Search

Background LY393558 is a combined antagonist of serotonin (5-HT) 5-HT1B receptors and inhibitor of serotonin transporter (SERT). LY393558 reduces 5-HT-induced vasoconstriction and remodelling of rat and/or mouse pulmonary arteries. The aim of our study was to examine the effect of LY393558 on the 5-HT-stimulated vasoconstriction of human pulmonary arteries (hPAs) and to determine the underlying mechanism(s). Methods Vascular effects of 5-HT receptor agonists, antagonists and a SERT inhibitor were examined in organ bath studies on intralobar hPAs obtained from patients during resection of lung carcinoma. Results Serotonin and agonists of the 5-HT1B receptor (5-carboxamidotryptamine, 5-CT) and 5-HT2A receptor (α-methyl-5-HT) contracted endothelium-intact hPAs in a concentration-dependent fashion. The 5-HT1B antagonists SB224289 and GR55562 reduced responses induced by 5-HT and 5-CT and the 5-HT2A antagonist ketanserin inhibited the effects of 5-HT and α-methyl-5-HT. Administration of the SERT inhibitor citalopram (at a concentration that failed to modify the 5-HT-induced vasoconstriction) in combination with SB224289 or GR55562 was more effective in inhibiting the response to 5-HT than the 5-HT1B antagonists alone. LY393558 showed the greatest antagonistic effect against the vasoconstriction elicited by 5-HT, 5-CT and α-methyl-5-HT. Conclusions LY393558 reduces the 5-HT-induced contraction antagonizing 5-HT1B and 5-HT2A receptors probably due to synergic interaction between SERT inhibition and 5-HT1B receptor antagonism. Thus, it might represent a valuable future option in the pulmonary arterial hypertension therapy.

GPR18 receptor protein was detected in the heart and vasculature and appears to play a functional role in the cardiovascular system. We investigated the effects of the new GPR18 agonists PSB-MZ-1415 and PSB-MZ-1440 and the new GPR18 antagonist PSB-CB-27 on isolated human pulmonary arteries (hPAs) and compared their effects with the previously proposed, but unconfirmed, GPR18 ligands NAGly, Abn-CBD (agonists) and O-1918 (antagonist). GPR18 expression in hPAs was shown at the mRNA level. PSB-MZ-1415, PSB-MZ-1440, NAGly and Abn-CBD fully relaxed endothelium-intact hPAs precontracted with the thromboxane A2 analog U46619. PSB-CB-27 shifted the concentration-response curves (CRCs) of PSB-MZ-1415, PSB-MZ-1440, NAGly and Abn-CBD to the right; O-1918 caused rightward shifts of the CRCs of PSB-MZ-1415 and NAGly. Endothelium removal diminished the potency and the maximum effect of PSB-MZ-1415. The potency of PSB-MZ-1415 or NAGly was reduced in male patients, smokers and patients with hypercholesterolemia. In conclusion, the novel GPR18 agonists, PSB-MZ-1415 and PSB-MZ-1440, relax hPAs and the effect is inhibited by the new GPR18 antagonist PSB-CB-27. GPR18, which appears to exhibit lower activity in hPAs from male, smoking or hypercholesterolemic patients, may become a new target for the treatment of pulmonary arterial hypertension.

Muscarinic M

Aims This study was performed to examine whether hypertension affects the sympathetic transmission to resistance vessels of pithed rats via inhibitory presynaptic cannabinoid CB1 receptors and whether endocannabinoids are involved in this response. Materials and methods We compared uninephrectomised rats rendered hypertensive by high salt diet and deoxycorticosterone acetate (DOCA) injections with normotensive animals (uninephrectomy only). Experiments were performed on vagotomised and pithed animals. Increases in diastolic blood pressure (DBP) were induced four times (S1–S4) by electrical stimulation or phenylephrine injection. Key findings Electrical stimulation (0.75 Hz, 1 ms, 50 V, 5 impulses) of the preganglionic sympathetic nerve fibres innervating the blood vessels more strongly increased DBP in normotensive than in DOCA–salt rats. Phenylephrine (0.01 μmol/kg) induced similar increases in DBP in both groups. The cannabinoid receptor agonist CP55940 (0.01–1 μmol/kg) did not modify the rises in DBP induced by phenylephrine. However, it inhibited the electrically stimulated increases in DBP, more strongly in DOCA–salt than in normotensive animals (maximally by 50 and 30%, respectively). The effect of CP55940 was attenuated by the CB1 antagonist AM251 (3 μmol/kg). AM251 enhanced the neurogenic vasopressor response during S4 by itself in hypertensive rats only. URB597 (3 μmol/kg), which inhibits degradation of the endocannabinoid anandamide, did not modify the electrically stimulated increases in DBP. Significance The function of inhibitory presynaptic CB1 receptors on sympathetic nerves is enhanced in DOCA–salt hypertensive rats. Thus, the CB1 receptor-mediated inhibition of noradrenaline release from the sympathetic nerve fibres innervating the resistance vessels might play a protective role in hypertension.

The cannabinoid CB1 receptors on the noradrenergic neurons in guinea pig hippocampal slices show an endogenous endocannabinoid tone. This conclusion is based on rimonabant, the facilitatory effect of which on noradrenaline release might be due to its inverse CB1 receptor agonism and/or the interruption of a tonic inhibition elicited by endocannabinoids. To examine the latter mechanism, a neutral antagonist would be suitable. Therefore, we studied whether O-2050 is a neutral CB1 receptor antagonist in the guinea pig hippocampus and whether it mimics the facilitatory effect of rimonabant. CB1 receptor affinity of O-2050 was quantified in cerebrocortical membranes, using (3)H-rimonabant binding. Its CB1 receptor potency and effect on (3)H-noradrenaline release were determined in superfused hippocampal slices. Its intrinsic activity at CB1 receptors was studied in hippocampal membranes, using (35)S-GTPγS binding. Endocannabinoid levels in hippocampus were determined by liquid chromatography-multiple reaction monitoring. O-2050 was about ten times less potent than rimonabant in its CB1 receptor affinity, potency and facilitatory effect on noradrenaline release. Although not affecting (35)S-GTPγS binding by itself, O-2050 shifted the concentration-response curve of a CB1 receptor agonist to the right but that of rimonabant to the left. Levels of anandamide and 2-arachidonoyl glycerol in guinea pig hippocampus closely resembled those in mouse hippocampus. In conclusion, our results with O-2050 confirm that the CB1 receptors on noradrenergic neurons of the guinea pig hippocampus show an endogenous tone. To differentiate between the two mechanisms leading to an endogenous tone, O-2050 is not superior to rimonabant since O-2050 may increase the inverse agonistic effect of endocannabinoids.

It has been suggested that activation of nuclear peroxisome proliferator-activated receptors γ (PPARγ) may represent a new strategy for the treatment of pulmonary arterial hypertension. It has been demonstrated that PPARγ activation relaxed the isolated mouse pulmonary artery. The aims of the present study were to examine whether and to which extent the two PPARγ agonists rosiglitazone and pioglitazone relax the isolated human pulmonary artery and to investigate the underlying mechanism(s). Isolated human pulmonary arteries were obtained from patients without clinical evidence of pulmonary hypertension during resection of lung carcinoma. Vasodilatory effects of PPARγ agonists were examined on endothelium-intact or endothelium-denuded vessels preconstricted with the thromboxane prostanoid receptor agonist U-46619. Rosiglitazone and pioglitazone (0.01–100 μM) caused a concentration- and/or time-dependent full relaxation of U-46619-preconstricted vessels. The rosiglitazone-induced relaxation was attenuated by the PPARγ antagonist GW9662 1 μM, endothelium denudation, the nitric oxide synthase inhibitor L-NAME 300 μM, the cyclooxygenase inhibitor indomethacin 10 μM, and the KATP channel blocker glibenclamide 10 μM. The prostacyclin IP receptor antagonist RO1138452 1 μM shifted the concentration–response curve for rosiglitazone to the right. The PPARγ agonists pioglitazone and rosiglitazone relax human pulmonary arteries. The rosiglitazone-induced vasorelaxation is partially endothelium-dependent and involves PPARγ receptors, arachidonic acid degradation products, nitric oxide, and KATP channels. Thus, the relaxant effect of PPARγ agonists in human pulmonary arteries may represent a new therapeutic target in pulmonary arterial hypertension.

Drug discovery strives for selective ligands to achieve targeted modulation of tissue function. Here we introduce engineered context-sensitive agonism as a postreceptor mechanism for tissue-selective drug action through a G protein-coupled receptor. Acetylcholine M2-receptor activation is known to mediate, among other actions, potentially dangerous slowing of the heart rate. This unwanted side effect is one of the main reasons that limit clinical application of muscarinic agonists. Herein we show that dualsteric (orthosteric/allosteric) agonists induce less cardiac depression ex vivo and in vivo than conventional full agonists. Exploration of the underlying mechanism in living cells employing cellular dynamic mass redistribution identified context-sensitive agonism of these dualsteric agonists. They translate elevation of intracellular cAMP into a switch from full to partial agonism. Designed context-sensitive agonism opens an avenue toward postreceptor pharmacologic selectivity, which even works in target tissues operated by the same subtype of pharmacologic receptor.

Intravenous (i.v.) injection of the endocannabinoid anandamide induces triphasic cardiovascular responses, including a pressor effect mediated via unknown central and peripheral mechanism(s). The aim of the present study was to determine the central mechanism(s) responsible for the pressor response to anandamide. For this purpose, the influence of antagonists at thromboxane A(2) TP (sulotroban, daltroban, SQ 29548), NMDA (MK-801) and beta(2)-adrenergic receptors (ICI 118551) on the pressor effect induced by i.v. and intracerebroventricularly (i.c.v.) administered anandamide was examined in urethane-anaesthetized rats. Anandamide (1.5-3 micromol/kg, i.v.) or its stable analogue methanandamide (0.75 micromol/kg, i.v.) increased blood pressure by 25%. Anandamide (0.03 mumol per animal i.c.v.) caused a pure pressor effect (by 20%) but only in the presence of antagonists of CB(1) and TRPV1 receptors. The effects of cannabinoids (i.v. or i.c.v.) were diminished by i.v. daltroban, sulotroban (10 mumol/kg each), and/or SQ 29548 (1 mumol/kg). The effect of anandamide i.v. was reduced by SQ 29548 (0.02 mumol per animal i.c.v.) and by the thromboxane A(2) synthesis inhibitor furegrelate i.c.v. (1.8 micromol per animal). ICI 118551, MK-801 (1 micromol/kg i.v. each), and bilateral adrenalectomy diminished the effect of anandamide i.c.v. Sulotroban (i.v.) failed to affect the response to anandamide (i.v.) in pithed rats, and anandamide and methanandamide did not bind to TP receptors in rat platelets. The present study suggests that central beta(2)-adrenergic, NMDA and thromboxane A(2) receptors are involved in the anandamide-induced adrenal secretion of catecholamines and their pressor effect in urethane-anaesthetized rats.

