Search

Seafood-borne outbreaks caused by Vibrio cholerae have led to the increased need for food safety risk assessment of marine products. An in silico investigation about the potential of virulence gene of V. cholerae, rtxA, as a DNA biomarker of the toxigenic bacterium has been carried out. The aim of this study was to use the bacterial DNA biomarker sequence as a tool to facilitate early rapid detection of cholera infection. Five specific pairs of primers were designed from the rtxA open reading frame DNA of V. cholerae O1 biovar El Tor str. N16961 genomic DNA using Primer3Plus. Next, in silico Polymerase Chain Reaction (PCR) assay was carried out using the newly designed primers and 25 genomic DNA of vibrio spp. retrieved from the in silico database. One of the five designed pairs of primers, RtxAOF-RtxAOR: ‘5-CGCAAAACAGTTTCAGCCGA-3’ and 5’-AGGTTGGTCTTTTGTGGCCA-3’, could result in single DNA amplicon sized 518 bp only from V. cholerae species. No amplicon bands were produced from 17 other vibrio genomes studied using similar RtxAF-RtxAR primers. A further check showed that the amplicon was indeed part of the rtxA gene of V. cholerae. Based on this in silico study, rtxA gene appeared to be a DNA biomarker of V. cholerae, which is potential to facilitate rapid diagnosis of the virulence bacterium using in silico PCR assay.

Streptococcus iniae has been notorious as a serious tilapia fish pathogen leading to many disease outbreaks in warm water marine aquaculture. An in silico investigation about the potential of virulence genes of S. iniae, sagC and sagD, as biomarkers of the bacterial species, has been carried out. The aim was to determine bacterial biomarkers, which are important to facilitate early rapid diagnosis of S. iniae streptococcal infection in fish and also in humans. First, specific primers were designed from sagC and sagD genes of S. iniae SF1 genomic DNA using Primer3Plus. Next, in silico PCR (Polymerase Chain Reaction) analysis was carried out using the newly designed primers and 117 genomic DNA of streptococci (all species) retrieved from the database. Primers designed from sagC and sagD genes (SagCF: ‘5- TGCTGACCTCCTAAAAGGGC -3’ and SagCR: ‘5- CTATGCGGCGGGTTTAAGGT -3’ as well as SagDF: 5’- GCCAATCCAATCCTGTCATGC -3’ and SagDR: 5’- TGCAGCTTCCATAACCCCTC -3’) could result in a single band of each matching to 558-bp and 590-bp PCR products only from S. iniae. From 116 other streptococcal genomes studied using similar primers have resulted in no amplicon bands. A further check showed that the amplicons were truly part of sagC and sagD genes of S. iniae. These results showed that sagC and sagD genes appeared to be biomarkers of S. iniae, which are potential to be used to facilitate rapid diagnostic of the pathogenic bacterium.

MotivationDNA metabarcoding is a commonly applied technique used to infer the species composition of environmental samples. These samples can comprise hundreds of organisms that can be closely or very distantly related in the taxonomic tree of life. DNA metabarcoding combines polymerase chain reaction (PCR) and next-generation sequencing (NGS), whereby a short, homologous sequence of DNA is amplified and sequenced from all members of the community. Sequences are then taxonomically identified based on their match to a reference database. Ideally, each species of interest would have a unique DNA barcode. This short, variable sequence needs to be flanked by relatively conserved regions that can be used as primer binding sites. Appropriate PCR primer pairs would match to a broad evolutionary range of taxa, such that we only need a few to achieve high taxonomic coverage. At the same time however, the DNA barcodes between primer pairs should be different to allow us to distinguish between species to improve resolution. This poses an interesting optimization problem. More specifically: Given a set of references ℛ = {R1, R2, …, Rm}, the problem is to find a primer set P balancing both: high taxonomic coverage and high resolution. This goal can be captured by filtering for frequent primers and ranking by coverage or variation, i.e. the number of unique barcodes. Here we present the software PriSeT, an offline primer discovery tool that is capable of processing large libraries and is robust against mislabeled or low quality references. It tackles the computationally expensive steps with linear runtime filters and efficient encodings.ResultsWe first evaluated PriSeT on references (mostly 18S rRNA genes) from 19 clades covering eukaryotic organisms that are typical for freshwater plankton samples. PriSeT recovered several published primer sets as well as additional, more chemically suitable primer sets. For these new sets, we compared frequency, taxon coverage, and amplicon variation with published primer sets. For 11 clades we found de novo primer pairs that cover more taxa than the published ones, and for six clades de novo primers resulted in greater sequence (i.e., DNA barcode) variation. We also applied PriSeT to 19 SARS-CoV-2 genomes and computed 114 new primer pairs with the additional constraint that the sequences have no co-occurrences in other taxa. These primer sets would be suitable for empirical testing.Availabilityhttps://github.com/mariehoffmann/PriSeTContactmarie.hoffmann@fu-berlin.de

Detection of Salmonella bacteria based on their virulence genes is among essential steps in the eradication of clinical infection by bacteria. In this study, two pair of primers, PhoPF-PhoPR: 5’- CCGCGCAGGAAAAACTCAAA-3’ and 5’-ATCTGTTCCAGCATCACCGG -3’ as well as PhoQF-PhoQR: 5’-AGAGATGATGCGCGTACTGG-3’ and 5’- CAGACGCCCCATGAGAACAT-3’, had been successfully designed using Primer3Plus to detect the presence of phoP and phoQ genes in Salmonella spp. Using genomic DNA of 44 genomic data of Salmonella spp. as templates, PhoPF-PhoPR could produce 520-bp amplicon, while PhoQF-PhoQR could result in 598-bp amplicon. Results of in silico PCR showed that both pairs of primers PhoPF-PhoPR and PhoQF-PhoQR could detect only Salmonella enterica species, and no Salmonella bongori species could be detected based on phoP and phoQ sequences. Both pairs of PhoPF-PhoPR and PhoQF-PhoQR primers were also able to detect the virulence genes in most of the studied subspecies of Salmonella enterica available in silico database unless Arizona subspecies. As conclusion, based on this in silico study, phoP and phoQ genes appeared to be biomarkers for Salmonella enterica species. Both pairs of primers designed in this study has potential to be used as detection tool to differentiate species Salmonella enterica from Salmonella bongori, and also to distinguish S.enterica subsp. enterica from subsp. Arizonae.Keywords: Gene detection, bacterial virulence, phoP, phoQ, Salmonella spp.

