Search

GNE gene-specific c.2179G>A(p.V727M) is a key alteration reported in patients with hereditary inclusion body myopathy (HIBM) and represents an ethnic founder mutation in the Indian cohort. However, the underlying role of this mutation in pathogenesis remains largely unknown. Thus, in this study, we aimed to access possible mechanisms of V727M mutation that could be leading to myopathy. We evaluated various in silico tools to predict the effect of this mutation on pathogenicity, structural or possible interactions, that could induce myopathy. Our results propose that V727M mutation could induce deleterious effects or pathogenicity and affect the stability of GNE protein. Analysis of differential genes reported in the V727 mutant case suggests that it can affect GNE protein interaction with Myc-proto-oncogene (MYC) transcription factor. Our in silico analysis also suggests a possible interaction between GNE ManNac-kinase domain with MYC protein at the C-terminal DNA-binding domain. MYC targets reported in skeletal muscles via ChIP-seq suggest that it plays a key role in regulating the expression of many genes reported differentially expressed in V727M-mutated HIBMs. We conclude that V727M mutation could alter the interaction of GNE with MYC thereby altering transcription of sialyltransferase and neuromuscular genes, thus understanding these effects could pave the way for developing effective therapies against HIBM.

Aims Nationwide large-scale genetic and outcome studies in cohorts with hypertrophic cardiomyopathy (HCM) have not been previously published. Methods and results We sequenced 59 cardiomyopathy-associated genes in 382 unrelated Finnish patients with HCM and found 24 pathogenic or likely pathogenic mutations in six genes in 38.2% of patients. Most mutations were located in sarcomere genes (MYBPC3, MYH7, TPM1, and MYL2). Previously reported mutations by our study group (MYBPC3-Gln1061Ter, MYH7-Arg1053Gln, and TPM1-Asp175Asn) and a fourth major mutation MYH7-Val606Met accounted for 28.0% of cases. Mutations in GLA and PRKAG2 were found in three patients. Furthermore, we found 49 variants of unknown significance in 31 genes in 20.4% of cases. During a 6.7 +/- 4.2 year follow-up, annual all-cause mortality in 482 index patients and their relatives with HCM was higher than that in the matched Finnish population (1.70 vs. 0.87%; P

Populations in North Africa (NA) are characterized by a high rate of consanguinity. Consequently, the proportion of founder mutations might be higher than expected and could be a major cause for the high prevalence of recessive genetic disorders like Fanconi anemia (FA). We report clinical, cytogenetic, and molecular characterization ofFANCAin 29 North African FA patients from Tunisia, Libya, and Algeria. Cytogenetic tests revealed high rates of spontaneous chromosome breakages for all patients except two of them.FANCAmolecular analysis was performed using three different molecular approaches which allowed us to identify causal mutations as homozygous or compound heterozygous forms. It included a nonsense mutation (c.2749C > T; p.Arg917Ter), one reported missense mutation (c.1304G > A; p.Arg435His), a novel missense variant (c.1258G > A; p.Asp409Glu), and theFANCAmost common reported mutation (c.3788_3790delTCT; p.Phe1263del). Furthermore, three founder mutations were identified in 86.7% of the 22 Tunisian patients: (1) a deletion of exon 15, in 36.4% patients (8/22); (2), a deletion of exons 4 and 5 in 23% (5/22) and (3) an intronic mutation c.2222 + 166G > A, in 27.3% (6/22). Despite the relatively small number of patients studied, our results depict the mutational landscape of FA among NA populations and it should be taken into consideration for appropriate genetic counseling.

Background: Next-generation sequencing (NGS) is increasingly used for clinical evaluation of cardiomyopathy patients as it allows for simultaneous screening of multiple cardiomyopathy-associated genes. Adding copy number variant (CNV) analysis of NGS data is not routine yet and may contribute to the diagnostic yield.Objectives: Determine the diagnostic yield of our targeted NGS gene panel in routine clinical diagnostics of Dutch cardiomyopathy patients and explore the impact of exon CNVs on diagnostic yield.Methods: Patients (N = 2002) referred for clinical genetic analysis underwent diagnostic testing of 55-61 genes associated with cardiomyopathies. Samples were analyzed and evaluated for single nucleotide variants (SNVs), indels and CNVs. CNVs identified in the NGS data and suspected of being pathogenic based on type, size and location were confirmed by additional molecular tests.Results: A (likely) pathogenic (L)P variant was detected in 22.7% of patients, including 3 with CNVs and 25 where a variant was identified in a gene currently not associated with the patient's cardiomyopathy subtype. Only 15 out of 2002 patients (0.8%) were found to carry two (L)P variants.Conclusion: The yield of routine clinical diagnostics of cardiomyopathies was relatively low when compared to literature. This is likely due to the fact that our study reports the outcome of patients in daily routine diagnostics, therefore also including patients not fully fulfilling (subtype specific) cardiomyopathy criteria. This may also explain why (L)P variants were identified in genes not associated with the reported subtype. The added value of CNV analysis was shown to be limited but not negligible. (C) 2021 The Authors. Published by Elsevier B.V.

Ovarian carcinomas (OC) often demonstrate rapid tumor shrinkage upon neoadjuvant chemotherapy (NACT). However, complete pathologic responses are very rare and the mechanisms underlying the emergence of residual tumor disease remain elusive. We hypothesized that the change of somatic BRCA1 status may contribute to this process. The loss-of-heterozygosity (LOH) at the BRCA1 locus was determined for 23 paired tumor samples obtained from BRCA1 germ-line mutation carriers before and after NACT. We observed a somatic loss of the wild-type BRCAI allele in 74% (17/23) of OCs before NACT. However, a retention of the wild-type BRCA1 copy resulting in a reversion of LOH status was detected in 65% (11/17) of those patients after NACT. Furthermore, we tested 3 of these reversion samples for LOH at intragenic BRCA1single nucleotide polymorphisms (SNPs) and confirmed a complete restoration of the SNP heterozygosity in all instances. The neoadjuvant chemotherapy for BRCA1-associated OC is accompanied by a rapid expansion of pre-existing BRCA1-proficient tumor clones suggesting that continuation of the same therapy after NACT and surgery may not be justified even in patients initially experiencing a rapid tumor regression. (C) 2017 Elsevier B.V. All rights reserved.

