Search

Background In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. Methods The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. Results The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. Conclusion With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

Objective: There are a lot of disagreements in the studies on hepatitis B virus (HBV) DNA polymerase mutation rate associated with nucleos(t)ide analogues (NAs) in treatment-naive chronic hepatitis B (CHB) patients. This is the first study aimed to investigate the prevalence of spontaneous HBV resistance mutations in Central China. Methods: This study included treatment-naive patients with CHB from June 2012 to May 2015 receiving care at the Institute of Liver Disease in Central China. All patients completed a questionnaire covering different aspects, such as family medical history, course of liver disease, medication history, alcohol use, among others. Mutations in HBV DNA polymerase associated with NAs resistance were detected using INNO-LiPA assay. Results: 269 patients were infected with HBV genotype B (81.4%), C (17.9%), and both B and C (0.7%). Mutations in HBV DNA polymerase were detected in 24 patients (8.9%) including rtM204I/V (n = 6), rtN236T (n = 5), rtM250V (n = 2), rtL180M (n = 2), rtT184G (n = 1), rtM207I (n = 1), rtS202I (n = 1), rtM204V/I & rtL180M (n = 5), and rtM204I & rtM250V (n = 1). Conclusion: Spontaneous HBV resistance mutations in HBV DNA polymerase were found in treatment-naive patients with CHB in Central China. These findings suggest that we should analyze HBV DNA polymerase resistance mutation associated with NAs before giving antiviral therapy such as lamivudine (LAM), adefovir (ADV), and telbivudine (LdT). Keywords: Hepatitis B virus, Chronic hepatitis B, Viral resistance mutations

Persistent infection with high-risk HPV, particularly Type HPV 16 and 18, is necessary in the development of cervical cancer, but apart from HPV infection, other causative factors of most cervical cancers remain unknown. The aim of this study was to determine the prevalence of HPV 16 and HPV 18 and HSV 1 and HSV 2 in cervical samples, and to assess the role of HSVs in cervical carcinogenesis. Two hundred thirty-three healthy controls and 567 cases (333 of cervicitis, 210 of cervical intraepithelial neoplasia, and 24 of squamous cell carcinoma) in cervical exfoliative cells were tested for HPV 16, HPV 18, HSV 1, and HSV 2 DNA using the triplex real-time polymerase chain reaction method. In contrast to healthy women, positive rate of HPV is related significantly to cervical lesions (odds ratios (ORs) = 4.1, P0.01 for cervical intraepithelial neoplasia; ORs = 24.9, P0.01 for squamous cell carcinoma), but not cervicitis (ORs = 2.3, P0.05). HSV 2 prevalence in cervical intraepithelial neoplasia and squamous cell carcinoma was higher than in healthy women (ORs = 4.9, P0.05 for cervical intraepithelial neoplasia; ORs = 4.7, P0.05 for squamous cell carcinoma). HSV 2 coinfection with HPV in cervical intraepithelial neoplasia and squamous cell carcinoma was strongly higher than in healthy women (ORs = 34.2, P0.01 for cervical intraepithelial neoplasia; ORs = 61.1, P0.01 for squamous cell carcinoma). The obtained results indicated that the presence of HPV is associated closely with cervical cancer, and that HSV 2 infection or co-infection with HPV might be involved in cervical cancer development, while HSV 1 might not be involved.

Schistosomiasis is a major infectious disease and a public health concern in many areas in China and other countries. Sensitive method for detection of the parasite is critical for early diagnosis and for monitoring of effective treatment of the disease. In this study, we developed a highly sensitive TaqMan real-time PCR assay for the detection of Schistosoma japonicum DNA in mouse feces and serum samples. This assay was based on the DNA sequence of the S. japonicum 18S rRNA gene and was able to detect 10 fg of S. japonicum genomic DNA, which is 100 times more sensitive than conventional PCR. We were able to detect the S. japonicum DNA one week post-infection in mouse sera and 4 weeks post-infection in feces, which was one week earlier than egg detection by microscopy in feces. This assay was also highly specific for Asian Schistosomes which are causative species of human Schistosomiasis. In single sex male cercariae infected mice, parasite DNA was only detected in the first 4 weeks post-infection, suggesting that the DNA was derived from decaying worms’ corpse in the first 4 weeks whereas the DNA was mainly from decaying parasite eggs afterwards. Therefore we conclude that the established TaqMan real-time PCR assay is a sensitive, specific and convenient method that could be used for the early diagnostic evaluation of S. japonicum infection in humans and for monitoring outbreaks in endemic areas with low prevalence.