Prostaglandin E(2) (PGE(2)) and its analogue sulprostone inhibit noradrenaline and serotonin release in rodent tissues. We examined whether the receptor involved is blocked by the EP(3) antagonist L-826,266, whether such receptors also occur on central cholinergic neurones and retinal dopaminergic cells, whether PGE(2) is produced by the degradation of the endocannabinoid virodhamine and whether EP(3) receptor activation stimulates (35)S-GTPgammaS binding. Transmitter release was studied as electrically evoked tritium overflow in superfused tissues preincubated with (3)H-noradrenaline (which in the guinea pig retina labels dopaminergic cells), (3)H-serotonin or (3)H-choline. (35)S-GTPgammaS binding, a measure of G protein activation, was studied in mouse and guinea pig hippocampal membranes. L-826,266 antagonised the effect of sulprostone on noradrenaline release in the rat cortex, yielding a Schild plot-based pA(2) value of 7.56. Apparent pA(2) values in mouse cortex and rat vas deferens (noradrenaline release) and rat cortex (serotonin release) were 7.55, 7.87 and 7.67, respectively. PGE(2) did not affect acetylcholine release in rat brain and dopamine release in guinea pig retina. In seven mice tissues, noradrenaline release was inhibited by sulprostone but not affected by virodhamine. (35)S-GTPgammaS binding was not altered by sulprostone but stimulated by the cannabinoid agonist WIN 55,212-2. Prostaglandins of the E series inhibit monoamine release via EP(3) receptors at which L-826,266 is a competitive antagonist. EP(3) receptors that inhibit transmitter release are not present on central cholinergic neurones and retinal dopaminergic cells. Virodhamine is not converted to PGE(2). An EP(3) receptor model based on (35)S-GTPgammaS binding could not be identified.

Background and purpose: We examined whether cannabinoid CB1 and histamine H3 receptors resemble α2-adrenoceptors in that their presynaptically mediated cardiovascular effects are less marked in urethane- than in pentobarbitone-anaesthetized pithed rats. Experimental approach: Effects of the cannabinoid agonist CP-55,940 and the H3 receptor agonist imetit on electrically induced tachycardic and vasopressor responses, respectively, was compared in pithed rats anaesthetized with urethane or pentobarbitone. The affinity of urethane for the three receptors was measured by radioligand binding studies in rat brain cortex membranes and its potency assessed in superfused mouse tissues preincubated with 3H-noradrenaline. Key results: The neurogenic tachycardic response was less markedly inhibited by CP-55,940 in urethane- than in pentobarbitone-anaesthetized pithed rats. Imetit inhibited the neurogenic vasopressor response after pentobarbitone but not after urethane. The catecholamine-induced tachycardic and vasopressor response did not differ between rats anaesthetized with either compound. Urethane 10 mM (plasma concentration reached under anaesthesia) did not affect binding to CB1 or H3 receptors and α2 adrenoceptors, nor did it alter the inhibitory effect of agonists at the three receptors on electrically evoked 3H-noradrenaline release. Conclusions and implications: Urethane, but not pentobarbitone, abolished the H3 receptor-mediated vascular response in pithed rats and attenuated the CB1 receptor-mediated cardiac response much more than pentobarbitone. The weaker effects of CB1, H3 and α2 receptor agonists cannot be explained by antagonism by urethane at the three receptors in vitro. Pentobarbitone, but not urethane, is suitable as an anaesthetic for investigations of inhibitory presynaptic receptor function in pithed and anaesthetized rats.

The histamine H4 receptor is coupled to Gi/o proteins and expressed on inflammatory cells and lymphoid tissues; it was suggested that this receptor also occurs in the brain or on peripheral neurones. Since many Gi/o protein-coupled receptors, including the H3 receptor, serve as presynaptic inhibitory receptors, we studied whether the sympathetic neurones supplying four peripheral tissues and the cholinergic neurones in the hippocampus from the guinea-pig are equipped with release-modulating H4 and H3 receptors. For this purpose, we preincubated tissue pieces from the aorta, atrium, renal cortex and vas deferens with 3H-noradrenaline and hippocampal slices with 3H-choline and determined the electrically evoked tritium overflow. The stimulation-evoked overflow in the five superfused tissues was inhibited by the muscarinic receptor agonist oxotremorine, which served as a positive control, but not affected by the H4 receptor agonist 4-methylhistamine. The H3 receptor agonist R-α-methylhistamine inhibited noradrenaline release in the peripheral tissues without affecting acetylcholine release in the hippocampal slices. Thioperamide shifted the concentration–response curve of histamine in the aorta and the renal cortex to the right, yielding apparent pA2 values of 8.0 and 8.1, respectively, which are close to its affinity at other H3 receptors but higher by one log unit than its pKi at the H4 receptor of the guinea-pig. In conclusion, histamine H4 receptors could not be identified in five experimental models of the guinea-pig that are suited for the detection of presynaptic inhibitory receptors whereas H3 receptors could be shown in the peripheral tissues but not in the hippocampus. This article is part of the Special Issue entitled ‘Histamine Receptors’.

A supersensitivity of the beta-adrenoceptor-mediated chronotropic response has been demonstrated in atria isolated from rats subjected to septic shock. Our study was undertaken to investigate whether bacterial endotoxin/LPS affects the increase in heart rate induced by beta-adrenoceptor agonists in the rat also in vivo. In pithed and vagotomized rats, the nonselective beta-adrenoceptor agonist isoprenaline (0.05-0.15 nmol/kg) and agonists at the high- and low-affinity state of beta1-adrenoceptors, that is, prenalterol (0.3-3 nmol/kg) and (+/-)-4-[3-[(1,1-dimethylethyl)amino]-2-hydroxypropoxy]-1,3-dihydro-2H-benzimidazole-2-one (CGP 12177; 3-6 nmol/kg), respectively, and at beta2-adrenoceptors, that is, fenoterol (1-5 nmol/kg), increased heart rate by 50 to 60 beats/min. Administration of LPS (0.4, 1, and 1.5 mg/kg), under continuous infusion of vasopressin, dose-dependently amplified the chronotropic response to isoprenaline, prenalterol, and fenoterol (by 80%, 50%, and 100%, respectively) but not to CGP 12177. The beta2-adrenoceptor antagonist erythro-(+/-)-1-(7-methylindan-4-yloxy)-3-isopropylaminobutan-2-ol (ICI 118551 0.1 mumol/kg) did not affect the chronotropic responses of isoprenaline, fenoterol, and prenalterol under non-endotoxic conditions, but abolished the potentiation of tachycardia produced by LPS (1.5 mg/kg). The beta1-adrenoceptor antagonist (+/-)-2-hydroxy-5-[2-[[2-hydroxy-3-[4-[1-methyl-4-(trifluoromethyl)-1H-imidazol-2-yl]-phenoxy]propyl]-amino]ethoxy]-benzamide CGP 20712A; 0.1 mumol/kg almost completely reduced the chronotropic effects of isoprenaline, fenoterol, and prenalterol both in control rats and in animals exposed to LPS (1.5 mg/kg). We conclude that LPS sensitizes cardiac beta-adrenoceptors by recruiting functionally active beta2-adrenoceptors, but the amplification of tachycardia occurs only when both beta1- and beta2-adrenoceptors are concomitantly activated. The pithed rat may serve as a model to examine the beta-adrenoceptor supersensitivity in vivo.

Cannabinoids exert complex effects on blood pressure related to their interference with cardiovascular centres in the central nervous system and to their direct influence on vascular muscle, vascular endothelium and heart. In view of the relative lack of information on the occurrence of CB1 receptors on the vascular postganglionic sympathetic nerve fibres, the aim of the present study was to examine whether cannabinoid receptor ligands affect the electrically evoked tritium overflow in superfused vessels (tissue pieces) from the guinea-pig, the rat and the mouse preincubated with 3H-noradrenaline. The cannabinoid receptor agonist WIN 55,212-2 (R(+)-[2,3-dihydro-5-methyl-3-[(morpholinyl)methyl]-pyrrolo[1,2,3-de]1,4-benzoxazinyl](1-naphthalenyl) methanone) inhibited the evoked tritium overflow in the guinea-pig aorta, but not in that of the rat or mouse. The concentration-response curve of WIN 55,212-2 was shifted to the right by the CB1 receptor antagonist rimonabant, yielding an apparent pA2 value of 7.9. The most pronounced (near-maximum) inhibition obtained at the highest WIN 55,212-2 concentration applied (3.2 microM) amounted to 40%. WIN 55,212-2 also inhibited the evoked overflow in guinea-pig pulmonary artery, basilar artery and portal vein, again in a manner sensitive to antagonism by rimonabant. The latter did not affect the evoked overflow by itself in the four vessels, but did increase the electrically evoked tritium overflow from superfused guinea-pig hippocampal slices preincubated with 3H-choline and from superfused guinea-pig retina discs preincubated with 3H-noradrenaline (labelling dopaminergic cells in this tissue). The inhibitory effect of 3.2 microM WIN 55,212-2 on the evoked overflow from the guinea-pig aorta was comparable in size to that obtained with agonists at the histamine H3, kappa opioid (KOP) and ORL1 (NOP) receptor (1 or 10 microM, producing the respective near-maximum effects) whereas prostaglandin E2 1 microM caused a higher near-maximum inhibition of 70%. Prostaglandin E2 also induced an inhibition by 65 and 80% in the rat and mouse aorta respectively, indicating that the present conditions are basically suitable for detecting presynaptic receptor-mediated inhibition of noradrenaline release. The results show that the postganglionic sympathetic nerve fibres in the guinea-pig aorta, but not in the rat or mouse aorta, are endowed with presynaptic inhibitory cannabinoid CB1 receptors; such receptors also occur in guinea-pig pulmonary artery, basilar artery and portal vein. These CB1 receptors are not subject to an endogenous tone and the extent of inhibition obtainable via these receptors is within the same range as that of several other presynaptic heteroreceptors, but markedly lower than that obtainable via receptors for prostaglandin E2.

