. Key findings include: TLR1 and TLR5 are expressed at high levels in the foetus but are low in the adult; in contrast, TLR4, CD14 and CARD15 increase with age. In addition, TLR9 and TLR10 are expressed by the spleen and not the skin, while CARD15 is low in the spleen and high in the skin. (c) 2008 Elsevier Ltd. Ail rights reserved.

Several studies have implicated a potential role for histamine H 3 receptors in pain processing, although the data are somewhat conflicting. In the present study we investigated the effects of the novel potent and highly selective H 3 receptor antagonists GSK189254 (6-[(3-cyclobutyl-2,3,4,5-tetrahydro-1 H -3-benzazepin-7-yl)oxy]- N -methyl-3-pyridinecarboxamide hydrochloride) and GSK334429 (1-(1-methylethyl)-4-({1-[6-(trifluoromethyl)-3-pyridinyl]-4-piperidinyl}carbonyl)hexahydro-1 H -1,4-diazepine) in two rat models of neuropathic pain, namely the chronic constriction injury (CCI) model and the varicella-zoster virus (VZV) model. Both GSK189254 (0.3, 3 and/or 10 mg/kg p.o.) and GSK334429 (1, 3 and 10 mg/kg p.o.) significantly reversed the CCI-induced decrease in paw withdrawal threshold (PWT) measured using an analgesymeter and/or von Frey hairs. In addition, GSK189254 (3 mg/kg p.o.) and GSK334429 (10 mg/kg p.o.) both reversed the VZV-induced decrease in PWT using von Frey hairs. We also investigated the potential site of action of this analgesic effect of H 3 antagonists using autoradiography. Specific binding to H 3 receptors was demonstrated with [ 3 H]-GSK189254 in the dorsal horn of the human and rat spinal cord, and in human dorsal root ganglion (DRG), consistent with the potential involvement of H 3 receptors in pain processing. In conclusion, we have shown for the first time that chronic oral administration of selective H 3 antagonists is effective in reversing neuropathic hypersensitivity in disease-related models, and that specific H 3 receptor binding sites are present in the human DRG and dorsal horn of the spinal cord. These data suggest that H 3 antagonists such as GSK189254 and GSK334429 may be useful for the treatment of neuropathic pain.

The aim of this study was to investigate skin immunopathology following gene gun delivery of plasmid-encoding interleukin 3 (pIL-3) and hence explore the possible mechanisms of its adjuvant activity. Using the sheep as the experimental model, expressible pIL-3 was administered to the epidermis and the dermal/epidermal junction and its effects on the skin were assessed by histopathology, immunohistology and quantitative RT-PCR for a range of pro-inflammatory and immune response polarizing cytokines. Delivery of both functional and non-functional plasmids caused an acute inflammatory response with the infiltration of neutrophils and micro-abscess formation; however, the response to pIL-3 was more severe and was also associated with an early (24 h) infiltration of B cells and a later accumulation of CD172a-/CD45RA+ dendritic cells (DC). In terms of cytokine transcript expression, an early TNFalpha response was stimulated by gene gun delivery of plasmid-associated gold beads, which coincided with an immediate infiltration of neutrophils. However, only pIL-3 triggered the short-lived expression of IL-3 (peaking at 6 h) and significant long-term increases in both TNFalpha and IL-1beta. pIL-3 did not affect the expression of the immune response polarizing cytokines, IL-10 and IL-12.

able 1 nternal and external primer sets of sheep TLR. Gene accession no. Primer sequence 5′ → 3′ Product size (bp) Annealing temperature (◦C) TLR1 F ext GAATTTCTGGGGTTGAGTGC 375 58 AY634628a R ext CTGGAGGATCGTGAAGAAGG AM231298 F int GCACTTCAACCCTCCCTTTTA 164 62.5 R int CTGGAGGATCGTGAAGAAGG TLR2 F ext TGCCTGAAACTTGTCAGTGG 953 58 AY634629a R ext AATGGCCTTCTTGTGTCAATGG AM183218 F int GATGGATGAAACAGTAGAAGTCG 125 62.5 R int TCTCCGAAAGCACAAAGATG TLR3 F ext GGGTCTGGAAGCACTTCTCC 403 59 AY124007a R ext GCTGAATTTCTGGACCCAAG AM231299 F int AAAGGGACTTTGAGGCAGGT 150 62.5 R int TAGCTTGCTGAACTGCATGG TLR4 F ext GGACAACCAACCTGAAGCAT 945 58 AF310952a R ext CCCTGTAGTGAAGGCAGAGC AM231300 F int TGCTGGCTGCAAAAAGTATG 149 62.5 R int CCCTGTAGTGAAGGCAGAGC TLR5 F ext CCAGAGTCTGCTGTTCAAGG 250 57 AB060695b and AF186107c R ext ACCCTCTGATGGACTGATGC AM231301 F int CCTCGAAGCCTTCAGTTACG 121 62.5 R int ACCCTCTGATGGACTGATGC TLR6 F ext TTTGTCCTCAGGAACCAAGC 238 57 a AJ618974 R ext TGGGCTAAAGAATTGGAAGC T AM231302 F int GCTTTCTTTGGAAACACTGGA 123 62.5 R int GAGTCAGTGAGGGCATTTGA

