Search

Undissociated lactic acid has been shown to play a major role in complete growth inhibition of Listeria monocytogenes in Gouda cheese. In addition, low water activity conditions may contribute to growth inhibition. In the current study, it was assessed whether the major factors that inhibit growth of L. monocytogenes in Gouda cheese are the factors that determine growth in other types of ready-to-eat cheese as well. Various types of cheeses were selected, some of which had been associated with listeriosis, while others had not. Based on the composition of the different cheese types, the concentrations of undissociated lactic acid were calculated for each type. The ability to support growth of L. monocytogenes was predicted using the Gamma model, based on literature data on total lactic acid content, moisture content, fat content, pH, Aw, and temperature, and optimal growth rates in milk at 30-37 °C. In addition, the actual specific growth rates of L. monocytogenes in the various cheeses were calculated based on available experimental growth data. In 9 out of the 10 RTE cheeses reviewed, the undissociated lactic acid concentrations and a w determined growth/no growth of L. monocytogenes. No growth was correctly predicted for feta, Cheddar and Gouda, and growth was correctly predicted for ricotta, queso fresco, Camembert, high-moisture mozzarella, cottage and blue cheese. Growth of L. monocytogenes was not observed in practice upon inoculation of Emmental, whereas growth in this cheese type was predicted when including the above mentioned factors in the models. Other factors, presumably acetic and propionic acid, are thought to be important to inhibit growth of the pathogen in Emmental. The results from our study show that for cheeses in which lactic acid is a main acid, our model based on undissociated lactic acid, temperature, pH and a w gives a good prediction of potential outgrowth of L. monocytogenes. Implications for L. monocytogenes legislation are discussed per type of RTE cheese reviewed., (Copyright © 2021 The Authors. Published by Elsevier B.V. All rights reserved.)

Realistic prediction of microbial inactivation in food requires quantitative information on variability introduced by the microorganisms. Bacillus subtilis forms heat resistant spores and in this study the impact of strain variability on spore heat resistance was quantified using 20 strains. In addition, experimental variability was quantified by using technical replicates per heat treatment experiment, and reproduction variability was quantified by using two biologically independent spore crops for each strain that were heat treated on different days. The fourth-decimal reduction times and z-values were estimated by a one-step and two-step model fitting procedure. Grouping of the 20 B. subtilis strains into two statistically distinguishable groups could be confirmed based on their spore heat resistance. The reproduction variability was higher than experimental variability, but both variabilities were much lower than strain variability. The model fitting approach did not significantly affect the quantification of variability. Remarkably, when strain variability in spore heat resistance was quantified using only the strains producing low-level heat resistant spores, then this strain variability was comparable with the previously reported strain variability in heat resistance of vegetative cells of Listeria monocytogenes, although in a totally other temperature range. Strains that produced spores with high-level heat resistance showed similar temperature range for growth as strains that produced low-level heat resistance. Strain variability affected heat resistance of spores most, and therefore integration of this variability factor in modelling of spore heat resistance will make predictions more realistic., (Copyright © 2017. Published by Elsevier B.V.)

This study describes the diffusion of NaCl and water in Gouda cheese during brining and ripening. Furthermore, we established water activity as a function of the NaCl-in-moisture content in Gouda cheese during ripening. We determined NaCl content, water content, and water activity in block-type Gouda cheeses that were brined for 3.8d and foil-ripened for a period of 26 wk, and in wheel-type Gouda cheeses that were brined for 0.33, 2.1, or 8.9d and subsequently nature-ripened for a period of 26 wk. The calculated diffusion coefficients of NaCl during brining were 3.6·10(-10) m(2)s(-1) in the block-type Gouda cheeses and 3.5·10(-10) m(2)s(-1) in the wheel-type Gouda cheeses. Immediately after brining, gradients of NaCl and water were observed throughout both types of cheese. During ripening, these gradients disappeared, except for the water gradient in nature-ripened cheeses. An empirical model was derived for Gouda cheese, in which water activity is expressed as a function of the NaCl-in-moisture content, as established for different brining times, locations and ripening times. Moreover, the effect of reduced water activity on inhibition of growth of Listeria monocytogenes in Gouda cheese was calculated. In addition to the presence of lactate and a pH of 5.2 to 5.3, the reduced water activity as seen in Gouda cheese can substantially contribute to inhibition of microbial growth and even to inactivation when cheeses are brined and ripened for extended times and subjected to nature-ripening., (Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.)

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a DeltarecA mutant strain after exposure to the DNA-damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin- and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Stress-survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2) and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.

The food-borne pathogen Listeria monocytogenes has the ability to survive extreme environmental conditions due to an extensive interacting network of stress responses. It is able to grow and survive at relatively high temperatures in comparison with other non-sporulating food-borne pathogens. To investigate the heat-shock response of L. monocytogenes, whole-genome expression profiles of cells that were grown at 37 degrees C and exposed to 48 degrees C were examined using DNA microarrays. Transcription levels were measured over a 40 min period after exposure of the culture to 48 degrees C and compared with those of unexposed cultures at 37 degrees C. After 3 min, 25 % of all genes were differentially expressed, while after 40 min only 2 % of all genes showed differential expression, indicative of the transient nature of the heat-shock response. The global transcriptional response was validated by analysing the expression of a set of 13 genes by quantitative PCR. Genes previously identified as part of the class I and class III heat-shock response and the class II stress response showed induction at one or more of the time points investigated. This is believed to be the first study to report that several heat-shock-induced genes are part of the SOS response in L. monocytogenes. Furthermore, numerous differentially expressed genes that have roles in the cell division machinery or cell wall synthesis were down-regulated. This expression pattern is in line with the observation that heat shock results in cell elongation and prevention of cell division.