Presynaptically localized adrenoceptors occur on a variety of neurones. In particular, alpha2-adrenoceptors, occurring on neurones of the peripheral and central nervous system, inhibit the release of the respective transmitters whereas beta2-adrenoceptors on some types of postganglionic sympathetic neurones facilitate noradrenaline release. Since only little information is available whether there are also presynaptic beta3-adrenoceptors, we examined the effect of beta3-adrenoceptor agonists on noradrenaline release from the resistance vessels and the hippocampus of the rat and on serotonin and acetylcholine release from the rat hippocampus. In rat hippocampal slices preincubated with (H-noradrenaline, 3H-serotonin and 3H-choline and superfused in the presence of an inhibitor of the neuronal transporter of the respective neurone, the beta3-adrenoceptor agonist CL 316243 did not affect the electrically evoked tritium overflow. The latter was, however, inhibited by at least 50% by agonists of the respective autoreceptors. CL 316243 and another three beta3-adrenoceptor agonists (BRL 37344, ZD 2079 and CGP 12177) failed to affect the electrically evoked tritium overflow also in slices preincubated with 3H-noradrenaline and superfused in the presence of the alpha2-adrenoceptor antagonist rauwolscine whereas prostaglandin E2 caused a marked inhibition. In pithed and vagotomized rats, the increase in diastolic blood pressure induced by electrical stimulation of the sympathetic outflow was also not affected by CL 316243 but markedly inhibited by the cannabinoid receptor agonist WIN 55212-2. CL 316243 and WIN 55212-2 were devoid of an effect on the rise in diastolic blood pressure induced by exogenous noradrenaline. In conclusion, our data suggest that the noradrenergic neurones innervating the resistance vessels of the rat and the noradrenergic, serotoninergic and cholinergic neurones of the rat hippocampus are not endowed with presynaptic beta3-adrenoceptors.

We examined whether replacement of imidazole by a piperidine or pyrrolidine moiety will affect the potency and affinity of six H3-receptor antagonists. Potencies were determined in superfused mouse brain cortex slices preincubated with [3H]noradrenaline, in which the interaction of the antagonists with histamine with respect to its inhibitory effect on the electrically evoked tritium overflow was studied. Affinities were determined in mouse brain cortex membranes, using the radioligand [3H] N(alpha)-methylhistamine. The concentration-response curve of histamine for its effect on the evoked overflow from mouse brain cortex slices was shifted to the right by the 13 compounds under study. Replacement of the imidazole by a piperidine ring affected the p A2 value as follows: thioperamide, -2.7 log units; clobenpropit, -1.9; proxyfan, -1.3; FUB 138, -1.2. Potency hardly changed (or =0.4 log units) when imidazole was replaced by piperidine in FUB 181 and by piperidine or pyrrolidine in FUB 153. Binding of [3H] N (alpha)-methylhistamine to mouse brain cortex membranes was inhibited monophasically by all compounds. The p K(i) values closely matched their p A2 values with three exceptions. The p K(i) values of proxyfan, FUB 138, and FUB 153 exceeded their respective p A(2) values by about 1 log unit. To reveal a potential partial agonism, the effect of the three drugs on (1) the electrically evoked tritium overflow and (2) [35S]GTPgammaS binding in mouse cortex preparations was determined. Proxyfan proved to be a partial agonist in both models (with intrinsic activities of 0.2 and 0.3, respectively) whereas FUB 138 and FUB 153 were devoid of agonistic effects. In conclusion, replacement of imidazole by piperidine or pyrrolidine affects the antagonist potencies of six H3-receptor antagonists in a very different manner. The piperidine analogue of FUB 181 (with a p A2 value as high as 7.7) may represent a lead for the development of non-imidazole H3-receptor antagonists. The discrepancy between the p K(i) and p A2 values may be accounted for by partial agonism in the case of proxyfan but can, at present, not be satisfactorily explained with respect to FUB 138 and FUB 153.

Aims This study was performed to examine whether acute pressure overload induced by transverse aortic constriction (TAC) inhibits the neurogenic vasopressor response and, if so, to check the role of cannabinoid CB 1 receptors and/or other mechanisms. Main methods TAC or a sham operation was performed in pithed and vagotomised rats; sham-operated rats were infused with vasopressin to ensure a basal systolic blood pressure (SBP) comparable to that of TAC animals. SBP was increased by 40 mm Hg by electrical stimulation of the preganglionic sympathetic nerve fibres or phenylephrine injection. At the end of the experiments, the atria and aorta were isolated. Key findings TAC reduced the electrically (but not the chemically) induced pressor response by 80%; sham operation plus vasopressin had no effect. While the cannabinoid receptor agonist CP55940 and antagonists of CB 1 receptors (AM251), α 2 -adrenoceptors (rauwolscine) and K ATP channels (glibenclamide) did not modify the inhibitory effect of TAC, adrenal medulla removal did prevent this effect. The contractile effects of noradrenaline and isoprenaline were reduced (isolated left atria), whereas their chronotropic effects (right atria) were not affected by TAC, which also spared the vasoconstrictor responses to phenylephrine (isolated aorta). Significance Acute pressure overload induced by TAC reduces the neurogenic vasopressor response via an unknown presynaptic mechanism, an increase in heart rate induced by catecholamines released from the adrenal medulla and a decrease in the catecholamine-induced heart contractility. A better understanding of the negative consequences induced by the acute pressure overload may help in the design of future heart failure therapies.

In previous studies, long-term cannabis use led to alterations of the endocannabinoid system including an increase in CB1 and/or CB2 receptor messenger RNA (mRNA) in blood cells and an increase in the serum level of the endocannabinoid 2-arachidonoyl glycerol. However, in those studies, cannabis use was stopped only few days before testing or not interrupted at all. Therefore, one cannot decide whether the alterations are due to long-term cannabis abuse or are confounded by acute effects of cannabis. Blood was sampled from donors that had smoked marijuana ≥20 times in their lives but had abstained from cannabis for ≥6 months (high-frequency users, HFU) and from controls (cannabis use ≤5 times lifetime). CB1 and CB2 mRNA was determined in peripheral mononuclear blood cells using the reverse transcriptase polymerase chain reaction. Serum anandamide level was assayed using electrospray tandem mass spectrometry. CB2 mRNA was increased by 45 % in HFU when compared to controls, whereas CB1 mRNA did not differ. The anandamide level in HFU exceeded that in controls by 90 %. Tobacco smoking could be excluded as a confounding factor. In conclusion, marijuana users that had smoked marijuana ≥20 times in their lives and stopped cannabis use at least 6 months before the study show an increase in CB2 receptor mRNA in the blood and in serum anandamide level. These alterations resemble those obtained for marijuana smokers that had stopped cannabis use only few days before testing and may be implicated in the pathogenesis of disorders associated with long-term cannabis use.

β-Adrenoceptor antagonists are important drugs for the treatment of cardiovascular diseases and some of those drugs also block the so-called low-affinity site of β1-adrenoceptors although at much higher concentrations. This low-affinity site, also identified in vivo and in human tissue, may come into play under certain pathophysiological situations including arrhythmias. The aim of our study was to determine the potency of 14 compounds chemically related to bupranolol or bevantolol and two xanthone derivatives at the low-affinity site of the β1-adrenoceptor. The potency of the compounds at the low- and high-affinity site of β1-adrenoceptors (β1L and β1H; both increasing heart rate) was compared in the pithed rat. One compound was also studied in the isolated rat heart and its α1-adrenolytic effect determined in the isolated rat mesenteric artery. In the pithed rat, four compounds blocked the β1L-adrenoceptor at a ≥10-fold lower potency than the β1H-adrenoceptor whereas the xanthone derivative (−)-MH-3 was equipotent. In the spontaneously beating right atrium (−)-MH-3 was a non-competitive antagonist of comparable potency at either receptor; its apparent pD′2 value for the β1L-adrenoceptor ranged from 5.6 to 6.4 under various conditions, including the Langendorff preparation. Its apparent pA2 at the α1-adrenoceptor in the mesenteric artery was 8.4. (−)-MH-3 is the first compound with virtually the same potency at the low- and high-affinity site of β1-adrenoceptors in vivo; it appears to be a non-competitive antagonist at either site in vitro.

We studied the effects of nociceptin, the endogenous ligand of the opioid OP4 receptor, and of two cannabinoid receptor agonists WIN 55,212-2 and CP-55,940 (0.001-1 micromol/kg each) on the neurogenic tachycardia and bradycardia in pithed rats. Electrical stimulation (1 Hz, 1 ms, 50 V for 10 s) of the preganglionic sympathetic nerve fibres and injection of nicotine 2 micromol/kg or isoprenaline 0.5 nmol/kg increased heart rate by about 70 beats/min (bpm) in pithed rats pretreated with atropine 1.5-2 micromol/kg. The electrically induced tachycardia was reduced dose dependently by nociceptin, WIN 55,212-2 and CP-55,940 (by 60, 30 and 20% at the highest dose, respectively). The OP4 and cannabinoid receptor agonists diminished the nicotine- but not the isoprenaline-stimulated increase in heart rate. In pithed rats pretreated with propranolol 3 micromol/kg, vagal stimulation (5 Hz, 1 ms, 15 V for 10 s) or injection of methacholine (5-10 nmol/kg) decreased heart rate by about 30 bpm. Nociceptin, but not WIN 55,212-2 or CP-55,940 decreased the vagal bradycardia dose dependently (the inhibitory effect of 1 micromol/kg was about 40%). Nociceptin failed to modify the methacholine-induced decrease in heart rate. The OP4 receptor antagonists naloxone benzoylhydrazone 5 micromol/kg and/or [Phe1Psi(CH2-NH)Gly2]-nociceptin(1-13)NH2 0.7 micromol/kg, but not the OP(1-3) receptor antagonist naloxone 10 micromol/kg, diminished the inhibitory action of nociceptin on the neurogenic tachycardia and bradycardia. The inhibitory effect of both cannabinoid receptor agonists on the neurogenic tachycardia was abolished by the CB1 receptor antagonist SR 141716 0.1 micromol/kg. The present data suggest that the postganglionic sympathetic nerve fibres innervating the rat heart are endowed with presynaptic opioid OP4 and cannabinoid CB1 receptors, activation of which inhibits the neurogenic tachycardia. The parasympathetic nerve fibres innervating the heart and causing bradycardia are endowed with presynaptic opioid OP4 but not cannabinoid receptors.