Purpose Familial pancreatic cancer describes families with at least two first-degree relatives with pancreatic cancer that do not fulfil the criteria of other inherited tumor syndromes with increased risks of pancreatic cancer. Although much has been learned regarding the aggregation of pancreatic cancer in some families, the genetic basis for this familial aggregation is poorly understood. This study evaluated the prevalence of 10 Polish founder mutations in four genes among individuals from families with diagnosed familial pancreatic cancer syndrome and assessed their possible association with the familial pancreatic cancer (FPC) risk in Poland. Materials and methods In this study, 400 FPC individuals and 4,000 control subjects were genotyped for founder mutations in BRCA1 (5382insC, 4153delA, C61G), CHEK2 (1100delC, IVS2+1G>A, del5395, I157T), NBS1 (657del5), and PALB2 (509_510delGA, 172_175delTTGT) genes. Results A statistically significant association was observed between the 172_175delTTGT mutation of the PALB2 gene and an increased risk of FPC syndrome (odds ratio [OR], 10.05; p=0.048). In addition, an increased risk of cancer was observed in the FPC family members with a BRCA1 mutation (OR, 6.72; p=0.006). Novel associations were found between the FPC family members with cancer and CHEK2 mutations (OR, 2.26; p=0.008) with a noticeable contribution of the missense variant, I157T of CHEK2 (OR, 2.17; p=0.026). Conclusion The founder mutations in the genes, BRCA1, PALB2, and CHEK2, cause a small percentage of familial pancreatic cancer syndrome in the Polish population. Following confirmation in larger studies, these mutations can be added to the panel of genes to be tested in families with a diagnosis of FPC syndrome.

Background— Sudden cardiac arrest (SCA) ranks among the most common causes of death worldwide. Because SCA is most often lethal, yet mostly occurs in individuals without previously known cardiac disease, the identification of patients at risk for SCA could save many lives. In unselected SCA victims from the community, common genetic variants (which are not disease-causing per se, but may increase susceptibility to ventricular fibrillation) are found to be associated with increased SCA risk. However, whether rare genetic variants contribute to SCA risk in the community is largely unexplored. Methods and Results— We here investigated the involvement of rare genetic variants in SCA risk at the population level by studying the prevalence of 6 founder genetic variants present in the Dutch population (PLN-p.Arg14del, MYBPC3-p.Trp792fsX17, MYBPC3-p.Arg943X, MYBPC3-p.Pro955fsX95, PKP2-p.Arg79X, and the Chr7q36 idiopathic ventricular fibrillation risk haplotype) in a cohort of 1440 unselected Dutch SCA victims included in the Amsterdam Resuscitation Study (ARREST). The six studied founder mutations were found to be more prevalent (1.1%) in the ARREST SCA cohort compared with an ethnically and geographically matched set of controls (0.4%, n=1379; P P Conclusions— This finding provides proof-of-concept for the notion that rare genetic variants contribute to some extent to SCA risk in the community.

The prevalence and spectrum of germline mutations in BRCA1 and BRCA2 have been reported in single populations, with the majority of reports focused on White in Europe and North America. The Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA) has assembled data on 18,435 families with BRCA1 mutations and 11,351 families with BRCA2 mutations ascertained from 69 centers in 49 countries on six continents. This study comprehensively describes the characteristics of the 1,650 unique BRCA1 and 1,731 unique BRCA2 deleterious (disease-associated) mutations identified in the CIMBA database. We observed substantial variation in mutation type and frequency by geographical region and race/ethnicity. In addition to known founder mutations, mutations of relatively high frequency were identified in specific racial/ethnic or geographic groups that may reflect founder mutations and which could be used in targeted (panel) first pass genotyping for specific populations. Knowledge of the population-specific mutational spectrum in BRCA1 and BRCA2 could inform efficient strategies for genetic testing and may justify a more broad-based oncogenetic testing in some populations.

Background Historically, three founder mutations in the BRCA1/2 (OMIM 113705; OMIM 600185) genes have been the focus of cancer risks within the Ashkenazi Jewish (AJ) population. However, there are several additional mutations associated with increased susceptibility to cancer in individuals of AJ ancestry. Methods We report three patients who exemplify the need to keep these additional founder mutations in mind when pursuing hereditary cancer genetic testing of individuals in this population. All gene sequences in this paper were aligned to reference sequences based on human genome build GRCh37/UCSC hg19. Results review of the literature discusses that the combined risk is 12.36%–20.83% forhaving 1 of the 10 hereditary cancer AJ founder mutations in the BRCA1, BRCA2, CHEK2 (OMIM 604373), APC (OMIM 611731), MSH2 (OMIM 609309), MSH6 (OMIM 600678), and GREM1 (OMIM 603054) genes for individuals of AJ ancestry. Conclusion We recommend testing for all 10 of these AJ founder cancer susceptibility mutations for individuals within this population as standard screening in order to ensure appropriate cancer risk management and cascade testing.

Background Founder mutations in the two breast cancer genes, BRCA1 and BRCA2, have been described in many populations, among these are Ashkenazi-Jewish, Polish, Norwegian and Icelandic. Founder mutation testing in patients with relevant ancestry has been a cost-efficient approach in such populations. Four Norwegian BRCA1 founder mutations were defined by haplotyping in 2001, and accounted for 68% of BRCA1 mutation carriers at the time. After 15 more years of genetic testing, updated knowledge on the mutation spectrum of both BRCA1 and BRCA2 in Norway is needed. In this study, we aim at describing the mutation spectrum and frequencies in the BRCA1/2 carrier population of the largest clinic of hereditary cancer in Norway. Methods A total of 2430 BRCA1 carriers from 669 different families, and 1092 BRCA2 carriers from 312 different families were included in a quality of care study. All variants were evaluated regarding pathogenicity following ACMG/ENIGMA criteria. The variants were assessed in AlaMut and supplementary databases to determine whether they were known to be founder mutations in other populations. Results There were 120 different BRCA1 and 87 different BRCA2 variants among the mutation carriers. Forty-six per cent of the registered BRCA1/2 families (454/981) had a previously reported Norwegian founder mutation. The majority of BRCA1/2 mutations (71%) were rare, each found in only one or two families. Fifteen per cent of BRCA1 families and 25% of BRCA2 families had one of these rare variants. The four well-known Norwegian BRCA1 founder mutations previously confirmed through haplotyping were still the four most frequent mutations in BRCA1 carriers, but the proportion of BRCA1 mutation carriers accounted for by these mutations had fallen from 68 to 52%, and hence the founder effect was weaker than previously described. Conclusions The spectrum of BRCA1 and BRCA2 mutations in the carrier population at Norway’s largest cancer genetics clinic is diverse, and with a weaker founder effect than previously described. As a consequence, retesting the families that previously have been tested with specific tests/founder mutation tests should be a prioritised strategy to find more mutation positive families and possibly prevent cancer in healthy relatives.