Ovine pulmonary adenocarcinoma (OPA) can be reproduced consistently in neonatal lambs by intratracheal injection of inocula containing jaagsiekte sheep retrovirus (JSRV). In this study, clinical disease, confirmed pathologically as OPA, was induced in a high proportion of lambs that had been inoculated intratracheally with infectious lung fluid at 1, 3 and 6 months of age. The incubation periods, however, were longer in these three age groups than in 1-week-old lambs that were used as controls. Viraemia was detected in all age groups before onset of clinical signs, but occurred later in older animals. These results suggest an age-dependent susceptibility to OPA that could be determined by the availability of JSRV target cells in the ovine lung. The feasibility of inducing OPA in older lambs and detecting JSRV viraemia in preclinical stages enables improved studies on the pathogenesis, assessment of vaccines, diagnosis and control of the disease.

The ability to manipulate the expression of genes within neurons provides unique opportunities to study the role of individual gene products in nervous system function. Virus vectors are a potentially rapid tool for the experimental manipulation of gene expression in the mammalian nervous system. However, a block to the use of virus vector systems in neurobiology is often the lack of cell-specific expression of the gene within the nervous system, and the immune and inflammatory responses to both the virus vector and the delivered gene. We have generated an adeno-associated virus vector that exploits the restricted expression pattern of the rat preprotachykinin-A promoter to support reporter gene expression. We demonstrate that this virus has a neuronal-specific expression pattern. Moreover, it is shown for the first time that the proximal rat preprotachykinin-A promoter is nerve growth factor inducible. This virus will be a useful tool to (i) modify neuronal phenotype by expressing therapeutic molecules or antisense nucleic acid and (ii) dissect the signal transduction pathways that regulate promoter function in vivo.

An ovine monocyte/macrophage cell surface antigen was recognized by three mouse monoclonal antibodies (mAbs) VPM65, VPM66 and VPM67. These mAbs also reacted with bovine cells. The antibodies immunoprecipitated a single, glycosyl-phosphatidylinositol-linked polypeptide of M r 55 000 which, when deglycosylated, was reduced to M r 53 000. They reacted strongly with peripheral blood monocytes, alveolar macrophages and peripheral blood granulocytes, and weakly with afferent lymph dendritic cells. They also reacted with macrophages in many different tissues but were non-reactive with lymphocytes. Competitive flow cytometry shows that these three mAbs recognize the same or a closely related epitope of a single antigen. An antigen-specific capture ELISA using the anti-human CD14 mAb (TUK4) revealed that all four mAbs associate with the same antigen. These data demonstrate that the mAbs react with the ovine homologue of the lipopolysaccharide (LPS)-LPS binding protein receptor, CD14.

This paper is concerned with the relationship of the three distinct members of the ovine beta 2-integrin family of leucocyte adhesion molecules that play an important role in cell-cell and cell-matrix interactions. A panel of monoclonal antibodies (mAbs) specific for sheep and cattle macrophages was characterized by flow cytometry, immunohistology, and immunoprecipitation for reactivity to the beta 2 integrins. Immunoprecipitation analysis of sheep antigens showed that these monoclonal antibodies could be divided into four distinct groups. All precipitated an M(r) 95,000 beta chain but they differed in the size or number (or both) of the alpha chains recognized. Group 1 precipitated alpha chains of M(r) 180,000; group 2 had M(r) 170,000 alpha chains; the group 3 alpha chain was of M(r) 150,000 and group 4 mAbs precipitated alpha chains of all three sizes. The relationship between these antibodies was demonstrated by sequential immunoprecipitation, which showed that the reactivities of antibodies in groups 1, 2 and 3 were mutually exclusive but that group 4 antibodies shared a common specificity with the other three groups. By analogy with the human and murine beta 2 integrin families, group 1 antibodies seemed to be specific for CD11a (LFA-1); group 2 were CD11b (CR3 or Mac1); group 3 were CD11c (CR4 or p150/95) and group 4 were CD18. In addition to different molecular weights, these antibodies had different cellular and tissue distributions. CD11a and CD18 were distributed identically. The antigens recognized by both were present on all the leucocyte populations. The mAbs recognizing CD11b reacted with a sub-population of peripheral blood B lymphocytes and all myeloid cells (alveolar macrophages, peripheral blood monocytes and granulocytes) except afferent lymph dendritic cells (ADC). Anti-CD11c (p 150/95 or CR4) antibodies reacted strongly with macrophages and ADC but were weakly reactive on monocytes and negative on neutrophils. CD11c was also present on a sub-population of peripheral blood B cells.