Clenbuterol, a lipophilic beta2-adrenoceptor agonist, was investigated in various seizure models of experimental epilepsy. In the maximal electroshock seizure threshold test, clenbuterol (> or =4 mg/kg i.p.) increased the electroconvulsive threshold for tonic seizures in mice. In the traditional maximal electroshock seizure (MES) test in mice, ED50 values of 11 mg/kg i.p. or s.c. were determined. In both models, the beta2-receptor antagonist ICI 118.551 did not antagonize the anticonvulsant activity of clenbuterol. Combinations of clenbuterol with standard antiepileptics revealed additive anticonvulsant effects. Repeated administration of clenbuterol (5 mg/kg s.c., twice daily for 14 days) to mice did not significantly influence its anticonvulsant potency or the effectiveness of phenobarbital in the MES test. In various chemically-induced seizure tests with tonic convulsions, clenbuterol inhibited or tended to suppress the tonic phase. However, this drug was not effective in preventing clonic seizures in the pentylenetetrazol (85 mg/kg s.c.) seizure threshold test. In the rotarod ataxia test (mice), a minimal "neurotoxic" dose (TD50) of 41 mg/kg i.p. was determined. In unrestrained rats with chronically implanted electrodes in the dorsal hippocampus, clenbuterol (2 mg/kg and 4 mg/kg i.p.) significantly reduced the duration of electrically evoked hippocampal afterdischarges. In amygdala-kindled rats, clenbuterol (5 mg/kg and 10 mg/kg i.p.) reduced the seizure severity to stage 3. Additional studies indicated that clenbuterol (6 mg/kg i.p.) increased the heart rate and decreased the blood pressure, but this drug did not alter the plasma level of the two tested antiepileptics phenobarbital and carbamazepine. Furthermore, in whole-cell voltage-clamp experiments on cultured neonatal rat cardiomyocytes, clenbuterol (1-100 microM) depressed the fast sodium current in a concentration- and frequency-dependent manner. In conclusion, the anticonvulsant effects of higher doses of clenbuterol against generalized tonic-clonic and complex partial seizures seem to be related to the inhibition of voltage-dependent sodium channels and not to the modulation of beta-adrenoceptors.

Cannabinoid CB1 receptors occur as presynaptic receptors producing inhibition of neurotransmitter release. To elucidate their physiological role, experiments on tissues from CB1 receptor knockout mice would be helpful. We studied whether CB1 receptor-mediated inhibition of acetylcholine release is detectable in the brain of NMRI mice and of CD-1 and C57BL/6J mice (the latter two strains representing the wild-type strains of the two CB1 receptor knockout mouse models). Brain slices preincubated with [3H]choline were superfused and tritium overflow was evoked electrically (3 Hz) or by introduction of Ca2+ into Ca2+-free K+-rich medium (35 mM) containing tetrodotoxin. The eletrically evoked tritium overflow from NMRI mouse hippocampal slices was inhibited (maximally by 60%) by the cannabinoid receptor agonists CP-55,940 and WIN 55,212-2 but not affected by WIN 55,212-3 (the inactive enantiomer of WIN 55,212-2; pEC50=7.9, 7.4 and5.5). The concentration-response curve of WIN 55,212-2 was shifted to the right by the CB1 receptor antagonist SR 141716 (apparent pA2=8.6). Compared to hippocampal slices from NMRI mice, WIN 55,212-2 1 microM inhibited the electrically evoked overflow (1) from cortical slices from NMRI mice to a lesser extent and from striatal slices not at all, (2) from hippocampal slices from CD-1 and C57BL/6J mice to an identical extent and (3) from hippocampal slices from Sprague-Dawley rats to at least the same extent. SR 141716 0.32 microM abolished the effect of WIN 55,212-2 1 microM in hippocampal slices from NMRI, CD-1 and C57BL/6J mice and in cortical slices from NMRI mice. The electrically evoked tritium overflow from NMRI mouse hippocampal slices was also inhibited by the muscarinic receptor agonist oxotremorine (maximum effect of 85%; pEC50=6.5) and this effect was antagonized by the muscarinic receptor antagonist AF-DX 384 (apparent pA2=8.3). The Ca2+-evoked tritium overflow from NMRI mouse hippocampal slices was inhibited by WIN 55,212-2 in a manner sensitive to SR 141716. In conclusion, the cholinergic axon terminals of the NMRI mouse hippocampus are endowed with presynaptic CB1 receptors. Such receptors are also detectable in the hippocampus of CD-1 and C57BL/6J mice. The maximum extent of the CB1 receptor-mediated inhibition of acetylcholine release is lower than the maximum effect mediated via the autoreceptor.

Nociceptin, the endogenous ligand of the OP(4) or ORL(1) (opioid receptor-like(1)) receptor, decreases blood pressure and heart rate in anesthetized rats. Since the OP(4) receptor antagonist [Phe(1)Psi(CH(2)-NH)Gly(2)]-nociceptin(1-13)NH(2) possesses an agonistic effect in this model, we examined whether other purported OP(4) receptor antagonists, acetyl-RYYRIK-NH(2) and naloxone benzoylhydrazone, antagonize the depressant effects of nociceptin. Acetyl-RYYRIK-NH(2), like nociceptin and [Phe(1)Psi(CH(2)-NH)Gly(2)]-nociceptin(1-13)NH(2) and unlike naloxone benzoylhydrazone, decreased diastolic blood pressure and heart rate (rank order of potencies: nociceptin approximately equal to acetyl-RYYRIK-NH(2)[Phe(1)Psi(CH(2)-NH)Gly(2)]-nociceptin(1-13)NH(2)). The depressant effects were insensitive to the OP(1-3) receptor antagonist naloxone but diminished by naloxone benzoylhydrazone. In conclusion, the hypotensive and bradycardic effects of nociceptin in the anesthetized rat are mediated via OP(4) receptors, at which acetyl-RYYRIK-NH(2) is a highly potent and efficacious agonist.

We studied whether serotonin release in the CNS is inhibited via cannabinoid receptors. In mouse brain cortex slices preincubated with [3H]serotonin and superfused with medium containing indalpine and metitepine, tritium overflow was evoked either electrically (3 Hz) or by introduction of Ca2+ (1.3 mM) into Ca2+-free K+-rich (25 mM) medium containing tetrodotoxin. The effects of cannabinoid receptor ligands on the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]choline and on the binding of [3H]WIN 55,212-2 and [35S]GTPgammaS to mouse brain cortex membranes were examined as well. In superfused mouse cortex membranes preincubated with [3H]serotonin, the electrically evoked tritium overflow was inhibited by the cannabinoid receptor agonist WIN 55,212-2 (maximum effect of 20%, obtained at 1 microM; pEC50=7.11) and this effect was counteracted by the CB1 receptor antagonist SR 141716 (apparent pA2=8.02), which did not affect the evoked tritium overflow by itself. The effect of WIN 55,212-2 was not shared by its enantiomer WIN 55,212-3 but was mimicked by another cannabinoid receptor agonist, CP-55,940. WIN 55,212-2 also inhibited the Ca2+-evoked tritium overflow and this effect was antagonized by SR 141716. Concentrations of histamine, prostaglandin E2 and neuropeptide Y, causing the maximum effect at their respective receptors, inhibited the electrically evoked tritium overflow by 33, 69 and 73%, respectively. WIN 55,212-2 (1 microM) inhibited the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]choline by 49%. [3H]WIN 55,212-2 binding to mouse cortex membranes was inhibited by CP-55,940, SR 141716 and WIN 55,212-2 (pKi=9.30, 8.70 and 8.19, respectively) but not by the auxiliary drugs indalpine, metitepine and tetrodotoxin (pKi

Nociceptin (or orphanin FQ), the endogenous ligand for the opioid receptor-like 1 (ORL1) receptor, decreases blood pressure in the conscious and anesthetized rat. This study examined whether prejunctional inhibitory ORL1 receptors located on the postganglionic sympathetic neurons innervating the resistance vessels are detectable in pithed rats. In pithed and vagotomized rats electrical stimulation of the preganglionic sympathetic nerve fibers, injection of nicotine (2 micromol/kg) or noradrenaline (1 nmol/kg) increased blood pressure by about 30 mmHg. The electrically induced vasopressor response was decreased dose-dependently by nociceptin (0.001-1 micromol/kg; decrease by about 60% at 1 micromol/kg). Nociceptin 0.1 micromol/kg reduced the nicotine-induced vasopressor response by about 40% but at doses up to 1 micromol/kg failed to affect the increase in blood pressure evoked by noradrenaline. The inhibitory action of nociceptin on the electrically and nicotine-induced increase in blood pressure was attenuated by the ORL1 receptor antagonists naloxone benzoylhydrazone (5 micromol/kg) and/or [Phe1psi(CH2-NH)Gly2]-nociceptin(1-13)NH2 (1 micromol/kg) but was not affected by naloxone 10 micromol/kg. In conclusion, the present data suggest that the postganglionic sympathetic nerve fibers innervating the resistance vessels of the rat are endowed with prejunctional ORL1 receptors, activation of which causes inhibition of noradrenaline release.

We have studied (i) the effect of antisense oligodeoxynucleotides complementary to CB1 mRNA on the CB1 receptor binding in hippocampus, striatum and cerebral cortex of the rat; (ii) the possible mechanism of action of one of the antisense oligodeoxynucleotides; and (iii) its effect on two functional CB1 receptor-mediated effects. Synthetic oligodeoxynucleotides or saline were administered to male Wistar rats by the intracerebroventricular (i.c.v.) route twice daily for 3 days. Antisense oligodeoxynucleotides corresponding to the nucleotides 4 to 21 (AS1; GCCATCTAGGATCGACTT) and -8 to 12 (AS2; GATCGACTTCATAACCTCAG) and a mismatch oligodeoxynucleotide differing from AS1 in 6 positions (MM; TCCAGCTACTATGGACTG) were used. The dissociation constant (K(D)) of rat CB1 cannabinoid receptors, labelled by the radioligand [3H]-SR141716, did not differ in membranes from rats treated with saline, AS , AS2 or MM. The density of receptor binding (Bmax) was reduced by the antisense oligodeoxynucleotides, 10nmol, in the hippocampus (AS 1, -40%; AS2, -20%) and striatum (AS1, -29%; AS2 -6%), but not in the cerebral cortex. When the dose of AS1 was raised to 30 nmol, the reduction of Bmax in the hippocampus and striatum was only marginally increased; a dose of 3nmol of AS1 reduced Bmax in both brain regions by somewhat more than the half-maximum effect. The mismatch oligodeoxynucleotide MM (3-30nmol) did not affect Bmax. In the second part of the study, RNA obtained from the three brain regions of rats pretreated with AS1 10 nmol, MM 10 nmol or saline was analyzed using reverse transcription-polymerase chain reaction of CB1 receptor mRNA and of beta-actin mRNA levels (used as reference value). The ratio of CB1 receptor mRNA over beta-actin mRNA after treatment with AS1 did not differ from the ratios following treatment with saline or MM in the hippocampus, striatum and cerebral cortex. Finally, pretreatment with antisense oligodeoxynucleotide AS1 30nmol attenuated two functional effects via CB1 receptors, i.e., the facilitatory effect of WIN 55,212-2 on [35S]-GTPgammaS binding in rat hippocampus membranes and the inhibitory effect of WIN 55,212-2 on acetylcholine release in rat hippocampus slices. In conclusion, (i) two antisense oligodeoxynucleotides reduce the density of CB1 receptors in the rat hippocampus and striatum after i.c.v. administration. (ii) The effect of the antisense oligodeoxynucleotide AS1 does not appear to be related to breakdown of CB1 receptor mRNA. (iii) Pretreatment with AS1 attenuated the CB1 receptor-mediated effect in two functional models.