A successful polymerase chain reaction (PCR) is the consequence of efficient primer designing and selective amplification of the target genetic region. The advancement of computational algorithms has allowed us to calculate the theoretical possibility of a successful PCR by designing highly specific and sensitive primers before starting expensive laboratory assays. Variety of web servers freely available for designing primer sequences and computational optimization of the PCR conditions. In the current chapter, we discuss and demonstrate how to design the primer sequences using “Primer-BLAST” program and validate those test sequences by simple primer evaluation methods. This in silico PCR method considers different primer-quality influencing factors like GC content, primer length, and melting temperature to design the five most suitable primer sets for the target gene sequence. The selection of best PCR primer set depends on how good the primer properties are and also its coverage area of the target gene. The short-listed primer sets are finally validated for future possibility of GC clamp, self-annealing, and hairpin formation using “PCR Primer Stat” program.

Despite the advent of next-generation sequencing, the polymerase chain reaction (PCR) and Sanger sequencing remain useful tools for molecular identification and systematics. To date, molecular systematics of scale insects has been constrained by the paucity of loci that researchers have been able to amplify with available PCR primers. Due to the rapid molecular evolution of scale insects, “universal” primers, and even primers developed for their sister taxon the Aphidoidea, typically fail. We used transcriptome data for two diaspidids, Acutaspis umbonifera (Newstead) and Chrysomphalus aonidum (Linnaeus), together with a published aphid genome, to design novel PCR primer sets for scale insects. Our primers amplify fragments of eight single-copy genes: ATP-dependent RNA helicase (DHX8), translation initiation factor 5 (IF5X1), DNA replication licensing factor (Mcm2), double-strand break repair protein (MRE11A), serine/threonine- protein phosphatase (PPP1CB), DNA-directed RNA polymerase II (RNApII), ribonucleoside-diphosphate reductase (RRM1), signal recognition particle receptor (SRPα), neuronal PAS domain-containing protein 4 (NPAS4), and cleft lip and palate transmembrane protein 1 (TP1). Here we report the results of tests of amplification success and phylogenetic utility of these primer sets across the Diaspididae and nine other families of Coccomorpha.

The dataset presented in this article is related to the research article entitled “Detection of HER2 Gene Polymorphism in Breast Cancer: PCR Optimization Study” (B.R. Budiarto, Desriani, 2016) [1] with some modification in primers used and in PCR optimization strategy to eliminate false-positive result that may occur in HER2I655V polymorphism detection. Combining a new set of primers with PCR gradient, The allele-specific PCR well performs to detect all type of breast cancer-originated HER2I655V genotypes. The validation of this method was done using Sanger DNA sequencing, offering an alternative tool for HER2I655V polymorphism detection in another type of cancer.

Introduction Brucellosis is a worldwide zoonosis and a significant cause of loss of health in humans and animals. Traditionally, classic diagnosis is carried out by isolation of Brucella, which is time-consuming, technically challenging and potentially dangerous. The aim of this study was to expand a molecular test that would be used for the develop detection of Brucella in a single reaction with high sensitivity and specificity, by targeting IS711element. Methods This study was carried out from 2015 to 2016 at the Ayatolla Rohani hospital in Babol, Iran. The present study was designed to develop PCR assay, based on IS711 gene for rapid diagnosis of Brucella spp. and immediate detection of Brucella, with high sensitivity and specificity. Four pairs of oligo-nucleotide primers with sizes of 547, 403, 291 and 127bp respectively, were planned to exclusively amplify the targeted genes of Brucella species. Results Our results show that, five PCR primers set up, would be helpful in amplifying the DNAs from the genus Brucella with high specificity and sensitivity so it can be 12 fg, for Brucella species to provide a valuable tool for diagnosis. Conclusion This method can be more useful than serological and biochemical tests and in addition, this reduces the number of required tests more rapidly and economically.

DNA metabarcoding is a technique used to survey biodiversity in many ecological settings, but there are doubts about whether it can provide quantitative results, that is, the proportions of each species in the mixture as opposed to a species list. While there are several experimental studies that report quantitative metabarcoding results, there are a similar number that fail to do so. Here, we provide the rationale to understand under what circumstances the technique can be quantitative. In essence, we simulate a mixture of DNA of S species with a defined initial abundance distribution. In the simulated PCR, each species increases its concentration following a certain amplification efficiency. The final DNA concentration will reflect the initial one when the efficiency is similar for all species; otherwise, the initial and final DNA concentrations would be poorly related. Although there are many known factors that modulate amplification efficiency, we focused on the number of primer-template mismatches, arguably the most important one. We used 15 common primers pairs targeting the mitochondrial COI region and the mitogenomes of ca. 1,200 insect species. The results showed that some primers pairs produced quantitative results under most circumstances, whereas some other primers failed to do so. In conclusion, depending on the primer pair used in the PCR amplification and on the characteristics of the mixture analysed (i.e., high species richness, low evenness), DNA metabarcoding can provide a quantitative estimate of the relative abundances of different species.