Background: Accurate estimates of survival are indispensable for cardiologists, clinical geneticists, and genetic counselors dealing with families with an inherited cardiac disease. However, a bias towards a more severe disease with a worse outcome in the first publications may not accurately represent the actual survival forecast. We, therefore, evaluated the effect of ascertainment bias on survival in 3 different inherited cardiac diseases (idiopathic ventricular fibrillation, SCN5A overlap syndrome, and arrhythmogenic cardiomyopathy) caused by a founder mutation. Methods: We collected mortality data from mutation-positive subjects with either DPP6 -associated idiopathic ventricular fibrillation, SCN5A overlap syndrome, and PLN -R14del-mediated arrhythmogenic cardiomyopathy >2 to 10 years of ongoing clinical/cascade genetic screening. Results: The median age of survival in DPP6 mutation-positive subjects increased from 44.6 years in the original cohort from 2008 (n=60; 95% CI, 36.8–52.4 years) to 68.2 years in the extended cohort from 2012 (n=235; 95% CI, 64.6–71.7 years; P SCN5A overlap syndrome, survival increased from 56.1 years in 1999 (n=86; 95% CI, 48.0–64.2 years) to 69.7 years in 2009 (n=197; 95% CI, 61.3–78.2 years; P =0.049). In PLN -R14del positive patients, the median age of survival increased from 63.5 years in 2010 (n=89; 95% CI, 59.1–68.0 years) to 65.2 years in 2012 (n=370; 95% CI, 62.0–68.3 years; P =0.046). Conclusions: The median age of survival in 3 different inherited cardiac diseases with an established pathogenic substrate significantly increased once genetic testing and cascade screening extended, after the first publication that elucidated the discovery of the disease-susceptibility gene/mutation. This underscores the direct and negative influence of ascertainment bias on survival forecasts and the importance of ongoing clinical/genetic follow-up to establish the most accurate disease prognosis for genetically mediated heart diseases.

Purpose Recommendations for treating patients who carry a BRCA1/2 gene are mainly based on cumulative lifetime risks (CLTRs) of breast cancer determined from retrospective cohorts. These risks vary widely (27% to 88%), and it is important to understand why. We analyzed the effects of methods of risk estimation and bias correction and of population factors on CLTRs in this retrospective clinical cohort of BRCA1/2 carriers. Patients and Methods The following methods to estimate the breast cancer risk of BRCA1/2 carriers were identified from the literature: Kaplan-Meier, frailty, and modified segregation analyses with bias correction consisting of including or excluding index patients combined with including or excluding first-degree relatives (FDRs) or different conditional likelihoods. These were applied to clinical data of BRCA1/2 families derived from our family cancer clinic for whom a simulation was also performed to evaluate the methods. CLTRs and 95% CIs were estimated and compared with the reference CLTRs. Results CLTRs ranged from 35% to 83% for BRCA1 and 41% to 86% for BRCA2 carriers at age 70 years width of 95% CIs: 10% to 35% and 13% to 46%, respectively). Relative bias varied from −38% to +16%. Bias correction with inclusion of index patients and untested FDRs gave the smallest bias: +2% (SD, 2%) in BRCA1 and +0.9% (SD, 3.6%) in BRCA2. Conclusion Much of the variation in breast cancer CLTRs in retrospective clinical BRCA1/2 cohorts is due to the bias-correction method, whereas a smaller part is due to population differences. Kaplan-Meier analyses with bias correction that includes index patients and a proportion of untested FDRs provide suitable CLTRs for carriers counseled in the clinic.

Arrhythmogenic cardiomyopathy (AC), also known as arrhythmogenic right ventricular dysplasia/cardiomyopathy (ARVD/C), is a hereditary disease characterised by ventricular arrhythmias, right ventricular and/or left ventricular dysfunction, and fibrofatty replacement of cardiomyocytes. Patients with AC typically present between the second and the fourth decade of life with ventricular tachycardias. However, sudden cardiac death (SCD) may be the first manifestation, often at young age in the concealed stage of disease. AC is diagnosed by a set of clinically applicable criteria defined by an international Task Force. The current Task Force Criteria are the essential standard for a correct diagnosis in individuals suspected of AC. The genetic substrate for AC is predominantly identified in genes encoding desmosomal proteins. In a minority of patients a non-desmosomal mutation predisposes to the phenotype. Risk stratification in AC is imperfect at present. Genotype-phenotype correlation analysis may provide more insight into risk profiles of index patients and family members. In addition to symptomatic treatment, prevention of SCD is the most important therapeutic goal in AC. Therapeutic options in symptomatic patients include antiarrhythmic drugs, catheter ablation, and ICD implantation. Furthermore, patients with AC and also all pathogenic mutation carriers should be advised against practising competitive and endurance sports.

With more than 40 dilated cardiomyopathy (DCM)-related genes known, genetic analysis of patients with idiopathic DCM is costly and time-consuming. We describe the yield from genetic analysis in DCM patients in a large Dutch cohort. We collected cardiological and neurological evaluations, family screenings, and genetic analyses for 418 index patients with idiopathic DCM. We identified 35 (putative) pathogenic mutations in 82 index patients (20%). The type of DCM influenced the yield, with mutations found in 25% of familial DCM cases, compared with 8% of sporadic DCM cases and 62% of cases where DCM was accompanied by neuromuscular disease. A PLN founder mutation (43 cases) and LMNA mutations (19 cases, 16 different mutations) were most prevalent and often demonstrated a specific phenotype. Other mutations were found in: MYH7, DES, TNNT2, DMD, TPM1, DMPK, SCN5A, SGCB (homozygous), and TNNI3. After a median follow-up of 40 months, the combined outcome of death from any cause, heart transplantation, or malignant ventricular arrhythmias in patients with a mutation was worse than in those without an identified mutation (hazard ratio 2.0, 95% confidence interval 1.4-3.0). This seems to be mainly attributable to a high prevalence of malignant ventricular arrhythmias and end-stage heart failure in LMNA and PLN mutation carriers. The yield of identified mutations in DCM index patients with clinical clues, such as associated neuromuscular disease or familial occurrence, is higher compared with those without these clues. For sporadic DCM, specific clinical characteristics may be used to select cases for DNA analysis

Exome sequencing was used as a diagnostic tool in a Roma/Gypsy family with three subjects (one deceased) affected by lissencephaly with cerebellar hypoplasia (LCH), a clinically and genetically heterogeneous diagnostic category. Data analysis identified high levels of unreported inbreeding, with multiple rare/novel “deleterious” variants occurring in the homozygous state in the affected individuals. Step-wise filtering was facilitated by the inclusion of parental samples in the analysis and the availability of ethnically matched control exome data. We identified a novel mutation, p.Asp487Tyr, in the VLDLR gene involved in the Reelin developmental pathway and associated with a rare form of LCH, the Dysequilibrium Syndrome. p.Asp487Tyr is the third reported missense mutation in this gene and the first example of a change affecting directly the functionally crucial β-propeller domain. An unexpected additional finding was a second unique mutation (p.Asn494His) with high scores of predicted pathogenicity in KCNV2, a gene implicated in a rare eye disorder, retinal cone dystrophy type 3B. This result raised diagnostic and counseling challenges that could be resolved through mutation screening of a large panel of healthy population controls. The strategy and findings of this study may inform the search for new disease mutations in the largest European genetic isolate.