Selective H2- and H3-receptor agonists, exhibiting an at least tenfold higher potency than histamine itself at the respective receptors, have been known for several years. Selective H1-receptor agonists with a potency exceeding that of histamine have become available only recently; the most potent are methylhistaprodifen and dimethylhistaprodifen [Nalpha-methyl- and Nalpha,Nalpha-dimethyl-2(3,3-diphenylpropyl)histamine, respectively] with 3.4- and 2.4-fold higher potencies than histamine in vitro (in the guinea-pig ileum). The aim of the present study was to examine whether these compounds and the parent compound histaprodifen are potent H1-receptor agonists in the pithed and in the anaesthetized rat. In pithed, vagotomized rats diastolic blood pressure was decreased by 2-(2-thiazolyl)ethanamine i.v. (which was used as a reference H1-receptor agonist) and by histaprodifen, methylhistaprodifen, and dimethylhistaprodifen; the maximum decrease was about 45 mmHg for each compound, and the potencies, expressed as pED50, the negative logarithm of the dose (in mole per kilogram body weight) eliciting a half-maximal response, were 7.23, 7.55, 8.43 and 8.12, respectively. The dose/response curves of the four compounds were shifted to the right to about the same extent by the H1-receptor antagonist dimetindene (1 micromol/kg i.v.). The vasodepressor response was not affected by combined i.v. administration of the H2- and H3-receptor antagonists ranitidine and thioperamide, by combined i.v. administration of the alpha1- and alpha2-adrenoceptor antagonists prazosin and rauwolscine, and by the beta-adrenoceptor antagonist propranolol i.v. but was attenuated by the inhibitor of NO synthase, N(omega)-nitro-L-arginine methyl ester i.v. In anaesthetized rats 2-(2-thiazolyl)ethanamine, histaprodifen, methylhistaprodifen and dimethylhistaprodifen i.v. also decreased diastolic blood pressure in a manner sensitive to dimetindene i.v. Our data show that histaprodifen and, in particular, methyl and dimethylhistaprodifen are highly potent H1-receptor agonists in vivo.

The effect of histamine and related drugs on the tritium overflow evoked electrically (0.3 Hz) or by introduction of Ca2+ ions into Ca2+-free K+-rich (25 mmol/l) medium containing tetrodotoxin was studied in superfused guinea-pig brain cortex, cerebellum, hippocampus or hypothalamus slices and in mouse brain cortex slices preincubated with 3H-noradrenaline. The electrically evoked tritium overflow in guinea-pig cortex slices was inhibited by histamine; the H3 receptor antagonist clobenpropit reversed the effect of histamine to a slight facilitation. The facilitatory effect of histamine (obtained in the presence of clobenpropit) was not affected by the H1 receptor antagonist mepyramine but abolished by the H2 receptor antagonist ranitidine. In the absence of clobenpropit, ranitidine augmented the inhibitory effect of histamine. In slices superfused in the presence of ranitidine, the evoked overflow was inhibited by histamine and, more potently, by the H3 receptor agonist R-alpha-methylhistamine in a concentration-dependent manner (maximum inhibitory effect obtained for both agonists 30-35%). The concentration-response curve of histamine was shifted to the right by the H3 receptor antagonist thioperamide. R-alpha-methylhistamine inhibited the electrically evoked tritium overflow also in guinea-pig cerebellar, hippocampal and hypothalamic slices. In cortex slices superfused in the presence of clobenpropit, the H2 receptor agonists impromidine and, less potently, R-sopromidine facilitated the evoked overflow in a concentration-dependent manner. S-Sopromidine only tended to increase the evoked overflow. The effect of impromidine was counteracted by the H2 receptor antagonists ranitidine and cimetidine. The extent of the maximum facilitatory effect of impromidine (by 15-20%) was about the same when (i) the Ca2+ concentration in the medium was reduced from 1.3 to 0.98 mmol/l, (ii) the time of exposure to impromidine was reduced from 28 to 8 min or (iii) cerebellar, hippocampal or hypothalamic slices were used instead of cortical slices. The Ca2+-induced tritium overflow in guinea-pig cortex slices was inhibited by histamine (in the presence of ranitidine); this effect was abolished by clobenpropit. In slices superfused in the presence of clobenpropit, impromidine failed to facilitate the Ca2+-evoked tritium overflow. The electrically evoked tritium overflow in mouse brain cortex slices was inhibited by histamine by about 60% (both in the absence or presence of ranitidine). The inhibitory effect of histamine was abolished (but not reversed) by clobenpropit. In conclusion, noradrenaline release in the guinea-pig brain cortex is inhibited via presynaptic H3 receptors and facilitated via H2 receptors not located presynaptically. In the mouse brain cortex, only inhibitory H3 receptors occur. The extent of the H3 receptor-mediated effect is more marked in the mouse than in the guinea-pig brain cortex.

The effects of two cannabinoid receptor agonists, R(+)-[2,3-dihydro-5-methyl-3-[(morpholinyl)methyl]pyrrolo[1,2,3-de]-1,4- benzoxazin-yl]-(1-naphthalenyl)-methanone (WIN 55,212-2) and (-)-cis-3-[2-hydroxy-4-(1,1-dimethylheptyl)phenyl]-trans-4-(3-hydr oxypropyl)-cyclohexanol (CP-55,940), were studied on (i) the vasopressor response elicited in pithed rats by electrical stimulation of the sympathetic outflow and (ii) the release of 3H-noradrenaline and the vasoconstriction elicited in isolated rat tail arteries by transmural electrical stimulation. In pithed rats, the electrical (1 Hz for 10 s) stimulation of the preganglionic sympathetic nerve fibres increased diastolic blood pressure by about 30 mmHg. This neurogenic vasopressor response (which under the conditions of our study was almost exclusively due to the release of catecholamines) was decreased by WIN 55-212,2 and CP-55,940 in a dose-dependent manner (inhibition by WIN 55,212-2 and CP-55,940, 0.1 micromol/kg each, about 25-30%). The inhibition was identical in adrenalectomized rats and in animals with intact adrenals. The inhibitory action of WIN 55,212-2 and CP-55,940 was abolished by a dose of 0.03 micromol/kg of the CB1 receptor antagonist N-piperidino-5-(4-chlorophenyl)-1-(2,4-dichlorophenyl)-4-methyl-3-pyrazo le-carboxamide (SR 141716), which, by itself, had no effect. WIN 55,212-2, CP-55,940 and SR 141716 failed to affect the vasopressor response to exogenous noradrenaline (1 nmol/kg), which also increased diastolic blood pressure by about 30 mmHg. In isolated rat tail arteries, the electrically (0.4 Hz) evoked tritium overflow and vasoconstriction were not modified by WIN 55,212-2 and CP-55,940 (1 micromol/l each). In conclusion, the neurogenic vasopressor response in the pithed rat can be modulated via cannabinoid CB1 receptors probably located presynaptically on the postganglionic sympathetic nerve fibres innervating resistance vessels.

Our previous results demonstrate the occurrence of presynaptic inhibitory histamine H3 receptors on sympathetic neurons innervating resistance vessels of the pithed rat. The present study, in which new H3 receptor ligands with increased potency and selectivity (imetit, clobenpropit) were used, was designed to further explore the role of H3 receptors in the regulation of the rat cardiovascular system. In particular we were interested whether these receptors may be activated by endogenous histamine and whether they are detectable in an experimental model of hypertension. All experiments were performed on pithed and vagotomized rats treated with rauwolscine 1 mumol/kg. In normotensive Wistar rats the electrical (1 Hz, 1 ms, 50 V for 20 s) stimulation of the preganglionic sympathetic nerve fibres increased diastolic blood pressure by about 35 mmHg. Two H3 receptor agonists, R-(-)-alpha-methylhistamine and imetit, inhibited the electrically induced increase in diastolic blood pressure in a dose-dependent manner. The maximal effect (about 25%) was obtained for R-(-)-alpha-methylhistamine at about 10 mumol/kg and for imetit at about 1 mumol/kg. Two H3 receptor antagonists, thioperamide 1 mumol/kg and clobenpropit 0.1 mumol/kg, attenuated the inhibitory effect of imetit. The neurogenic vasopressor response was increased by about 15% by thioperamide 1 mumol/kg and clobenpropit 0.1 mumol/kg and decreased by 25% by the histamine methyltransferase inhibitor metoprine 37 mumol/kg. R-(-)-alpha-Methylhistamine, imetit, thioperamide, clobenpropit and metoprine did not affect the vasopressor response to exogenously added noradrenaline 0.01 mumol/kg (which increased diastolic blood pressure by about 40 mmHg). Metoprine had only a very low affinity for H3 binding sites (labelled by 3H-N alpha-methylhistamine; pKi 4.46). In pithed Wistar Kyoto (WKY) and spontaneously hypertensive (SHR) rats, electrical (1 Hz, 1 ms, 50 V for 10 s) stimulation increased diastolic blood pressure by 28 and 37 mmHg, respectively. Imetit inhibited the neurogenic vasopressor response to about the same extent in WKY and SHR rats (maximal effect of about 30%). The inhibitory influence of imetit was diminished by thioperamide 1 mumol/kg to about the same degree in rats of either strain. The present study confirms the occurrence of presynaptic H3 receptors on sympathetic nerve fibres involved in the inhibition of the neurogenic vasopressor response. Moreover, it demonstrates that these H3 receptors are probably activated by endogenous histamine and appear to be operative in hypertension.

The possible occurrence of cannabinoid (CB) receptors was studied on superfused guinea-pig retinal discs preincubated with [3H]dopamine or [3H]noradrenaline. Tritium overflow was evoked either electrically (3 Hz) or by re-introduction of Ca2+ 1.3 mM after superfusion with Ca(2+)-free medium containing K+ 30 mM. The accumulation of [3H]dopamine ([3H]DA) and [3H]noradrenaline ([3H]NA) was inhibited by the selective inhibitor of the neuronal dopamine transporter GBR-12909 (pIC50% 7.29 and 7.41, respectively) but not by the selective inhibitor of the neuronal noradrenaline transporter desipramine (1 microM). The electrically or Ca(2+)-evoked tritium overflow in retinal discs preincubated with [3H]DA or [3H]NA was reduced by the CB receptor agonists CP-55,940 and WIN 55,212-2 (pIC50% in discs preincubated with [3H]NA, electrical stimulation: 7.03 and 6.70, respectively) but not affected by the inactive S(-)enantiomer of the latter, WIN 55,212-3 (up to 10 microM). The concentration-response curve of WIN 55,212-2 was shifted to the right by the CB1 receptor antagonist SR 141716 (apparent pA2: 8.29) which, by itself, increased the evoked overflow. The facilitatory effect of SR 141716 was not affected by GBR-12909 and the dopamine receptor antagonist haloperidol. In conclusion, the dopaminergic neurones of the guinea-pig retina can be labelled by both [3H]DA and [3H]NA. Transmitter release from the dopaminergic neurones is inhibited by activation of cannabinoid receptors of the CB1 type, which appear to be tonically activated by an endogenous CB receptor ligand.