The internal transcribed spacer (ITS) of nuclear ribosomal DNA is one of the most commonly used DNA markers in plant phylogenetic and DNA barcoding analyses, and it has been recommended as a core plant DNA barcode. Despite this popularity, the universality and specificity of PCR primers for the ITS region are not satisfactory, resulting in amplification and sequencing difficulties. By thoroughly surveying and analysing the 18S, 5.8S and 26S sequences of Plantae and Fungi from GenBank, we designed new universal and plant-specific PCR primers for amplifying the whole ITS region and a part of it (ITS1 or ITS2) of plants. In silico analyses of the new and the existing ITS primers based on these highly representative data sets indicated that (i) the newly designed universal primers are suitable for over 95% of plants in most groups; and (ii) the plant-specific primers are suitable for over 85% of plants in most groups without amplification of fungi. A total of 335 samples from 219 angiosperm families, 11 gymnosperm families, 24 fern and lycophyte families, 16 moss families and 17 fungus families were used to test the performances of these primers. In vitro PCR produced similar results to those from the in silico analyses. Our new primer pairs gave PCR improvements up to 30% compared with common-used ones. The new universal ITS primers will find wide application in both plant and fungal biology, and the new plant-specific ITS primers will, by eliminating PCR amplification of nonplant templates, significantly improve the quality of ITS sequence information collections in plant molecular systematics and DNA barcoding.

Insertional mutagenesis induced by T-DNA or transposon tagging offers possibilities for analysis of gene function. However, its potential remains limited unless good methods for detecting the target locus are developed. We describe a PCR technique for efficient identification of DNA sequences adjacent to the inserted T-DNA in a higher plant, Chinese cabbage ( Brassica rapa ssp. pekinensis). This strategy, which we named variable argument thermal asymmetric interlaced PCR (VA-TAIL PCR), was desi gned by modifying a single-step annealing-extension PCR by including a touch-up PCR protocol and using long gene-specific primers. Amplification efficiency of this PCR program was significantly increased by employing an autosegment extension method and linke d sequence strategy in nested long gene-specific primers. For this technique, arbitrary degenerate (AD) primers specific to B. rapawere designed by analyzing the Integr8 proteome database. These primers showed higher accuracy and utility in the identificatio n of flanking DNA sequences from individual transgenic Chinese cabbages in a large T-DNA inserted population. The VA-TAIL PCR method described in this study allows the identification of DNA regions flanking known DNA fragments T.his method has potential biotechnological applications, being highly suitable for identification of target genomic loci in insertional mutagenesis scree ns.Additional key words

Background Genetic polymorphisms of human cytochrome P450 2A6 (CYP2A6) are one of the determinants of smoking behavior and/or tobacco-related lung cancer risk in male Japanese smokers. To help identify those at high risk, we developed a multiplex real-time polymerase chain reaction (PCR)-based genotyping method with dual-labeled probes to detect wild-type and whole-gene deletion of CYP2A6 directly from blood samples without DNA isolation. Methods We validated the new real-time PCR method that uses dual-labeled probes by utilizing 116 genomic DNA samples that had been genotyped previously and 33 blood samples. Results The new method could discriminate CYP2A6 from highly homologous CYP2A7 and CYP2A13 genes and could also determine CYP2A6*1 (wild type) and CYP2A6*4 (whole-gene deletion) alleles in perfect accordance with previous analysis data. Amplification curve profiles were obtained by multiplex real-time PCR assay with CYP2A6*1 and CYP2A6*4 primer sets and dual-labeled probes using one-drop blood samples previously genotyped for CYP2A6*1/*1, CYP2A6*1/*4, and CYP2A6*4/*4. Conclusions A real-time multiplex PCR assay for genotyping wild-type CYP2A6 and whole-gene deletion was developed with dual-labeled probes. The new method achieved 100% agreement with data from the conventional PCR method for 116 genomic DNA samples and samples from 33 volunteers, thereby establishing its validity.

Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR) including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets) and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR), limit of detection (LoD) and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively) and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia). Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America. © 2017 León, Muñoz, Hernández, Ayala, Flórez, Teherán, Cubides and Ramírez.

This chapter provides various tricks, tips, and troubleshooting solutions regarding nonstandard polymerase chain reaction (PCR) cases, such as “long PCR,” randomly amplified of polymorphic DNA PCR, and quantitative PCR. Optimization information is given on how to amplify very long PCR products, as well as how to amplify DNA targets for which the DNA sequence might be unknown (randomly amplified of polymorphic DNA PCR). In addition, quantitative PCR is described and a guide for detecting potential problems and troubleshooting is provided.

The polymerase chain reaction (PCR) is a technology used to exponentially amplify a short, specific DNA region of interest, generating thousands to millions of copies of this specific region, all with a similar sequence and length. It is one of the few techniques that has undoubtedly revolutionized the field of molecular biology and diagnostics. Since the invention of the classical end-point PCR in 1986, the technique has gone through a revolutionary period, with a boost in 1992 due to the invention of real-time or quantitative PCR (qPCR), which allowed for monitoring the PCR reaction in real-time, thereby making the quantification of nucleic acids much more simple, accurate, and sensitive. It is a key technology that is present on almost every bench in a research or diagnostic laboratory. In this chapter we will give an overview of the qPCR technique, starting from its invention, describing the different methodologies and important factors to be taken into account when optimizing and using this widespread nucleic acid-based technique.

Accurate identification of fungal pathogens using a sequence-based approach requires an extraction method that yields template DNA pure enough for polymerase chain reaction (PCR) or other types of amplification. Therefore, the objective of this study was to develop and standardise a rapid, inexpensive DNA extraction protocol applicable to the major fungal phyla, which would yield sufficient template DNA pure enough for PCR and sequencing. A total of 519 clinical and culture collection strains, comprised of both yeast and filamentous fungi, were prepared using our extraction method to determine its applicability for PCR, which targeted the ITS and D1/D2 regions in a single PCR amplicon. All templates were successfully amplified and found to yield the correct strain identification when sequenced. This protocol could be completed in approximately 30 min and utilised a combination of physical and chemical extraction methods but did not require organic solvents nor ethanol precipitation. The method reduces the number of tube manipulations and yielded suitable template DNA for PCR amplification from all phyla that were tested.