Background Skin cancers (SC) are complex diseases that develop from complex combinations of genetic and environmental risk factors. One of the most severe and rare genetic diseases predisposing to SC is the Xeroderma pigmentosum (XP) syndrome. Objectives First, to identify the genetic etiology of XP and to better classify affected patients. Second, to provide early molecular diagnosis for pre-symptomatic patient and finally to offer genetic counseling for related individuals. Methods Whole Exome Sequencing (WES) and Run Of Homozygosity (ROH) were performed for two patients belonging to two different multiplex consanguineous families. The identified mutations were confirmed by Sanger sequencing and researched in ten Tunisian families including a total of 25 affected individuals previously suspected as having XP group V (XP-V) form. All patients had mild dermatological manifestations, absence of neurological abnormalities and late onset of skin tumors. Results Screening for functional variations showed the presence of the ERCC2 p.Arg683Gln in XP14KA-2 patient and a novel mutation, DDB2 p. (Lys381Argfs*2), in XP51-MAH-1 patient. Sanger sequencing and familial segregation showed that the ERCC2 mutation is present at a homozygous state in 10 affected patients belonging to 3 families. The second mutation in DDB2, is present at a homozygous state in 5 affected cases belonging to the same family. These two mutations are absent in the remaining 10 affected patients. The ERCC2 c.2048G > A mutation is present in a medium ROH region (class B) suggesting that it mostly arises from ancient relatedness within individuals. However, the c.1138delG DDB2 mutation is present in a large ROH region (class C) suggesting that it arises from recent relatedness. Conclusion To our knowledge, this is the first study that identifies XP-D and XP-E complementation groups in Tunisia. These two groups are very rare and under-diagnosed in the world and were not reported in North Africa.

Human induced pluripotent stem cells (hiPSC) have enabled a major step forward in pathophysiologic studies of inherited diseases and may also prove to be valuable in in vitro drug testing. Long QT syndrome (LQTS), characterized by prolonged cardiac repolarization and risk of sudden death, may be inherited or result from adverse drug effects. Using a microelectrode array platform, we investigated the effects of six different drugs on the electrophysiological characteristics of human embryonic stem cell-derived cardiomyocytes as well as hiPSC-derived cardiomyocytes from control subjects and from patients with type 1 (LQT1) and type 2 (LQT2) of LQTS. At baseline the repolarization time was significantly longer in LQTS cells compared to controls. Isoprenaline increased the beating rate of all cell lines by 10–73 % but did not show any arrhythmic effects in any cell type. Different QT-interval prolonging drugs caused prolongation of cardiac repolarization by 3–13 % (cisapride), 10–20 % (erythromycin), 8–23 % (sotalol), 16–42 % (quinidine) and 12–27 % (E-4031), but we did not find any systematic differences in sensitivity between the control, LQT1 and LQT2 cell lines. Sotalol, quinidine and E-4031 also caused arrhythmic beats and beating arrests in some cases. In summary, the drug effects on these patient-specific cardiomyocytes appear to recapitulate clinical observations and provide further evidence that these cells can be applied for in vitro drug testing to probe their vulnerability to arrhythmia. Electronic supplementary material The online version of this article (doi:10.1186/s40064-016-1889-y) contains supplementary material, which is available to authorized users.

SUMMARY Long QT syndrome (LQTS) is caused by functional alterations in cardiac ion channels and is associated with prolonged cardiac repolarization time and increased risk of ventricular arrhythmias. Inherited type 2 LQTS (LQT2) and drug-induced LQTS both result from altered function of the hERG channel. We investigated whether the electrophysiological characteristics of LQT2 can be recapitulated in vitro using induced pluripotent stem cell (iPSC) technology. Spontaneously beating cardiomyocytes were differentiated from two iPSC lines derived from an individual with LQT2 carrying the R176W mutation in the KCNH2 (HERG) gene. The individual had been asymptomatic except for occasional palpitations, but his sister and father had died suddenly at an early age. Electrophysiological properties of LQT2-specific cardiomyocytes were studied using microelectrode array and patch-clamp, and were compared with those of cardiomyocytes derived from control cells. The action potential duration of LQT2-specific cardiomyocytes was significantly longer than that of control cardiomyocytes, and the rapid delayed potassium channel (IKr) density of the LQT2 cardiomyocytes was significantly reduced. Additionally, LQT2-derived cardiac cells were more sensitive than controls to potentially arrhythmogenic drugs, including sotalol, and demonstrated arrhythmogenic electrical activity. Consistent with clinical observations, the LQT2 cardiomyocytes demonstrated a more pronounced inverse correlation between the beating rate and repolarization time compared with control cells. Prolonged action potential is present in LQT2-specific cardiomyocytes derived from a mutation carrier and arrhythmias can be triggered by a commonly used drug. Thus, the iPSC-derived, disease-specific cardiomyocytes could serve as an important platform to study pathophysiological mechanisms and drug sensitivity in LQT2.

We examined whether long QT syndrome (LQTS) mutation carrier status or symptomatic LQTS are associated with depression, and whether there are sex differences in these potential relationships. The sample comprised 782 participants (252 men). Of the 369 genetically defined LQTS mutation carriers, 169 were symptomatic and 200 were asymptomatic. The control group consisted of 413 unaffected relatives. Depression was assessed using the Beck Depression Inventory-II (BDI-II). No association was found for LQTS mutation carrier status with depression. The multinomial logistic regression showed that LQTS mutation carrier men with arrhythmic events scored higher on depression compared with the control group, even when adjusting for age, beta-blockers, antidepressants, and social support (OR = 1.09, 95 % CI [1.02, 1.15], p = .007). The binary logistic regression comparing symptomatic and asymptomatic LQTS mutation carriers showed that symptomatic LQTS was associated with depression in men (OR = 1.10, 95 % CI [1.03, 1.19], p = .009). The results were unchanged when additionally adjusted for education. These findings suggest that symptomatic LQTS is associated with depression in men but not in women. Overall, however, depression is more frequent in women than men. Thus, regular screening for depression in LQTS mutation carriers and their unaffected family members can be important.