The present study was carried out to examine whether acute experimental myocardial infarction affects the sympathetic transmission to vessels and the heart of pithed rats via a presynaptic mechanism and, if so, to check whether inhibitory presynaptic cannabinoid (CB) receptors and endocannabinoids are involved in this response. In pithed and vagotomized rats, electrical stimulation (0.75 Hz; 1 ms; 50 V; 5 or 15 pulses for increases in heart rate or blood pressure, respectively) of the preganglionic sympathetic nerve fibers or intravenous injection of isoprenaline (0.1 nmol/kg) or noradrenaline (1 nmol/kg) increased heart rate and blood pressure by approximately 50 beats/min and 40 mm Hg, respectively. Ligation of the left coronary artery reduced the electrically (as opposed to the chemically) induced tachycardic and pressor responses by approximately 30 to 40%. The inhibitory effect of myocardial infarction was prevented by the CB(1) receptor antagonist rimonabant but not by the CB(2) receptor antagonist N-[(1S)-endo-1,3,3-trimethyl-bicyclo[2.2.1]heptan-2-yl]-5-(4-chloro-3-methylphenyl)-1-(4-methylbenzyl)-pyra-zole-3-carboxamide (SR144528) and the transient receptor potential vanilloid 1 receptor antagonist capsazepine. The inhibitory effect of myocardial infarction was slightly enhanced by the inhibitors of anandamide and 2-arachidonyl glycerol degradation, 3'-(aminocarbonyl)[1,1'-biphenyl]-3-yl)-cyclohexylcarbamate (URB597) and 4-nitrophenyl-4-(dibenzo[d][1,3]dioxol-5-yl(hydroxy)methyl)piperidine-1-carboxylate (JZL184), respectively. Rimonabant increased myocardial infarction-induced mortality. Our results demonstrate that during the early phase of myocardial infarction the activation of presynaptic CB(1) receptors by endogenously formed cannabinoids contributes to the inhibition of the neurogenic tachycardic and vasopressor responses. Thus, the CB(1) receptor-mediated inhibition of excessive noradrenaline release from the sympathetic nerve fibers innervating the heart and vessels might play a protective role in myocardial ischemia.

It was the aim of the present study to determine the affinities of four neuroleptics and five antidepressants for histamine H3 receptors. In rat brain cortex membranes, the specifically bound [3H]-N alpha-methylhistamine was monophasically displaced by clozapine (pKi 6.15). The other drugs did not completely displace the radioligand even at 100 microM; the pKi values were: haloperidol (4.91); sulpiride (4.73); amitriptyline (4.56); desipramine (4.15); levomepromazine (4.14); fluovoxamine (4.13); maprotiline (4.09); moclobemide (< 4.0). The effect of clozapine was further examined in a functional H3 receptor model, i.e., in superfused mouse brain cortex slices preincubated with [3H]-noradrenaline. The electrically evoked tritium overflow was not affected by clozapine 0.5-32 microM. However, clozapine shifted the concentration-response curve of histamine for its inhibitory effect on the evoked overflow to the right, but did not affect the maximum effect of histamine. The Schild plot yielded a pA2 value of 6.33. In conclusion, clozapine shows an intermediate affinity and potency (as a competitive antagonist) at H3 receptors. The Ki value of clozapine at H3 receptors resembles its Ki value at D2 receptors (the target of the classical neuroleptics), but is higher than its Ki values at D4, 5-HT2 or muscarinic acetylcholine receptors, which according to current hypotheses, might be involved in the atypical profile of clozapine.

1. We determined the affinities of ten novel H3 receptor antagonists in an H3 receptor binding assay and their potencies in two functional H3 receptor models. The novel compounds differ from histamine in that the aminoethyl side chain is replaced by a propyl or butyl chain linked to a polar group (amide, thioamide, ester, guanidine, guanidine ester or urea) which, in turn, is connected to a hexocyclic ring or to an alicyclic ring-containing alkyl residue [corrected]. 2. The specific binding of [3H]-N alpha-methylhistamine to rat brain cortex membranes was monophasically displaced by each of the ten compounds at pKi values ranging from 7.56 to 8.68. 3. Inhibition by histamine of the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]-noradrenaline was antagonized by the ten compounds and the concentration-response curve was shifted to the right with apparent pA2 values ranging from 7.07 to 9.20. 4. The electrically induced contraction in guinea-pig ileum strips (which was abolished by atropine) was inhibited by the H3 receptor agonists R-(-)-alpha-methylhistamine (pEC50 7.76), N alpha-methylhistamine (7.90) and imetit (8.18). The concentration-response curve of R-(-)-alpha-methylhistamine was shifted to the right by thioperamide (apparent pA2 8.79) and by the ten novel compounds (range of pA2 values 6.64-8.81). 5. The affinities and potencies were compared by linear regression analysis. This analysis was extended to thioperamide, the standard H3 receptor antagonist, which is also capable of differentiating between H3A and H3B sites. Comparison of the apparent pA2 values in the two functional H3 receptor models yielded a regression coefficient of 0.77 (P0.02). When the pA2 of the drugs in the mouse brain cortex were compared to the pXj for H3 sites (ten novel compounds) and for H3A sites (thioperamide), a significant correlation (r = 0.87; P0.001) was obtained. There was, however, no significant correlation when the pKi of thioperamide for H3B sites was used instead (r = 0.52). In a similar manner, comparison of the pA2 in the guinea-pig ileum with the pKi in the binding assay yielded a significant correlation(r = 0.70, P0.05) only when the pKi of thioperamide for H3A sites was used but not when its pKi forH3B sites was considered (r = 0.17, NS).6 On the basis of these results, structure-activity relationships for the novel H3 receptor antagonists,and the nature of the H3 receptors in the guinea-pig ileum and mouse brain, are considered.

In pithed rats, we studied the effects of prostaglandin E2 and of subtype-selective prostaglandin E receptor (EP receptor) ligands on the rise in blood pressure induced by electrical stimulation of the preganglionic sympathetic nerves. Prostaglandin E2, the EP1/EP3 receptor agonist sulprostone and the EP2/EP3 receptor agonist misoprostol inhibited the electrically induced increase in diastolic blood pressure (rank order of potencies sulprostoneor = misoprostolor = prostaglandin E2); the rise in blood pressure induced by exogenously added noradrenaline was not affected by these compounds. The inhibitory effect of sulprostone on the electrically induced vasopressor response was not significantly changed by indomethacin. Iloprost (an agonist at EP1 and prostacyclin receptors (IP receptors)) failed to affect the electrically evoked increase in blood pressure. The present study suggests that prostaglandin E2 inhibits the release of catecholamines in pithed rats via prostanoid receptors of the EP3 subtype, probably located presynaptically on the postganglionic sympathetic nerve fibres.

Different types of presynaptic inhibitory Gα(i/o) protein-coupled receptors usually do not act independently of each other but rather pre-activation of receptor X impairs the effect mediated via receptor Y. It is, however, unknown whether this interaction extends to the cannabinoid CB(1) receptor on cholinergic neurones and hence we studied whether its activation, pharmacological blockade, or genetic inactivation affects the function of other presynaptic inhibitory receptors. The electrically evoked acetylcholine or noradrenaline release was determined in superfused rodent tissues preincubated with (3)H-choline or (3)H-noradrenaline. The muscarinic M(2) receptor, Gα(i), and Gα(o) proteins were determined in hippocampal synaptosomes by Western blotting. Hippocampal anandamide and 2-arachidonoyl glycerol levels were determined by LC-MS/MS. The inhibitory effect of the muscarinic receptor agonist oxotremorine on acetylcholine release in hippocampal slices was increased by genetic CB(1) receptor ablation (mouse) and the CB(1) antagonist rimonabant (rat but not mouse) and decreased by a cannabinoid receptor agonist (mouse). In mouse tissues, CB(1) receptor ablation also increased the effect of a δ opioid receptor agonist on acetylcholine release in the hippocampus and the effect of oxotremorine on noradrenaline release in the vas deferens. CB(1) receptor ablation, to a very slight extent, increased Gα(o) protein levels without affecting either Gα(i) and M(2) receptor protein or the levels of anandamide and 2-arachidonoyl glycerol in the hippocampus. In conclusion, the CB(1) receptor shows an inhibitory interaction with the muscarinic and δ opioid receptor on cholinergic neurones in the rodent hippocampus and with the muscarinic receptor on noradrenergic neurones in the mouse vas deferens.

The aim of our study was (1) the pharmacological characterization of EP(3) receptors in human pulmonary arteries and (2) the examination of the potential involvement of these receptors in the regulation of neurogenic tachycardia in pithed rats. L-826266 served as the EP(3) receptor antagonist.Experiments were performed on isolated human pulmonary arteries and pithed rats.The prostanoid EP(1)/EP(3) receptor agonist sulprostone (1 nM - 100 μM) concentration-dependently contracted isolated human pulmonary arteries (pEC50, 6.88 ± 0.10). The EP(1) receptor antagonist SC 19920 (100 μM) did not affect the vasoconstriction induced by sulprostone, the TP receptor antagonist sulotroban (10 μM) only slightly attenuated the effects elicited by sulprostone3 μM, whereas L-826266 (10 μM) shifted its concentration-response curve to the right (apparent pA(2) value 6.18; incubation time 0.5 h). In rings exposed to L-826266 (0.1, 1 or 10 μM) for 3 h, a concentration-dependent inhibitory effect against the sulprostone-induced vasoconstriction was obtained, yielding a Schild plot-based pA(2) value of 7.39. In pithed rats, sulprostone (10 - 1,000 nmol/kg), but not the IP/EP(1) receptor agonist iloprost (1-100 nmol/kg), inhibited the electrically evoked increase in heart rate (HR) dose-dependently, maximally by at least 80%. L-826266 (3 μmol/kg) did not affect basal HR and diastolic blood pressure, but reduced the inhibitory effect of sulprostone 1,000 nmol/kg by about 20%.EP(3) receptors (1) located postsynaptically strongly contract human pulmonary arteries and (2) located presynaptically on sympathetic nerve fibers supplying the heart of pithed rats strongly inhibit the neurogenic tachycardia.