Genetic transformation is a widely employed tool in both basic research and commercial plant breeding programs. Its application requires that transgenes be stably integrated and expressed in the plant genome. When transgenic plants are developed, it is essential to determine which plants contain the transgene. Detection methods are usually based on amplification of the target transgene. This paper describes a development of detection method based on conventional and real time polymerase chain reaction (PCR) for simultaneous detection of barley HVA1 transgene and its transcript in transformed durum wheat. Since there exist a high homology between the barley HVA1 gene and the wheat gene, development of a specific sets of primers is needed for PCR-based characterizations, and the study of the transgene. Based on the alignment of the two genes sequences obtained from public databases, several primers were designed to detect and distinguish between the transformed and non-transformed plants. Real time PCR has been employed because of its inherent sensitivity and quantitative nature. It has been possible to design the following primers pairs F2/MMR, F2/R10 and F14/R10 as highly specific and suitable for the detection of HVA1 DNA by conventional and real-time PCR. Nonetheless, the primers used were allowed to reach high efficiencies and did not show any cross-reactivity with DNAs extracted from various plants. The sensitivity achieved was 6.4 pg. The primer pair F2/R10 was considered as highly specific for the detection of both DNA and mRNA of the HVA1 by real-time PCR. The assays proved to be accurate, specific, sensitive and sufficiently reproducible for further application in high-throughput molecular characterization of transgenic lines.Keywords: HVA1, durum wheat, transgenic plant, real time polymerase chain reaction (PCR), droughtAfrican Journal of Biotechnology, Vol. 13(4), pp. 581-592, 22 January, 2014

Pseudomonas spp. have been known as notorious food spoilage bacteria with ability to produce thermo-tolerant enzymes. They pose serious risk to public health as its most pathogenic member, P. aeruginosa, could cause nosocomial infections affecting peoplewith immunodeficiency. The use of GMF-GMR primers had been reported capable for detecting bacterial moaC of Alcaligenes javaensis JG3. The gene is suspected to be related with dormancy of pathogenic bacteria. This study aimed to investigate specificity of the GMR-GMF as well as a newly designed JMF-JMR pairs of primers (JMF: 5’- GGCGTACATCATCCACACTG-3’ and JMR: 5’-GGCGTTGACCATCTATGACA-3’) for detecting moaC genes of 57 members of Pseudomonas spp. retrieved from http://insilico.ehu.eus/ database using in silico PCR (Polymerase Chain Reaction). The results showed that GMF-GMR primers could selectively amplify 271-bp in silico PCR products from 14 out of 57 members of Pseudomonas spp. tested. However, BLASTn analysis on these 14 amplified DNA sequences showed that they were not part of moaC, yet glpK gene fragment sequences. Meanwhile, the newly designed primers from moaC sequence of strain JG3, JMFJMR, could specifically amplify 214-bp in silico PCR products from 2 out of 57 members of Pseudomonas spp. matched to bacterial moaC gene fragment sequences. As conclusion, based on in silico study JMF-JMR primers are more specific than GMF-GMR ones for detecting moaC gene fragments of members of Pseudomonas spp. studied.

Summary We describe a semi-empirical framework that combines thermodynamic models of primer hybridization with experimentally determined elongation biases introduced by 3′-end mismatches for improving polymerase chain reaction (PCR)-based sequence discrimination. The framework enables rational and automatic design of primers for optimal targeting of one or more sequences in ensembles of nearly identical DNA templates. In situations where optimal targeting is not feasible, the framework accurately predicts non-target sequences that are difficult to distinguish with PCR alone. Based on the synergistic effects of disparate sources of PCR bias, we used our framework to robustly distinguish between two alleles that differ by a single base pair. To demonstrate the applicability to environmental microbiology, we designed primers specific to all recognized archaeal and bacterial genera in the Ribosomal Database Project, and have made these primers available online. We applied these primers experimentally to obtain genus-specific amplification of 16S rRNA genes representing minor constituents of an environmental DNA sample. Our results demonstrate that inherent PCR biases can be reliably employed in an automatic fashion to maximize sequence discrimination and accurately identify potential cross-amplifications. We have made our framework accessible online as a programme for designing primers targeting one group of sequences in a set with many other sequences (http://DECIPHER.cee.wisc.edu).

DNA is a typical organic compound with marked differences from other chemicals and biopolymers because DNA can be amplified by the enzyme polymerase. DNA can be, in principle, amplified from a single copy by the polymerase chain reaction (PCR). In this review, we focus our attention on the chemistry of PCR primers. Because PCR is basic technology in biology research fields, we sometimes use chemically labeled primers without any awareness of the chemistry they leave behind. We would like to emphasize that chemically labeled primers contain a lot of potential for different chemistry ideas and much study is still necessary to advance PCR for single-nucleotide polymorphism (SNP) typing, genetic diagnosis, and other fields. Two categories of primers, affinity-capture primers and signaling primers, are discussed from the viewpoints of their chemical concepts and applications. Affinity-capture primers are used for purification, isolation, and manipulation of PCR products by high specificity and affinity to the cognate molecules by moleculemolecule interactions, whereas signaling primers report the hybridization and/or progress of PCR amplification by a signal change, in most cases by a fluorescence change. The content of this review may be useful for a better understanding of the chemistry of PCR primers and, more importantly, for the invention of novel PCR chemistry.