Detection of mutations in hereditary breast and ovarian cancer-related BRCA1 and BRCA2 genes is an effective method of cancer prevention and early detection. Different ethnic and geographical regions have different BRCA1 and BRCA2 mutation spectrum and prevalence. Along with the emerging targeted therapy, demand and uptake for rapid BRCA1/2 mutations testing will increase in a near future. However, current patients selection and genetic testing strategies in most countries impose significant lag in this practice. The knowledge of the genetic structure of particular populations is important for the developing of effective screening protocol and may provide more efficient approach for the individualization of genetic testing. Elucidating of founder effect in BRCA1/2 genes can have an impact on the management of hereditary cancer families on a national and international healthcare system level, making genetic testing more affordable and cost-effective. The purpose of this review is to summarize current evidence about the BRCA1/2 founder mutations diversity in European populations.

The prevalence of disease-related BRCA1 mutations was investigated in 642 Dutch breast cancer patients not selected for family history or age at diagnosis. They were tested for germline mutations in the BRCA1 gene using an assay which detects small deletions and insertions (DSDI), as well as the two major genomic founder deletions present in the Dutch population. Data on family history and bilateral breast cancer were obtained retrospectively. Ten protein truncating mutations were detected and one in-frame deletion with an unknown relation to disease risk. Four patients carried the Dutch founder deletion of exon 22. Based on these results the estimated prevalence of breast cancer in the general population in the Netherlands attributable to BRCA1 mutations is 2.1%. Under 40 years-of-age and under 50 years-of-age this prevalence is 9.5% and 6.4%, respectively. All mutation carriers were under 50 years-of-age at diagnosis of the first breast cancer, and five did not have any relative with breast cancer. The proportions of bilateral breast cancer in the mutation carriers and noncarriers did not differ from each other. These data indicate that in the general Dutch breast cancer population the great majority of BRCA1 mutations will be found in women diagnosed under 50 years-of-age. (C) 2000 Cancer Research Campaign.

SummaryTo facilitate the evaluation of ATM heterozygotes for susceptibility to other diseases, such as breast cancer, we have attempted to define the most common mutations and their frequencies in ataxia-telangiectasia (A-T) homozygotes from 10 ethnic populations. Both genomic mutations and their effects on cDNA were characterized. Protein-truncation testing of the entire ATM cDNA detected 92 (66%) truncating mutations in 140 mutant alleles screened. The haplotyping of patients with identical mutations indicates that almost all of these represent common ancestry and that very few spontaneously recurring ATM mutations exist. Assays requiring minimal amounts of genomic DNA were designed to allow rapid screening for common ethnic mutations. These rapid assays detected mutations in 76% of Costa Rican patients (3), 50% of Norwegian patients (1), 25% of Polish patients (4), and 14% of Italian patients (1), as well as in patients of Amish/Mennonite and Irish English backgrounds. Additional mutations were observed in Japanese, Utah Mormon, and African American patients. These assays should facilitate screening for A-T heterozygotes in the populations studied.

Background The PALB2 c.2323C>T [p.Q775X] mutation has been reported in at least three breast cancer families and breast cancer cases of French Canadian descent and this has been attributed to common ancestors. The number of mutation-positive cases reported varied based on criteria of ascertainment of index cases tested. Although inherited PALB2 mutations are associated with increased risks of developing breast cancer, risk to ovarian cancer has not been fully explored in this demographically unique population. Methods We screened the PALB2 p.Q775X variant in 71 families with at least three cases of breast cancer (n=48) or breast and ovarian cancers (n=23) that have previously been found negative for at least the most common BRCA1 and BRCA2 mutations reported in the French Canadian population and in 491 women of French Canadian descent who had invasive ovarian cancer and/or low malignant potential tumors of the major histopathological subtypes. Results We identified a PALB2 p.Q775X carrier in a breast cancer family, who had invasive ductal breast carcinomas at 39 and 42 years of age. We also identified a PALB2 p.Q775X carrier who had papillary serous ovarian cystadenocarcinoma at age 58 among the 238 serous subtype ovarian cancer cases investigated, who also had breast cancer at age 52. Conclusion Our findings, taken together with previous reports, support adding PALB2 c.2323C>T p.Q775X to the list of cancer susceptibility genes for which founder mutations have been identified in the French Canadian population.

Background Tunisia is a North African country of 10 million inhabitants. The native background population is Berber. However, throughout its history, Tunisia has been the site of invasions and migratory waves of allogenic populations and ethnic groups such as Phoenicians, Romans, Vandals, Arabs, Ottomans and French. Like neighbouring and Middle Eastern countries, the Tunisian population shows a relatively high rate of consanguinity and endogamy that favor expression of recessive genetic disorders at relatively high rates. Many factors could contribute to the recurrence of monogenic morbid trait expression. Among them, founder mutations that arise in one ancestral individual and diffuse through generations in isolated communities. Method We report here on founder mutations in the Tunisian population by a systematic review of all available data from PubMed, other sources of the scientific literature as well as unpublished data from our research laboratory. Results We identified two different classes of founder mutations. The first includes founder mutations so far reported only among Tunisians that are responsible for 30 genetic diseases. The second group represents founder haplotypes described in 51 inherited conditions that occur among Tunisians and are also shared with other North African and Middle Eastern countries. Several heavily disabilitating diseases are caused by recessive founder mutations. They include, among others, neuromuscular diseases such as congenital muscular dystrophy and spastic paraglegia and also severe genodermatoses such as dystrophic epidermolysis bullosa and xeroderma pigmentosa. Conclusion This report provides informations on founder mutations for 73 genetic diseases either specific to Tunisians or shared by other populations. Taking into account the relatively high number and frequency of genetic diseases in the region and the limited resources, screening for these founder mutations should provide a rapid and cost effective tool for molecular diagnosis. Indeed, our report should help designing appropriate measures for carrier screening, better evaluation of diseases burden and setting up of preventive measures at the regional level.