We studied whether noradrenaline release is affected by interleukin-1β and the neuropeptides urotensin II, melanin-concentrating hormone (MCH), neuropeptide W (NPW) and neuropeptide FF (NPFF). Rodent tissues preincubated with [3H]noradrenaline were superfused, and the effect of peptides on the electrically-evoked tritium overflow ("noradrenaline release") was studied. In mouse brain cortex, interleukin-1β at 0.3 nM and the prostaglandin E2 analogue sulprostone at 3 nM inhibited noradrenaline release by about 40% the effect of interleukin-1β developed gradually, whereas the effect of sulprostone occurred promptly. Urotensin II at 0.001-1 μM did not affect noradrenaline release in rat kidney cortex, whereas 0.01 μM angiotensin II increased it (positive control). MCH at 0.01-1 μM did not alter noradrenaline release in the rat brain cortex, and NPW 1 μM did not affect noradrenaline release in the mouse hypothalamus or hippocampus. In each model, 0.1 μM sulprostone inhibited noradrenaline release (positive control). NPFF and the NPFF2 receptor agonist dNPA (1 μM) did not affect noradrenaline release in the mouse atria; the inhibitory effect of the δ opioid receptor agonist 1 μM DPDPE on noradrenaline release in this tissue was not altered by NPFF or dNPA at 0.32 μM but was counteracted by the δ opioid antagonist naltrindole at 0.001 μM. In conclusion, interleukin-1β inhibits noradrenaline release in the mouse cortex; the effect develops gradually, suggesting that it affects protein biosynthesis. Noradrenergic neurons in various tissues from rodents are devoid of presynaptic receptors for urotensin II, MCH, NPW and NPFF. Finally, an interaction between a δ opioid agonist and NPFF could not be detected.

Intravenous injection of the endocannabinoid anandamide induces complex cardiovascular changes via cannabinoid CB(1), CB(2) and vanilloid TRPV1 receptors. Recently, evidence has been accumulating that in vitro, but not in vivo, anandamide relaxes blood vessels, via an as yet unidentified, non-CB(1) vascular cannabinoid receptor, sensitive to O-1918 (1,3-dimethoxy-5-2-[(1R,6R)-3-methyl-6-(1-methylethenyl)-2-cyclohexen-1-yl]-benzene). We here examined whether the anandamide-induced hypotension in urethane-anaesthetized rats was also mediated via a non-CB(1) vascular cannabinoid receptor.Effects of two antagonists (O-1918 and cannabidiol) of the non-CB(1) vascular cannabinoid receptor on anandamide-induced changes in mean, systolic and diastolic blood pressure (MBP, SBP, DBP), mesenteric (MBF) and renal (RBF) blood flow and heart rate (HR) in urethane-anaesthetized rats was examined.In anaesthetized rats, anandamide (1.5-3 micromol.kg(-1)) and its stable analogue methanandamide (0.5 micromol.kg(-1)) caused a delayed and prolonged decrease in MBP, SBP, DBP, MBF and RBF by about 10-30% of the respective basal values without changing HR. In pithed rats, anandamide (3 micromol.kg(-1)) decreased blood pressure by about 15-20% of the basal value without affecting HR, MBF and RBF. All vascular changes were reduced by about 30-70% by cannabidiol and O-1918 (3 micromol.kg(-1), each).Non-CB(1) cannabinoid vascular receptors, sensitive to O-1918, contribute to the hypotensive effect of anandamide in anaesthetized rats. Activation of these receptors may be therapeutically important as the endocannabinoid system could be activated as a compensatory mechanism in various forms of hypertension.

The human saphenous vein was used to examine whether presynaptic histamine receptors can modulate noradrenaline release and, if so, to determine their pharmacological characteristics. Strips of this blood vessel were incubated with [3H]noradrenaline and subsequently superfused with physiological salt solution containing desipramine and corticosterone. Electrically (2 Hz) evoked 3H overflow was inhibited by histamine and the H3 receptor agonist R-(-)-alpha-methylhistamine. Histamine-induced inhibition of electrically evoked tritium overflow was not affected by alpha 2-adrenoceptor blockade by rauwolscine. S-(+)-alpha-methylhistamine (up to 10 mumol/l) as well as the histamine H1 and H2 receptor agonists 2-(2-thiazolyl)ethylamine (up to 3 mumol/l) and dimaprit (up to 30 mumol/l), respectively, were ineffective. The selective histamine H3 receptor antagonist thioperamide abolished the inhibitory effect of histamine. The histamine H2 and H1 receptor antagonists ranitidine and pheniramine, respectively, did not affect the histamine-induced inhibition of evoked tritium overflow. The present results are compatible with the suggestion that the sympathetic nerves of the human saphenous vein are endowed with inhibitory presynaptic histamine receptors of the H3 class.

Brain cortex slices were preincubated with 3H-noradrenaline and superfused with physiological salt solution containing desipramine. We studied the inhibition of the electrically evoked tritium overflow caused by histamine in the presence of α-adrenoceptor ligands (mouse and rat brain cortex), and the inhibition caused by talipexole (the former B-HT 920) in the presence of H3-receptor ligands (mouse brain cortex). In mouse brain cortex slices, the inhibitory effect of histamine on the tritium overflow evoked by 36 pulses, 0.3 Hz was not changed by the α1-adrenoceptor antagonist prazosin, but increased by the α2-adrenoceptor antagonist rauwolscine. When the current strength or the duration of electrical pulses was reduced to compensate for the increase in evoked tritium overflow produced by rauwolscine, the latter still. enhanced the effect of histamine. The histamine-induced inhibition of tritium overflow evoked by 360 pulses, 3 Hz was not affected by the α1-adrenoceptor agonist phenylephrine but attenuated by the α2-adrenoceptor- agonist talipexole. Finally, the inhibition by histamine of the tritium overflow evoked by 3 pulses, 100 Hz was attenuated by talipexole but not affected by rauwolscine. Conversely,. the inhibitory effect of talipexole on tritium overflow elicited by 360 pulses, 3 Hz was slightly attenuated by the H3-receptor agonist R-(−)-α-methylhistamine but not, affected by the H3- receptor antagonist thioperamide. In rat brain cortex slices, histamine only tended to inhibit tritium overflow evoked by 360 pulses, 3 Hz, both in the absence of α-adrenoceptor antagonists and in the presence of prazosin. However, histamine markedly inhibited the evoked overflow in the presence of rauwolscine. Again, enhancement of the histamine-induced inhibition also occurred when the current strength or the duration of pulses was reduced in order to compensate for the increase in evoked tritium overflow produced by rauwolscine. The results suggest that the α2-autoreceptors and the H3-heteroreceptors at the noradrenergic nerve endings in the brain of mouse and rat interact with each other. Activation of the α2-autoreceptors decreases, whereas blockade of the activated (but not of the non-activated) α2-autoreceptors increases, the inhibitory effect of histamine. Activation of the H3-heteroreceptors slightly decreases, whereas blockade of the H3-receptors fails to affect, the inhibitory effect of talipexole.

1. The purpose of the present study was to relate the effects of the novel drug, anpirtoline, on 5-hydroxytryptamine (5-HT) receptor subtypes to its antinociceptive and antidepressant-like actions in rodents. 2. Binding assays with rat brain membranes have shown that anpirtoline bound with a much higher affinity to 5-HT1B receptor (Ki = 28 nM) than to 5-HT1A (Ki = 150 nM) and 5-HT2 (Ki = 1.49 microM) receptors. 3. Like 5-HT, anpirtoline concentration-dependently inhibited forskolin-stimulated adenylate cyclase activity in homogenates from the rat substantia nigra. Both effects were not additive, and could be prevented by 5-HT1B receptor antagonists such as propranolol and penbutolol. 4. In superfused rat and pig brain cortex slices preincubated with [3H]-5-HT, the electrically evoked tritium overflow was inhibited by anpirtoline and 5-HT. Whereas 5-HT was equipotent in both tissues (EC50 = 69 nM), anpirtoline was markedly less potent in pig brain cortex slices (EC50 = 1190 nM) than in rat brain cortex slices (EC50 = 55 nM). The concentration-response curve for anpirtoline was shifted to the right by metitepine in both preparations. 5. In the social behaviour deficit test, anpirtoline and trifluoromethylphenyl-piperazine were effective in reversing the isolation-induced impairments in mice, an effect shown only by compounds with agonist properties at the 5-HT1B receptor. 6. In the electrostimulated pain test using mice, anpirtoline dose-dependently increased the pain threshold with an ED50 of 0.52 mg kg-1, i.p. The antinociceptive activity of anpirtoline was abolished by pretreatment with cyproheptadine or propranolol.7. In the forced swimming test in rats, anpirtoline induced a dose-related increase in swimming activity. With an ED50 value of 4.6mgkg-1, i.p., anpirtoline was 4 times more potent than the two standard compounds imipramine and desipramine. The decrease of immobility time or the increase of active periods in this model of behavioural despair is suggested to be characteristic of antidepressant drugs.8. Anpirtoline exhibits both antinociceptive and antidepressant-like activities in animals. It is probable that anpirtoline elicits these pharmacological effects via its agonist effect on 5-HT1B and 5-HT1A receptors.

1 Segments of the rat vena cava preincubated with [3H]-noradrenaline were superfused with [3H]-noradrenaline-free solution containing desipramine and corticosterone and the effects of γ-aminobutyric acid (GABA) receptor ligands and of histamine on tritium overflow evoked by transmural electrical stimulation were studied. 2 GABA inhibited, and histamine failed to affect, the electrically (0.66 Hz) evoked tritium overflow both in the absence and presence of rauwolscine (which was present in the superfusion medium in the subsequent experiments). The effect of GABA was less pronounced at a stimulation frequency of 2 Hz. 3 The inhibitory effect of GABA (pIC35 5.83) on the electrically (0.66 Hz) evoked overflow was mimicked by the GABAB receptor agonist, R-(−)-baclofen (6.07) and less potently by S-(+)-baclofen (3.30) and the GABAA receptor agonist, muscimol (3.70). The concentration-response curve of GABA was shifted to the right by the GABAB receptor antagonist, CGP 35348 (P-(3-aminopropyl)-P-diethoxymethyl-phosphinic acid; apparent pA2 4.76), but not affected by the GABAA receptor antagonist, (−)-bicuculline methiodide 100 μmol1−1. Given alone, (−)-bicuculline methiodide slightly increased, and CGP 35348 did not affect, the evoked overflow. 4 The effect of GABA in veins from rats treated for 14 days with RS-baclofen (10 mg kg−1, i.p. once daily) did not differ from that in veins from rats which received the vehicle instead. The effect of GABA also did not differ in veins from rats treated once either with RS-baclofen or with its vehicle. 5 The results suggest that the postganglionic sympathetic nerve fibres in the rat vena cava are endowed with presynaptic GABAB receptors, but not with receptors for histamine. (−)-Bicuculline methiodide increases noradrenaline release by a mechanism not related to GABAA, GABAB, α2-receptors or noradrenaline uptake.