This laboratory exercise demonstrates three different analytical forms of the polymerase chain reaction (PCR) that allow students to genotype themselves at four different loci. Here, we present protocols to allow students to a) genotype a non-coding polymorphic Variable Number of Tandem Repeat (VNTR) locus on human chromosome 5 using conventional PCR, b) perform PCR - Restriction Fragment Polymorphism (PCR-RFLP) analysis to genotype a Single Nucleotide Polymorphism (SNP) of the TAS2R38 gene on human chromosome 7 and c) perform duplex Allele Specific Primer-PCR (ASP-PCR) to genotype SNPs of two enzyme-encoding genes in a single biochemical pathway on human chromosomes 4 and 12. All PCR reactions have been optimized to use a single easily purified sample of the students' own DNA and run under a single thermal cycler program using inexpensive reagents to produce robust and clearly interpretable results on a single agarose gel. As presented here, the lab occupies two lab periods of 2 h, 40 min each: DNA purification followed by PCR reactions set-up on Day 1 and enzyme digestion of the PCR-RFLP and agarose gel analysis on Day 2.

The aim of the present study was to develop a strain-specific polymerase chain reaction (PCR) primer set for the detection of Bifidobacterium bifidum OLB6378 (OLB6378) that can serve as suitable probiotics for infants. The random amplified polymorphic DNA (RAPD)-PCR technique was used to obtain OLB6378-specific PCR products. One OLB6378-specific RAPD-PCR product was obtained after testing 97 RAPD primers, and was sequenced. Thirteen PCR primer sets were designed from the sequence. One PCR primer set was found to amplify one PCR product when genomic DNA of OLB6378 was used as template. The primer set did not amplify any PCR product when the other genomic DNA was used as template. The primer set was tested with 47 strains of B. bifidum and 20 strains of the other Bifidobacterium species. As a result, we developed an OLB6378-specific primer set, one that should be useful not only for the detection of OLB6378 but also for the quantification of OLB6378.

With increasing rates of antibiotic resistance, bacterial infections have become more difficult to treat, elevating the importance of surveillance and prevention. Effective surveillance relies on the availability of rapid, cost-effective, and informative typing methods to monitor bacterial isolates. PCR-based typing assays are fast and inexpensive, but their utility is limited by the lack of targets which are capable of distinguishing between strains within a species. To identify highly informative PCR targets from the growing base of publicly available bacterial genome sequences, we developed pan-PCR. This computer algorithm uses existing genome sequences for isolates of a species of interest and identifies a set of genes whose patterns of presence or absence provide the best discrimination between strains in this species. A set of PCR primers targeting the identified genes is then designed, with each PCR product being of a different size to allow multiplexing. These target DNA regions and PCR primers can then be utilized to type bacterial isolates. To evaluate pan-PCR, we designed an assay for the emerging pathogen Acinetobacter baumannii . Taking as input a set of 29 previously sequenced genomes, pan-PCR identified 6 genetic loci whose presence or absence was capable of distinguishing all the input strains. This assay was applied to a set of patient isolates, and its discriminatory power was compared to that of multilocus sequence typing (MLST) and whole-genome optical maps. We found that the pan-PCR assay was capable of making clinically relevant distinctions between strains with identical MLST profiles and showed a discriminatory power similar to that of optical maps. Pan-PCR represents a tool capable of exploiting available genome sequence data to design highly discriminatory PCR assays. The ease of design and implementation makes this approach feasible for diagnostic facilities of all sizes.

Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered.

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with 'end-point' PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included.

Diatoms are widely known as brown microalgae generating silicified cell-wall called frustule. The unique frustule ornamentations form occlusion and perforation. An interesting study of frustule formation led us to understand further the variation of thegene of interest (Silicic Acid Transporter/ SIT1) on Bacillariophyceae. The SIT1 gene indicating the frustule formation on diatomhas been studied. As a preliminary study, we used in silico Polymerase Chain Reaction (PCR) analysis to know the gene variation of SIT1. The analysis was conducted using data available from Genebank followed by primer design, comparison of sequence alignment, and in silico PCR. Fourteen extracted SIT1 sequences were aligned and analyzed usingFastPCR program with in silico PCR feature. Our result suggested the primer 7C could be implemented as degenerate primers resulting the in silico amplification of 426-435 bp PCR products. MUSCLE algorithm was furthermore used to align the regions resulted from in silico PCR. A moderate percent...

With the advent of molecular-based methods to detect the presence of microbial pathogens, technologies such as the polymerase chain reaction (PCR) and whole genome sequencing have revolutionized the field of food microbiology in ensuring that food products are pathogen free. In addition, these tests can also be applied to strain-specific identification, thus serving as an important tool for differentiating and identifying strains used in food production and as probiotics. The basis of PCR methods is the amplification of select sites in either DNA or RNA molecules such that the level of sensitivity is as low as one microbial cell or virus particle. Since the first days that PCR was rolled out and its potential as a powerful tool for microbial diagnostics was recognized, improvements in its chemistry and the machines that perform these reactions have been impressive. Real-time PCR, which enables concurrent amplification of nucleic acid target sites and the data readout indicating the status of the reaction, has reduced the time of analysis from 2 to 4 h to less than 1 h. Whole genome sequencing can be applied to isolated colonies as well as a nonconventional means as a culture-free detection and identification method. Improvements in these technologies have such potential that the detection and identification of all known microbial pathogens can be accomplished in one reaction. Many different types of molecular-based assays are described in this article.

With the advent of next-generation sequencing and its prolific use in the clinical realm, it would appear that techniques such as PCR would not be in high demand. This is not the case however, as PCR techniques play an important role in the success of NGS technology. Although NGS has rapidly become an important part of clinical molecular diagnostics, whole genome sequencing is still difficult to implement in a clinical laboratory due to high costs of sequencing, as well as issues surrounding data processing, analysis, and data storage, which can reduce efficiency and increase turnaround times. As a result, targeted sequencing is often used in clinical diagnostics, due to its increased efficiency. PCR techniques play an integral role in targeted NGS sequencing, allowing for the generation of multiple NGS libraries and the sequencing of multiple targeted regions simultaneously. We will outline the methods we employ in PCR amplification of targeted genomic regions for cancer mutation hotspots using the Ampliseq Cancer Hotspot v2 panel (Life Technologies, Carlsbad, CA).