10 páginas, 3 figuras, 3 tablas.-- et al.-- El pdf del artículo es la versión post-print., The distribution of BRCA1 and BRCA2 germ line mutations in breast/ovarian cancer families varies among different populations, which typically present a wide spectrum of unique mutations. Splicing mutation 5272-1G>A of BRCA1 and frameshift mutation 5374delTATG of BRCA2 are highly prevalent mutations in Castilla-León (Spain), accounting for 18.4% and 13.6% of BRCA1 and BRCA2 positive families, respectively. To test the presence of founder effects, 9 Spanish 5272-1G>A and 13 5374delTATG families were genotyped with polymorphic markers linked to BRCA1 or BRCA2. All the 5272-1G>A families shared a common haplotype in eight markers (1.1 Mb region) and the mutation age was estimated in 15 generations (∼380 years). A conserved haplotype associated to 5374delTATG was observed in four markers (0.82 Mb). The mutation occurred approximately 48 generations ago (∼1200 years). Each mutation likely arose from a common ancestor that could be traced to a small area of Castilla-León and expanded to other Spanish regions. They can have a significant impact on the clinical management of asymptomatic carriers as well as on the genetic screening strategy to be followed in populations with Spanish ancestries., This work has been supported by the Regional Government of Castilla y León, and grants PI061102, PI052275, PI050864) (Instituto de Salud Carlos III, Ministerio de Ciencia e Innovación), 200820I135 (Consejo Superior de Investigaciones Científicas, Ministerio de Ciencia e Innovación), INT07/191 (Instituto de Salud Carlos III), PGDIT06BTF910101PR (Xunta de Galicia). EB was supported by The Health Department of The Basque Country Government (BOPV, 17 Jul 2008, p.16983).

5 páginas, 1 figura, 1 tabla.-- et al.-- El pdf del artículo es el manuscrito de autor., The mutation spectrum of BRCA1 and BRCA2 presents a wide range of unique mutations in breast/ovarian cancer patients but recurrent mutations with founder effects have also been described. BRCA2 5344delAATA and 9538delAA are recurrent mutations in Castilla-Leo´n (Spain) representing 10.6% of BRCA2 positive families. By genotyping eleven chromosome 13 markers (4.3 Mb) we demonstrate that each mutation shows core haplotypes of 1.66 and 0.87 Mb, respectively, supporting a common ancestor in Castilla-Leo´n. Furthermore, both mutations are associated with earlier onset of breast cancer (5344delAATA: 37.4 years, P = 0.033; 9538delAA: 39.4 years, P = 0.008). The identification of founder effects improves the genetic screening strategy to be followed and facilitates the clinical management of asymptomatic carriers., This work has been supported by the Regional Government of Castilla y León, and grants PI061102 (Instituto de Salud Carlos III, Ministerio de Ciencia e Innovación) and 200820I135 (Consejo Superior de Investigaciones Científicas, Ministerio de Ciencia e Innovación).

Aims Mutations in the cardiac myosin-binding protein C gene (MYBPC3) are the most common genetic cause of hypertrophic cardiomyopathy (HCM) worldwide. The molecular mechanisms leading to HCM are poorly understood. We investigated the metabolic profiles of mutation carriers with the HCM-causing MYBPC3-Q1061X mutation with and without left ventricular hypertrophy (LVH) and non-affected relatives, and the association of the metabolome to the echocardiographic parameters. Methods and Results 34 hypertrophic subjects carrying the MYBPC3-Q1061X mutation, 19 non-hypertrophic mutation carriers and 20 relatives with neither mutation nor hypertrophy were examined using comprehensive echocardiography. Plasma was analyzed for molecular lipids and polar metabolites using two metabolomics platforms. Concentrations of branched chain amino acids, triglycerides and ether phospholipids were increased in mutation carriers with hypertrophy as compared to controls and non-hypertrophic mutation carriers, and correlated with echocardiographic LVH and signs of diastolic and systolic dysfunction in subjects with the MYBPC3-Q1061X mutation. Conclusions Our study implicates the potential role of branched chain amino acids, triglycerides and ether phospholipids in HCM, as well as suggests an association of these metabolites with remodeling and dysfunction of the left ventricle.

BRCA1 and BRCA2 gene mutations in patients with breast and/or ovarian cancer have been not characterized in the Turkish population until now. A total of 87 female subjects from two sets of families (38 families total) provided blood samples from which DNA was extracted. All coding exons of the BRCA1 and BRCA2 genes were screened for mutations with heteroduplex analysis and sequencing. Fourteen of the families (49 subjects comprising 17 patients and 32 unaffected relatives) had at least 2 women affected by breast and/or ovarian cancer. The other 24 families (38 subjects unaffected by breast and/or ovarian cancer) also had a history of these 2 forms of cancer. Six different sequence variants were detected: one previously described truncating mutation (5382insC) and one novel polymorphism (3663C -> A) in BRCA1, and 2 novel truncating mutations (9329insC and 9934insG), one novel intronic polymorphism 7069+41(TTTT -> AAAG), and one previously reported global polymorphism (1093A -> C) in BRCA2. BRCAPRO software was used for analysis, and the results showed that the level of risk for both breast and ovarian cancer increased with age in women who carried the mutation. In conclusion, these findings contribute significantly to what currently is known about the types and impact of germline BRCA1 and BRCA2 mutations in Turkish women.

Mutations in two major cancer susceptibility genes, BRCA1 and BRCA2 , predispose to early onset breast and ovarian cancer. Since 1994, genetic testing for germline mutations in these genes has been carried out in many countries in both diagnostic and research settings. Mutation analysis is usually done on the basis of a (family) history of breast or ovarian cancer—for example, (very) early age of onset, multiple affected close relatives, multiple tumours in one patient, and breast cancer in men.1–3 Ethnic background may also play a role in decisions about DNA testing, as in some populations founder BRCA1 or BRCA2 mutations are known to occur at relatively high prevalence (for example, 185delAG and 5382insC in BRCA1 and 6174delT in BRCA2 in Ashkenazi Jews4). In recent years several families have been described in which more than one BRCA mutation segregated, predominantly involving Ashkenazi Jewish founder mutations. These reports describe families that harbour two pathogenic BRCA1 mutations,5 one BRCA1 and one BRCA2 mutation,6,7,8,9,10,11,12,13,14,15,16,17 or even three pathogenic mutations in BRCA genes.18 Some of these families were uncovered because the index case appeared to carry two (founder) mutations, and only rarely was co-segregation of two different mutations suspected beforehand on the basis of the family history. This has led to the recommendation that one should always test for all three founder mutations in individuals of known Jewish ancestry.19 However, DH has also been reported without prior knowledge of Jewish ancestry.10,12,13,16,17,20 In this paper we present four new cases with mutations in both BRCA1 and BRCA2 and review and update the 30 cases reported in the literature, in order to investigate the phenotypic consequences of double heterozygosity (DH)—that is, the …

Numerous founder mutations have been reported in BRCA1 and BRCA2. For genetic screening of a population with a founder mutation, testing can be targeted to the mutation, allowing for a more rapid and less expensive test. In addition, more precise estimates of the prior probability of carrying a mutation and of the likelihood of a mutation carrier developing cancer should be possible. For a given founder mutation a large number of carriers are available, so that focused scientific studies of penetrance, expression, and genetic and environmental modifiers of risk can be performed. Finally, founder populations may be a powerful resource to localize additional breast cancer susceptibility loci, because of the reduction in locus heterogeneity.