The effects of neuropeptide Y (NPY), peptide YY (PYY), pancreatic polypeptide and of another four peptides on the electrically evoked 3H overflow were studied in superfused rat brain cortex slices preincubated with 3H-serotonin. In addition, we determined the effect of NPY on the Ca2(+)-induced 3H overflow from rat brain cortex slices and synaptosomes (preincubated with 3H-serotonin) and on the forskolin-stimulated accumulation of cAMP in a membrane fraction from rat brain cortex. The electrically (3 Hz) evoked 3H overflow was inhibited by PYY, NPY and pancreatic polypeptide (decreasing order of potency), but not affected by ACTH1-24, angiotensin II, bradykinin and delta-sleep-inducing peptide. The inhibitory effect of NPY did not change when the stimulation frequency was lowered to 1 Hz, but was markedly reduced at 10 Hz. The inhibitory effect of a presumably maximally active concentration of PYY was not altered in the presence of NPY or pancreatic polypeptide (effects not additive), whereas the inhibition produced by a maximally active concentration of the alpha 2-adrenoceptor agonist clonidine was further increased by NPY. NPY also inhibited (1) the tritium overflow, evoked by introduction of Ca2+, in slices superfused with Ca2(+)-free and K(+)-rich medium containing tetrodotoxin, (2) the tritium overflow, evoked by simultaneously increasing Ca2+ and K+ in the superfusion fluid of synaptosomes previously superfused with Ca2(+)-free medium and (3) the forskolin-stimulated accumulation of cAMP in rat brain cortex membranes. The present results suggest that NPY inhibits serotonin release in the rat brain via presynaptic NPY receptors, which are also activated by PYY and pancreatic polypeptide and may be negatively coupled to an adenylate cyclase.

Stimulation-evoked 3 H-noradrenaline release in human cerebrocortical slices was inhibited by histamine (in a manner sensitive to clobenpropit) and by imetit, suggesting H 3 receptor-mediated inhibition of noradrenaline release in human brain.

The dose-response curve for the vasopressor effect of alpha, beta-methylene ATP in pithed rats was influenced by four suramin-related drugs (each at 100 mumol/kg). The curve was shifted to the right by a factor of 8 by 'compound 3' and by a factor of 2 by two other derivatives, but was not affected by the fourth analogue. Compound 3 had no effect on the vasopressor response to noradrenaline or neuropeptide Y. In conclusion, compound 3 is a purine P2X receptor antagonist which is approximately as potent as suramin, and which, like suramin, does not exhibit antagonistic properties at alpha-adrenoceptors and neuropeptide y receptors.

The mechanism of action of cannabidiol, one of the major constituents of cannabis, is not well understood but a noncompetitive interaction with mu opioid receptors has been suggested on the basis of saturation binding experiments. The aim of the present study was to examine whether cannabidiol is an allosteric modulator at this receptor, using kinetic binding studies, which are particularly sensitive for the measurement of allosteric interactions at G protein-coupled receptors. In addition, we studied whether such a mechanism also extends to the delta opioid receptor. For comparison, (-)-Delta9-tetrahydrocannabinol (THC; another major constituent of cannabis) and rimonabant (a cannabinoid CB1 receptor antagonist) were studied. In mu opioid receptor binding studies on rat cerebral cortex membrane homogenates, the agonist 3H-DAMGO bound to a homogeneous class of binding sites with a KD of 0.68+/-0.02 nM and a Bmax of 203+/-7 fmol/mg protein. The dissociation of 3H-DAMGO induced by naloxone 10 microM (half life time of 7+/-1 min) was accelerated by cannabidiol and THC (at 100 microM, each) by a factor of 12 and 2, respectively. The respective pEC50 values for a half-maximum elevation of the dissociation rate constant k(off) were 4.38 and 4.67; 3H-DAMGO dissociation was not affected by rimonabant 10 microM. In delta opioid receptor binding studies on rat cerebral cortex membrane homogenates, the antagonist 3H-naltrindole bound to a homogeneous class of binding sites with a KD of 0.24+/-0.02 nM and a Bmax of 352+/-22 fmol/mg protein. The dissociation of 3H-naltrindole induced by naltrindole 10 microM (half life time of 119+/-3 min) was accelerated by cannabidiol and THC (at 100 microM, each) by a factor of 2, each. The respective pEC50 values were 4.10 and 5.00; 3H-naltrindole dissociation was not affected by rimonabant 10 microM. The present study shows that cannabidiol is an allosteric modulator at mu and delta opioid receptors. This property is shared by THC but not by rimonabant.

We examined whether the beta2-adrenoceptor agonists fenoterol and salbutamol, the beta3-adrenoceptor agonists CL 316243 and ZD 2079, and the agonists of the low-affinity state of beta-adrenoceptors, cyanopindolol and CGP 12177 block alpha1-adrenoceptors in that concentration range in which they relax the human pulmonary and rat mesenteric arteries preconstricted with phenylephrine 10 microM and 1 microM, respectively. For quantification of vasodilatation pEC25 values and for the antagonism toward alpha1-adrenoceptors, pA2 values were determined. We found that in the rat mesenteric artery, (1) the pEC25 values of the beta-adrenoceptor ligands resemble their respective pA2 values (differenceor = 0.9 log units), and (2) the order of potencies is the same for both parameters, ie, cyanopindolol approximately fenoterolCGP 12177salbutamolZD 2079CL 316243. In the human pulmonary artery, (1) the pEC25 values are slightly lower (by 0.6-1.3 log units) than their respective pA2 values, and (2) the rank order of potencies is the same for both parameters. In conclusion, the present study suggests that ligands of beta2-adrenoceptors and of non-beta1-non-beta2-adrenoceptors relax rat and human vessels preconstricted with phenylephrine or norepinephrine mainly through their alpha1-adrenolytic effects. Hence, for the investigation of the role of beta-adrenoceptors in vessels, the constrictor agent should be chosen with great caution.

1. Our study was undertaken to investigate whether bacterial endotoxin/lipopolysaccharide (LPS) affects the neurogenic vasopressor response in rats in vivo by presynaptic mechanisms and, if so, to characterize the type of presynaptic receptor(s) operating in the initial phase of septic shock. 2. In pithed and vagotomized rats treated with pancuronium, electrical stimulation (ES) (1 Hz, 1 ms, 50 V for 10 s) of the preganglionic sympathetic nerve fibers or intravenous bolus injection of noradrenaline (NA) (1-3 nmol x kg(-1)) increased the diastolic blood pressure (DBP) by about 30 mmHg. Administration of LPS (0.4 and 4 mg x kg(-1)) under continuous infusion of vasopressin inhibited the neurogenic vasopressor response by 25 and 50%, respectively. LPS did not affect the increase in DBP induced by exogenous NA. 3. The LPS-induced inhibition of the neurogenic vasopressor response was counteracted by the cannabinoid CB(1) receptor antagonist SR 141716A (0.1 micromol x kg(-1)), but not by the CB(2) receptor antagonist SR 144528 (3 micromol x kg(-1)), the vanilloid VR1 receptor antagonist capsazepine (1 micromol x kg(-1)) or the histamine H(3) receptor antagonist clobenpropit (0.1 micromol x kg(-1)). The four antagonists by themselves did not affect the increase in DBP induced by ES or by injection of NA in rats not exposed to LPS. 4. We conclude that in the initial phase of septic shock, the activation of presynaptic CB(1) receptors by endogenously formed cannabinoids contributes to the inhibition of the neurogenic vasopressor response.

1. We studied whether cannabinoid CB1 receptor gene disruption (to yield CB1-/- mice) affects the electrically evoked tritium overflow from vas deferens and atrial pieces preincubated with [3H]-noradrenaline (NA) ('noradrenaline release') and from cerebral cortex slices preincubated with [3H]-choline ('acetylcholine release'). 2. NA release was higher by 37% in vas deferens from CB1-/- mice than in vas deferens from CB1+/+ mice. The cannabinoid receptor agonist WIN 55,212-2 inhibited, and the CB1 receptor inverse agonist/antagonist SR 141716, increased NA release in vas deferens from CB1+/+ mice without affecting it in vas deferens from CB1-/- mice. 3. Atrial NA release did not differ between CB1+/+ and CB1-/- mice nor did WIN 55,212-2 affect NA release in either strain. 4. Cortical acetylcholine (Ach) release did not differ between CB1+/+ and CB1-/- mice. WIN 55,212-2 inhibited, but SR 141716 did not affect, Ach release in the cortex from CB1+/+ mice. Both drugs did not alter Ach release in the cortex from CB1-/- mice. 5. Tritium content did not differ between CB1+/+ and CB1-/- mice in any preparation. 6. In conclusion, the increase in NA release associated with CB1 receptor deficiency in the vas deferens, which cannot be ascribed to an alteration of tritium content of the preparations, suggests an endogenous tone at the CB1 receptors of CB1+/+ mice in this tissue. Furthermore, the effect of WIN 55,212-2 on NA release in the vas deferens and on cortical Ach release involves CB1 receptors, whereas the involvement of non-CB1-non-CB2 receptors can be excluded.

1. The cannabinoid CB(1) receptor inverse agonist/antagonist SR 141716 increases acetylcholine release in rodent hippocampus and improves memory in some experimental paradigms. Since drugs like SR 141716 may represent a novel class of cognition-enhancing drugs, we wanted to check whether the function of the CB(1) receptor is preserved during ageing. 2. Hippocampal and striatal slices from 2- to 3- and 24- to 28-month-old C57BL/6J mice were preincubated with [(3)H]-choline or [(3)H]-noradrenaline ([(3)H]-NA) and superfused. 3. The cannabinoid receptor agonist WIN 55212-2 inhibited, and SR 141716 facilitated, the electrically (3 Hz) evoked tritium overflow in hippocampal slices (preincubated with [(3)H]-choline) from young and aged mice to the same extent. The evoked overflow per se was less by 33% in slices from aged animals. 4. WIN 55212-2 and SR 141716 did not affect, but the muscarinic receptor agonist oxotremorine inhibited, the evoked (3 Hz) overflow in striatal slices (preincubated with [(3)H]-choline) from young and aged mice to the same extent. The evoked overflow per se tended to be less in slices from aged animals. 5. The evoked (0.3 Hz) overflow in hippocampal slices (preincubated with [(3)H]-NA) was not affected by WIN 55212-2 and SR 141716, but was inhibited by histamine (via H(3) receptors) in slices from young mice and, to a somewhat less extent, in slices from aged mice. The evoked overflow per se did not differ between age groups. 6. In conclusion, the function of the CB(1) receptor involved in the tonic inhibition of hippocampal acetylcholine release is preserved in aged mice.