The polymerase chain reaction (PCR) is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation and diagnosis of a growing number of diseases. PCR is also used in forensics laboratories. PCR can identify genes that have been implicated in the development of cancer. The present paper is an attempt to review basics of PCR in relation to its methods, application and use.

Evaluating the specificity of polymerase chain reaction (PCR) primers is an essential step in PCR primer design. The MFEprimer-2.0 server allows users to check primer specificity against genomic DNA and messenger RNA/complementary DNA sequence databases quickly and easily. MFEprimer-2.0 uses a k-mer index algorithm to accelerate the search process for primer binding sites and uses thermodynamics to evaluate binding stability between each primer and its DNA template. Several important characteristics, such as the sequence, melting temperature and size of each amplicon, either specific or non-specific, are reported on the results page. Based on these characteristics and the user-friendly output, users can readily draw conclusions about the specificity of PCR primers. Analyses for degenerate primers and multiple PCR primers are also supported in MFEprimer-2.0. In addition, the databases supported by MFEprimer-2.0 are comprehensive, and custom databases can also be supported on request. The MFEprimer-2.0 server does not require a login and is freely available at http:// biocompute.bmi.ac.cn/CZlab/MFEprimer-2.0. More over, the MFEprimer-2.0 command-line version and local server version are open source and can be downloaded at https://github.com/quwubin/ MFEprimer/wiki/Manual/.

Metabarcoding approaches use total and typically degraded DNA from environmental samples to analyse biotic assemblages and can potentially be carried out for any kinds of organisms in an ecosystem. These analyses rely on specific markers, here called metabarcodes, which should be optimized for taxonomic resolution, minimal bias in amplification of the target organism group and short sequence length. Using bioinformatic tools, we developed metabarcodes for several groups of organisms: fungi, bryophytes, enchytraeids, beetles and birds. The ability of these metabarcodes to amplify the target groups was systematically evaluated by (i) in silico PCRs using all standard sequences in the EMBL public database as templates, (ii) in vitro PCRs of DNA extracts from surface soil samples from a site in Varanger, northern Norway and (iii) in vitro PCRs of DNA extracts from permanently frozen sediment samples of late-Pleistocene age (~16,000-50,000 years bp) from two Siberian sites, Duvanny Yar and Main River. Comparison of the results from the in silico PCR with those obtained in vitro showed that the in silico approach offered a reliable estimate of the suitability of a marker. All target groups were detected in the environmental DNA, but we found large variation in the level of detection among the groups and between modern and ancient samples. Success rates for the Pleistocene samples were highest for fungal DNA, whereas bryophyte, beetle and bird sequences could also be retrieved, but to a much lesser degree. The metabarcoding approach has considerable potential for biodiversity screening of modern samples and also as a palaeoecological tool.

Screening and analysis of collections of DNA molecules is a standard aspect of many DNA computing approaches. We describe the use of three different polymerase chain reaction (PCR) detection methods to screen specific members of a 5-site, 2-variable DNA computing library previously created using parallel overlap assembly of unique sequences generated from the SynDCode program. The three PCR methods (conventional gel-based PCR, SYBR Green real-time PCR and TaqMan real-time PCR) could all successfully identify individual library members separately or in a mixture. The TaqMan approach was also able to identify members in the original library we had not yet sequenced, providing more evidence supporting our hypothesis that the DNA library we generated may be complete. We expect these three approaches will be useful in future screening of other DNA computing libraries and structures.

Summary The base adjacent to the 3′ end of universal PCR primers targeting the 16S rRNA gene is often variable and apparently biases the microbial community composition as represented by PCR-based surveys. To test this hypothesis, four templates of 44 bases each and two complementary primers (21 bases) were designed to differ only in the bases adjacent to the primers, and their amplification efficiencies were evaluated using quantitative PCR. For extension temperatures of 72°C, 73°C and 74°C, improvement in initial amplification efficiency was observed for templates with guanine or cytosine at the position contiguous to the primers. However, no clear preference was observed when extension temperature was lowered to 70°C. Shortening the primers by one base, so that the variable position was located two base pairs downstream from the primer, attenuated but did not eliminate this bias. A conformational change of the quaternary polymerase – primer – template – dNTP complex upon commencing of polymerization is thought to be a rate-limiting step. A possible explanation for the observed bias is the stabilization of this complex by the adjacent guanine or cytosine. Reducing PCR extension temperature to 70°C minimizes amplification biases caused by variable template-contiguous bases to the 3′ end of universal PCR primers. Next-base nucleotide composition should be taken in consideration in designing primers targeting 16S rRNA or other functional genes used in microbial ecology studies.

Optimization of primer sequences for polymerase chain reaction (PCR) and quantitative PCR (qPCR) and reaction conditions remains an experimental challenge. We have developed a resource, PrimerBank, which contains primers that can be used for PCR and qPCR under stringent and allele-invariant amplification conditions. A distinguishing feature of PrimerBank is the experimental validation of primer pairs covering most known mouse genes. Here, we describe a major update of PrimerBank that includes the design of new primers covering 17 076 and 18 086 genes for the human and mouse species, respectively. As a result of this update, PrimerBank contains 497 156 primers (an increase of 62% from the previous version) that cover 36 928 human and mouse genes, corresponding to around 94% of all known protein-coding gene sequences. An updated algorithm based on our previous approach was used to design new primers using current genomic information available from the National Center for Biotechnology Information (NCBI). PrimerBank primers work under uniform PCR conditions, and can be used for high-throughput or genome-wide qPCR. Because of their broader linear dynamic range and greater sensitivity, qPCR approaches are used to reanalyze changes in expression suggested by exploratory technologies such as microarrays and RNA-Seq. The primers and all experimental validation data can be freely accessed from the PrimerBank website, http://pga.mgh.harvard.edu/primerbank/.