To the Editor: Germline mutations in the BRCA1 (MIM 113705) and BRCA2 (MIM 600185) genes are associated with a high risk of breast and ovarian cancer in women (Ford et al. 1998). The risk of male breast cancer is higher among carriers of BRCA2 mutations compared with carriers of BRCA1 mutations, although the absolute risk to male carriers is not well characterized (Wooster et al. 1995; Ford et al. 1998). Studies of BRCA2 in small population- and clinic-based series of male breast cancer patients from the United States and the United Kingdom have found carrier frequencies of 4%–14% (Couch et al. 1996; Friedman et al. 1997; Mavraki et al. 1997). Carrier frequencies for specific founder BRCA2 germline mutations have been higher: 21%–40% (Thorlacius et al. 1996; Haraldsson et al. 1998; Csokay et al. 1999). The number of cases analyzed has ranged from 18 to 54, however, and the confidence limits on the carrier frequencies are very large. Among predominantly Ashkenazi Jewish populations, three founder mutations in the BRCA1/2 genes are present in >2% of all individuals, and they may account for ∼80% of all the mutations in these genes (Struewing et al. 1997; Frank et al. 1998). This allows the relatively efficient analysis of larger numbers of cases. All male patients with breast cancer (n=165) diagnosed in five Israeli hospitals during 1980–97 were reviewed for inclusion in this study. Jewish patients were characterized as Ashkenazi or non-Ashkenazi, on the basis of either the recorded place of birth in the Israeli Population Registry or, if they were born in Israel, their father's recorded place of birth. Non-Ashkenazi Jews were born in Turkey, Syria, Iraq, Iran, Afghanistan, Morocco, or Libya. Israeli-born non-Jews were designated as Arab, Christian, or Druze. Samples were analyzed anonymously. Among the 122 histologically verified cases for whom adequate pathological material could be obtained, 1 was excluded, because analysis from multiple specimens differed with respect to mutation status and marker genotypes. Eighty-nine cases were Ashkenazi, 21 were non-Ashkenazi, and 14 were Arabs. Unstained 5-μm paraffin sections were scraped from slides and were digested in 100 μl of buffer containing 10 mM Tris (pH 8.0), 50 mM KCl, 10 mM EDTA, 2 mM MgCl2, 1% Tween-20 and 10 μg of Proteinase K at 57°C overnight. The samples were then heated to 100°C for 5 min and then 1–5 μl were used as template in the PCR reactions. A 20-μl multiplex PCR reaction was used to amplify the three segments containing the founder mutations. Each reaction contained 1 × PCR Buffer, 2.5 mM MgCl2, 100 μM each dNTP, 15% sucrose, and 0.75 U Taq Gold (PE Biosystems). Primers included 300 nM 2F103 (6FAM-tcgcgttgaagaagtacaaaatgtc), 300 nM 2R102 (caaattaatacactcttgtgctgacttac), 200 nM 20F101 (HEX-gtcaatggaagaaaccaccaaggtc), 200 nM 20R101 (tgcaaaggggagtggaatacacagt), 200 nM 11F101 (TET-tagggaagcttcataagtcagtctca), and 200 nM 11R101 (cttgcgttttgtaatgaagcatct). Cycling consisted of 94°C for 12 min, followed by 10 cycles of 92°C for 10 s, annealing at 68°C for 10 s, and 72°C for 20 s, with the annealing temperature being decreased 1.5°C per cycle, followed by 30 cycles of 92°C for 15 s, 55°C for 15 s, and 72°C for 30 s, followed by 72°C for 10 min. The PCR products were diluted 1:149 with water and then were diluted 1:6 with loading cocktail, according to the manufacturers' recommendations, and were electrophoresed on an ABI 310 capillary electrophoresis machine by use of GENESCAN software (PE Biosystems). Known mutant, wild-type, and no-DNA controls were run with each PCR reaction. Mutants were identified by visual inspection of the electropherograms, with the small-insertion or -deletion mutations resulting in an extra peak in the pattern. Primers to amplify the chromosome 13 markers D13S260, D13S1695, D13S1698, and D13S1701 were redesigned to result in shorter amplicons. All carriers of the 6174delT mutation and a reference family with this mutation were analyzed for these four markers, on the ABI 310 (primer sequences are available, on request, from the corresponding author.) The results of mutation testing are shown in table 1. Of the 19 mutation carriers, 17 were Ashkenazi and 2 were non-Ashkenazi Jews. Carrier frequencies were not statistically different between the two ethnic groups (P=.7). None of the Arab men was a carrier, and the 5382insC mutation was not detected in any patients. The mean ages at diagnosis of all 19 mutation carriers (64 years) and of the BRCA2 6174delT mutation carriers (66 years) were not significantly different than that of noncarriers (68 years). Reliable genotypes could not be obtained for all the markers for all carriers, but 14 of 14 carriers successfully genotyped at D13S1698 shared the same allele as was seen in the reference family; 12 of 12 carriers successfully genotyped at D13S260 shared the correct allele; 7 of 8 carriers successfully genotyped at D13S1701 shared the correct allele; and 13 of 15 carriers successfully genotyped at D13S1695 shared the correct allele. Table 1 Israeli Male-Breast-Cancer Mutation Testing Results These results suggest that ⩾17% of Jewish men diagnosed with breast cancer in Israel carry a mutation in BRCA1 or BRCA2, since only the three common founder mutations were screened. This study was based on the analysis of a small amount of pathological tissue, and the proportion of the tissue that was tumor was unknown. Our methods may have led both to false negatives, caused by the complete loss of the relevant genes in a tumor—although this might be expected to result in preferential loss of the wild-type and retention of the mutant allele—and false positives, caused by contamination of the specimens during processing and handling. Our observed carrier frequency is somewhat higher than those in most series studied in the United States and the United Kingdom but is lower than frequencies observed in several other populations with common founder mutations. Unlike that in female carriers, who have an earlier age at diagnosis of breast cancer, the age at diagnosis among male carriers was not significantly lower than among noncarriers. This may reflect the fact that most men carried a BRCA2 mutation, because the age at diagnosis for female breast cancer appears to be later for BRCA2 carriers than for BRCA1 carriers (Ford et al. 1998). The BRCA1 185delAG founder mutation has been observed in both Ashkenazi and non-Ashkenazi Jewish women with breast or ovarian cancer (Bar-Sade et al. 1998). We observed the 6174delT mutation in two non-Ashkenazi Jewish men with breast cancer, and this is the first published observation of this mutation in this population (Neuhausen et al. 1998). Our characterization of Jewish men as Ashkenazi or non-Ashkenazi was based on the place of birth as recorded in the Israeli Population Registry. Since ethnic origin was not determined in person or by biological testing, some misclassification could have occurred. If verified in other studies, however, this finding would suggest that this mutation is considerably older than previously estimated (Neuhausen et al. 1998). Genotyping of four microsatellite markers near BRCA2 was consistent with their sharing the same haplotype as was seen in Ashkenazi carriers of this mutation. Although the number of cases was small, we did not observe an earlier age at onset among mutation carriers, nor did we detect any of the three mutations in Arab men with breast cancer.