This study characterizes antigen-induced phenotypic and functional aspects of major histocompatibility complex (MHC) class II expression on recirculating T cells in efferent lymph. In vivo secondary, but not primary challenge is associated with both kinetic and phenotypic alterations in class II expression by T cells. All three major T cell subsets, CD4+, CD8+ and T19+ (gamma delta T cell receptor), show an approximate four fold increase in the level of MHC class II expression during secondary responses. No changes in B cell expression of class II were seen. Resting efferent lymph T cells are predominantly either class II- or DR+DQ- but this changes to DR+DQ+ after antigenic challenge. The antigen-presenting function of these class II+ T cells was investigated at daily intervals after in vivo antigenic challenge. T cells from non-activated lymph nodes could not induce proliferation of antigen-specific T cells with soluble antigen but were weakly stimulatory in allo-mixed lymphocyte reaction (MLR) at high (> 2:1) stimulator cell ratios. Activated T cells isolated during secondary in vivo responses, and expressing increased quantities of MHC class II, were positive stimulator cells in the MLR. In contrast these cells could not present soluble antigen or trypsin-digested antigen to the T cell lines. In the MLR assays, the relative stimulation by class II+ T cells correlates with the levels of class II expression. We conclude from these experiments that both quantitative and qualitative changes in MHC class II, induced on T cells under physiological conditions, play a role in the regulation of the immune response in vivo but that that role is not simply one of presentation of soluble antigen.

Polyclonal antibodies were raised against the individual 85 and 70 kDa subunits of the Ku complex purified from nuclear extract prepared from the T cell line MLA 144. They specifically recognise the appropriate subunits of the Ku complex from whole cell extract of HeLa cells using Western blot analysis. They are also able to identify the Ku proteins present in the cell membrane using FACS analysis.

We have used a DNA competition binding assay to search for herpes simplex virus (HSV) proteins which are able to bind to specific sequences of the genome of HSV. Cloned DNAs from different regions of the virus genome were tested. Two late polypeptides, one major of apparent molecular weight 21 000 and one minor of 22 000, were preferentially bound by a variety of fragments containing the HSV-1 400 bp a sequence (a direct repeat present at the ends of the molecule and in inverted orientation between the long and short regions of the genome) but not by other competing DNAs including ones containing an origin of replication. We interpret our result as evidence that the HSV type 1-induced 21K and 22K polypeptides interact specifically with DNA sequences within this 400 bp HSV-1 a sequence.

Viral etiology is well established for at least two chronic progressive CNS diseases in man. Subacute sclerosing panencephalitis (SSPE) is a rare late complication of childhood measles characterized by a long time span between the initial attack and the onset of SSPE. This latent or silent phase may be a decade or longer, and the interaction between virus and host during this interval is poorly understood (1).

Strains of the murine coronavirus mouse hepatitis virus type 4 (MHV-4) which contained a mutation in the E2 peplomer glycoprotein were obtained by selection for resistance to neutralization by monoclonal antibodies. Characterization of six variants representing two independent epitopes on E2, E2B and E2C, by in vitro neutralization and antibody-binding assays demonstrated that selection for an alteration in epitope E2B also resulted in changes in epitope E2C and vice versa. We observed a mutation frequency of approximately 10(-4.3) to 10(-4.6), which is consistent with the expected occurrence of single point mutations. The variant virus strains were attenuated with respect to neurovirulence when compared with wild-type MHV-4. Mice normally develop encephalomyelitis and die after wild-type MHV-4 infection. Mice receiving 2- to 3-log-higher doses of the variant strains survived and developed demyelinating disease. As the disease progressed, evidence of remyelination and ongoing demyelination was observed up to 65 days after infection. Virus reisolated 15 days after infection retained the variant phenotype. The data indicate that the E2 glycoprotein plays a central role in determining the cellular tropism and virulence of MHV-4 in the mouse.

The genes of herpes simplex virus type 1 (HSV-1) can be divided into at least three temporally regulated groups termed immediate early (IE), early and late. We have studied in detail the expression of a member of the late class of genes, US11, which encodes a polypeptide of apparent molecular weight 21K. Highly specific and sensitive probes were used to monitor US11 RNA and protein synthesis during HSV-1 infection of tissue culture cells in the presence and absence of phosphonoacetic acid, an inhibitor of viral DNA replication. The results were compared with a similar study of the products of a delayed early gene, US6, encoding glycoprotein D (gD). It was found that the patterns of RNA and protein synthesis from US11 were significantly different to those of gD. US11 products appeared later and accumulated until late in infection, while gD RNA was significantly reduced at late times. In the presence of the inhibitor of DNA synthesis, US11 gene expression was reduced 50- to 100-fold while gD expression was reduced five- to tenfold. We conclude that US11 behaves as a true late gene during HSV-1 infection. However, the use of sensitive assays, which allowed the detection of very low levels of US11 gene products under conditions designed to eliminate DNA replication, brings into question the absolute requirement for DNA replication for the expression of a true late HSV-1 gene. These results are discussed in terms of current models for the regulation of late gene expression.