The development of a reliable PCR assay for genetic testing of spinocerebellar ataxia type 3. Touchdown PCR conditions were tested and different primer sets were evaluated with genomic DNA from blood sample of patients suffering from spinocerebellar ataxia type 3 (SCA3). An improved PCR assay was developed with a new set of primers and using the optimized touchdown PCR protocol. This new assay had been successfully employed in the screening of one identificated SCA3 family. Results from the present study document a simple and reliable PCR assay for genetic testing of SCA3. Strategies used in the present study may find applications in the optimization of PCR assay for triplet expansion with GC rich in the sequence context.

With the increasing development of genetically modified organisms (GMOs), labeling regulations have been introduced, which require appropriate detection methods. The polymerase chain reaction (PCR) technique has been the mainstay for GMO detection, especially for event-specific qualitative and quantitative PCR detection methods, which have become the internationally agreed state-of-art. This paper describes the character and event-specific quantitative detection method of DP-356043-5 (356043) soybean. In this research, the flanking regions were characterized by inverse PCR (I-PCR). Furthermore, the event-specific PCR primers and TaqMan probe were designed based on the discovered right and left flanking sequences. In the qualitative PCR assay, PCR systems were established with the species-specific and event-specific primers, respectively. And event-specific primers were established on both right and left flanking sequences; the limit of detection (LOD) was both 0.05% (approximates to 42 haploid genome copies). In the quantitative TaqMan real-time PCR assay, we obtained standard curves with good linearity and relatively high efficiency of PCR. All the results indicated that the established event-specific qualitative and quantitative PCR systems for 356043 soybean in this study were reliable and suitable for 356043 soybean detection in mixed samples. Besides, based on the flanking sequence information we obtained, not only the qualitative and quantitative PCR system for detecting 356043 soybean can be established, but also some other novel event-specific detection methods using gene microarray, biosensor, etc., with target sequence on them can also be developed, which have a good value for detecting 356043 soybean.

With the development of genetically modified organisms (GMOs), labeling regulations have been introduced, which require appropriate detection methods. Event-specific qualitative and quantitative PCR detection methods have become the internationally agreed state-of-art. This paper describes the characterization and event-specific quantitative detection of LY038 maize insert with the application of reference molecule. The flanking regions were characterized by Inverse-PCR (I-PCR). Furthermore, the event-specific PCR primers and TaqMan probe were designed based on the discovered right flanking sequence. In the qualitative PCR assay, two PCR systems were established with the event-specific and specie-specific primers respectively, and the limit of detection (LOD) was 0.1% (approximates to 37 haploid genome copies). In the quantitative TaqMan real-time PCR assay, a reference molecule was constructed by recombinant PCR and standard curves were set up. By using the reference molecule, we obtained standard curves with good linearity and relatively high efficiency of PCR reaction. The results indicated the usability of the plasmid as standard material. From above results, we believed that the established event-specific qualitative and quantitative PCR systems for LY038 maize in this study were acceptable and suitable for LY038 maize detection in mixed samples.

Objectives To establish a primer design method for amplification of GC-rich DNA sequences. Design and methods A group of 15 pairs of primers with higher Tm (> 79.7 °C) and lower level ΔTm ( 65 °C), and we can overcome this difficulty easily by designing primers and using higher annealing temperature.

PCR detection of viral pathogens is extremely useful, but suffers from the challenge of detecting the many variant strains of a given virus that arise over time. Here, we report the computational derivation and initial experimental testing of a combination of 10 PCR primers to be used in a single high-sensitivity mixed PCR reaction for the detection of dengue virus. Primer sequences were computed such that their probability of mispriming with human DNA is extremely low. A 'cocktail' of 10 primers was shown experimentally to be able to detect cDNA clones representing the four serotypes and dengue virus RNA spiked into total human whole blood RNA. Computationally, the primers are predicted to detect 95% of the 1688 dengue strains analyzed (with perfect primer match). Allowing up to one mismatch and one insertion per primer, the primer set detects 99% of strains. Primer sets from three previous studies have been compared with the present set of primers and their relative sensitivity for dengue virus is discussed. These results provide the formulation and demonstration of a mixed primer PCR reagent that may enable the detection of nearly any dengue strain irrespective of serotype, in a single PCR reaction, and illustrate an approach to the broad problem of detecting highly mutable RNA viruses.

PCR amplification techniques viz., repetitive DNA element PCR (REP-PCR), short tandemly repeated repetitive PCR (STRR-PCR) and arbitrarily primed PCR (RAPD-PCR) were used for the taxonomic discrimination among the strains of the unicellular cyanobacterium Synechococcus elongatus collected across the coastal regions of the Indian subcontinent. These strains showed similar phenotypic and genotypic characteristics. Data obtained from genomic fingerprinting were used to perform cluster analysis and demonstrated ability to differentiate strains at intra-specific level. Polymorphisms of different PCR amplification products can serve as strain-specific molecular fingerprints. In comparison with the STRR and RAPD, the REP primer set generates fingerprints of lower complexity, but still the phenogram clearly differentiated the strains. In conclusion, described PCR fingerprinting methods can be considered as promising tools for the differentiation at the strain level of cyanobacteria from the same species.

The 16S-23S intergenic spacers (ITS) of ribosomal DNA from ten independent isolates of Streptococcus iniae and one reference strain ATCC29178 were sequenced, aligned and used to design a polymerase chain reaction (PCR) primer set for rapid and specific detection and identification of S. iniae. This primer set amplified a 377-bp DNA fragment specifically from S. iniae, but not from other common bacterial pathogens of fish or from non-fish pathogens. The PCR conditions were optimized to allow detection of the organism from agar, broth culture or infected fish tissue. The sensitivity of the PCR assay was established by the detection of DNA as low as 0.02 ng or as few as 10 CFU bacterial cells. The establishment of the specific PCR assay provides a useful tool for the identification and diagnosis of fish infection with S. iniae.