Background: Previous data suggest that mitral valve leaflets are elongated in hypertrophic cardiomyopathy (HCM), and mitral valve leaflet elongation may constitute a primary phenotypic expression of HCM. Our objective was to measure the length of mitral valve leaflets by cardiovascular magnetic resonance (CMR) in subjects with HCM caused by a Finnish founder mutation in the myosin-binding protein C gene (MYBPC3-Q1061X), carriers of the same mutation without left ventricular hypertrophy, as well as in unselected consecutive patients with HCM, and respective controls. Methods: Anterior mitral valve leaflet (AML) and posterior mitral valve leaflet (PML) lengths were measured by CMR in 47 subjects with the Q1061X mutation in the gene encoding MYBPC3 and in 20 healthy relatives without the mutation. In addition, mitral valve leaflet lengths were measured by CMR in 80 consecutive non-genotyped patients with HCM in CMR and 71 age-and gender-matched healthy subjects. Results: Of the subjects with the MYBPC-Q1016X mutation, 32 had left ventricular hypertrophy (LVH, LV maximal wall thickness >= 13 mm in CMR) and 15 had no hypertrophy. PML was longer in patients with the MYBPC3-Q1061X mutation and LVH than in controls of the MYBPC group (12.8 +/- 2.8 vs 10.6 +/- 1.9 mm, P = 0.013), but the difference between the groups was not statistically significant when PML was indexed for BSA (P = 0.066), or when PML length was adjusted for BSA, age, gender, LV mass and ejection fraction (P = 0.195). There was no significant difference in the PML length in mutation carriers without LVH and controls (11.1 +/- 3.4 vs 10.6 +/- 1.9, P = 0.52). We found no difference in AML lengths between the MYBPC mutation carriers with or without hypertrophy and controls. In 80 consecutive non-genotyped patients with HCM, there was no difference either in AML or PML lengths in subjects with HCM compared to respective control subjects. Conclusions: In subjects with HCM caused by the Q1061X mutation in the MYBPC3 gene, the posterior mitral valve leaflets may be elongated, but mitral valve elongation does not constitute primary phenotypic expression of the disease. Instead, elongated mitral valve leaflets seem to be associated with body size and left ventricular remodeling.

Background The involvement of Wnt in carcinogenesis and progression of pancreatic cancer is currently intensely discussed. We evaluated activation of the Wnt signaling pathway by using a Wnt reporter mouse strain expressing β-galactosidase under the control of the Axin2 promotor during pancreatitis induced formation of precancerous lesions. We also evaluated activation of Wnt signaling during interaction of pancreatic cancer with the tumor stroma. Results Activation of Wnt signaling was observed during acinar-to-ductal metaplasia after chronic as well as acute pancreatitis. Activation of Wnt signaling was also noticed during growth of pancreatic cancer in an orthotopic syngeneic pancreas cancer model. Activation of Wnt signaling was, however, not observed in carcinoma associated fibroblasts, but was detected in few cell clusters inside the tumor. Genetic ablation of Axin2 significantly reduced body weight without having a major impact on blood glucose concentration. However, ablation of Axin2 had no influence on the observed β-galactosidase positive cell clusters or on tumor weight. Conclusion These data demonstrate that the Wnt signaling pathway is activated during acinar-to-ductal metaplasia after injury to the pancreas. However these data do not support a major role of Wnt signaling or of Axin2 in carcinoma associated fibroblasts and tumor growth. Electronic supplementary material The online version of this article (doi:10.1186/s13578-016-0116-4) contains supplementary material, which is available to authorized users.

Background Relatives of BRCA1 and BRCA2 mutation carriers have long been proposed by epidemiological studies to have an increased risk of developing prostate cancer. In the Ashkenazi Jewish (AJ) population, the existence of 3 frequent founder mutations, 185delAG and 5382insC in BRCA1 and 6174delT in BRCA2 greatly facilitates screening for carriers. Methods We tested 146 AJ men with confirmed diagnoses of invasive prostate cancer. Thirteen had at least one first degree relative with prostate cancer. The median age at diagnosis of participants was 67.9 years (range 48.6–84.2 years). Subjects were screened for the BRCA1:185delAG, BRCA1:5382insC and BRCA2:6174delT mutations simultaneously using a multiplex sizing assay detecting band shifts in the presence of the variant sequence. Results Two out of 146 individuals were found to carry the germline BRCA2 mutation 6174delT (1.4%); the previously reported population frequency for this mutation is ~1% in AJ. We found no BRCA1 mutations. One carrier had 2 uncles affected with prostate cancer, while the other had an uncle and daughter with breast cancer. We combined our results with previously published data examining these 3 founder AJ mutations in men with prostate cancer and in population controls. Including our results, studies to date reported 5/463 (1.1%), 2/293 (0.68%) and 7/461 (1.3%) carriers for the BRCA1:185delAG, BRCA1:5382insC and BRCA2:6174delT mutations in prostate cancer cases, respectively. This compares with combined reported frequencies of 85/9371 (0.91%), 24/8867 (0.27%) and 119/9514 (1.3%) for the same mutations in control individuals. There was no statistically significant excess of mutations in cases compared to controls in either gene. Conclusions Our observations remain preliminary. By combining all studies published to date, we have an 80% power to detect ORs of 2.7, 6.6 and 2.5 (185delAG, 5382insC and 6174 delT, respectively) while the values we observed range between 1.0 and 2.5. However, the contribution of rare mutations with such low odds ratios to the population prostate cancer burden is unlikely to be large enough to be clinically useful. Thus, contrary to suggestions from some previous epidemiological data, our observations do not support an important role for AJ founder BRCA1/2 mutations in prostate cancer risk.