Polymerase chain reaction (PCR) provides a foundation for simple sequence repeat molecular marker-assisted selection (SSR MAS) in soybean. This PCR system and its various conditions have been optimized by many researchers. However, current research on the optimization of the PCR system focuses on double-primer PCR products. We compared single- and double-SSR primer PCR products from 50 soybean samples and found that the use of single-PCR primers in the reaction system can lead to amplified fragments of portions of the SSR primers in the PCR process, resulting in both false-positives and fragment impurity of double-primer PCR amplification, inconvenient for subsequent analysis. We used "single-primer PCR correction" to eliminate interference caused by single-primer nonspecific PCR amplification and improve PCR quality. Using this method, the precision and success rates of SSR MAS in soybean can be increased.

The polymerase chain reaction (PCR)-based genome walking method has been extensively used to isolate unknown flanking sequences, whereas nonspecific products are always inevitable. To resolve these problems, we developed a new strategy to isolate the unknown flanking sequences by combining A-T linker adapter PCR with inverse PCR (I–PCR) or thermal asymmetric interlaced PCR (TAIL–PCR). The result showed that this method can be efficiently achieved with the flanking sequence from the Arabidopsis mutant and papain gene. Our study provides researchers with an additional method for determining genomic DNA flanking sequences to identify the target band from bulk of bands and to eliminate the cloning step for sequencing.

We describe a set of novel primers for successful amplification of the complete mitochondrial cytochrome b (cyt b) gene of ungulate species. DNA extracted from non-invasively obtained and decomposed samples is found to be degraded and inappropriate for amplification of the complete gene (more than 1 kb) in single PCR amplification. We developed a series of six ungulate-specific conserved primers for the cyt b gene. These primers, in various combinations, amplify 366–1,266 bp fragments. We also used them in multiplex PCR reaction to assess the maximum possible size of the PCR amplification product.

There are two approaches in detection of bacterium Erwinia amylovora by PCR. One is based on detection of plasmid pEA29 and the other is based on detection of a chromosomal DNA sequence, specific for E. amylovora, in a sample. Since pathogenic strains without pEA29 have been isolated from the environment, methods based on this plasmid have been compromised and PCR methods based on chromosomal DNA species specific sequences became only reliable methods. PCR method with chromosomal primers FER1-F and FER1-R is currently the most reliable method due to its high sensitivity and specificity. The goal of this research is to make a significant improvement of the method by optimization of PCR in application of hot start DNA Taq polymerase, instead of wax, to obtain a hot start reaction. This enzyme, which is currently widely applied, can provide simpler achievement of hot start, saving labor and time and decreasing possibility of cross contamination of samples. Experiments showed that simple replacement of a regular recombinant Taq DNA polymerase by a hot start Taq DNA polymerase leads to complete failure of the reaction. Many optimization experiments had to be carried out to obtain an operational and reliable PCR which simultaneously has high sensitivity and specificity. Content of the reaction mixture, as well as temperature and time parameters of PCR, were significantly changed to achieve proper optimization.

The purpose of this study was to develop species-specific PCR primers for detection of Fusobacterium periodonticum. The specificity data showed that two sets of PCR primers, Fp-F3/Fp-R2 and Fp-F1/Fp-R2 PCR, produced amplicons from all the F. periodonticum, but not from the other species tested, which included 12 Fusobacterium species or subspecies and representative oral bacteria. The sensitivity of the primer sets was 4 or 40 pg of the chromosomal DNA from F. periodonticum ATCC 33693(T) . These results suggest that these two sets of PCR primers are quite sensitive in detection of F. periodonticum in molecular epidemiological studies of periodontitis.

Summary A real time PCR assay was developed for the detection of Chalara fraxinea in common ash. PCR primers and Taqman probes, based on the internal transcribed spacer region of the multi-copy gene rDNA, were tested for specificity and sensitivity. The primers amplified an 81 bp fragment for C. fraxinea but did not amplify DNA from other Chalara species or from other fungi isolated from ash, whether pathogenic or saprophytic. The limit of detection was 5 pg of genomic DNA per PCR. Moreover, naturally-infected samples were correctly diagnosed. A procedure for DNA extraction from woody tissues using an electric drill yielded DNA of an appropriate quality for real time PCR. This molecular method could be useful for routine analysis of this emergent pathogen and for epidemiological studies.

Phytoplankton are primary producers and can be important indicators of environmental change. To monitor the plankton species composition of environmental seawater samples, we developed a molecular method composed of colony polymerase chain reaction (PCR), polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP), and sequencing. A clone library of the ribosomal small subunit RNA gene (18S rDNA) in the nuclear genome was constructed by environmental PCR using a newly designed primer set and clones were directly amplified by colony PCR. To select unique putative clones, we choose a PCR-RFLP method that employed two restriction enzymes (MseI and Tsp509I). After the PCR-RFLP pattern was evaluated, selected clones were sequenced and analyzed. In this study, we revealed the hidden biodiversity in environmental seawater containing a wide range of taxonomic groups in the Alveolata (Ciliphora and Dinophyceae), Euglenozoa, Stramenopiles (Bacillariophyta), and Viridiplantae (Chlorophyta) without the need to conduct extensive colony isolation techniques. Moreover, we found species of fungi and Metazoa (Arthropoda, Annelida, and Mollusca). Therefore, this improved molecular method can be used to generate a robust database describing the species diversity of environmental samples and provide useful information regarding the dynamics of the eukaryotic plankton community structure.

Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.