Search

Hypohidrotic ectodermal dysplasia (HED) is a rare genetic disorder caused by mutational inactivation of a developmental pathway responsible for generation of tissues of ectodermal origin. The X-linked form accounts for the majority of HED cases and is caused by Ectodysplasin (EDA) pathogenic variants. We performed a combined analysis of 29 X-linked hypohidrotic ectodermal dysplasia (XLHED) families (including 12 from our previous studies). In addition to the classical triad of symptoms including loss (or reduction) of ectodermal structures, such as hair, teeth, and sweat glands, we detected additional HED-related clinical features including facial dysmorphism and hyperpigmentation in several patients. Interestingly, global developmental delay was identified as an unusual clinical symptom in many patients. More importantly, we identified 22 causal pathogenic variants that included 15 missense, four small in-dels, and one nonsense, splice site, and large deletion each. Interestingly, we detected 12 unique (India-specific) pathogenic variants. Of the 29 XLHED families analyzed, 11 (38%) harbored pathogenic variant localized to the furin cleavage site. A comparison with HGMD revealed significant differences in the frequency of missense pathogenic variants; involvement of specific exons and/or protein domains and transition/transversion ratios. A significantly higher proportion of missense pathogenic variants (33%) localized to the EDA furin cleavage when compared to HGMD (7%), of which p.R155C, p.R156C, and p.R156H were detected in three families each. Therefore, the first comprehensive analysis of XLHED from India has revealed several unique features including unusual clinical symptoms and high frequency of furin cleavage site pathogenic variants.

X-linked hypohidrotic dysplasia (XLHED), caused by mutations in the EDA gene, is a rare genetic disease that affects the development and function of the teeth, hair, nails, and sweat glands. The structural and functional consequences of caused by an ectodysplasin-A (EDA) mutations on protein phenotype, stability, and posttranslational modifications (PTMs) have not been well investigated. The present investigation involves five missense mutations that cause XLHED (L56P, R155C, P220L, V251M, and V322A) in different domains of EDA (TM, furin, collagen, and tumor necrosis factor [TNF]) from previously published papers. The deleterious nature of EDA mutant variants was identified using several computational algorithm tools. The point mutations induce major drifts in the structural flexibility of EDA mutant variants and have a negative impact on their stability, according to the 3D protein modeling tool assay. Using the molecular docking technique, EDA/EDA variants were docked to 10 EDA interacting partners, retrieved from the STRING database. We found a novel biomarker CD68 by molecular docking analysis, suggesting all five EDA variants had lower affinity for EDAR, EDA2R, and CD68, implying that they would affect embryonic signaling between the ectodermal and mesodermal cell layers. In silico research such as gene ontology, subcellular localization, protein-protein interaction, and PTMs investigations indicates major functional alterations would occur in EDA variants. According to molecular simulations, EDA variants influence the structural conformation, compactness, stiffness, and function of the EDA protein. Further studies on cell line and animal models might be useful in determining their specific roles in functional annotations.

Hypohidrotic ectodermal dysplasia (HED) is a genetic disorder characterized by hypohidrosis, hypodontia, and hypotrichosis. Autosomal forms of the disease are caused by mutations in either EDAR or EDARADD. To date, the underlying pathomechanisms for HED resulting from EDARADD mutations have not fully been disclosed. In this study, we performed detailed in vitro analyses in order to characterize three dominantly inherited missense mutations, p.D120Y, p.L122R, and p.D123N, and one recessively inherited missense mutation, p.E152K, in the EDARADD gene. Nuclear factor (NF)-κB reporter assays demonstrated that all the mutant EDARADD showed reduction in activation of NF-κB. Importantly, p.D120Y-, p.L122R-, and p.D123N-mutant EDARADD slightly reduced the NF-κB activity induced by wild-type EDARADD in a dominant negative manner. Co-immunoprecipitation assays showed that all of the mutant EDARADD were capable of binding to EDAR and wild-type EDARADD. Additional co-immunoprecipitation assays revealed that p.D120Y-, p.L122R-, and p.D123N-mutant EDARADD markedly prevented the interaction between EDAR and wild-type EDARADD, which further indicated a dominant negative effect by these mutations. Finally, we found that p.D120Y-, p.L122R-, and p.D123N-mutant EDARADD completely lost the ability to bind with TRAF6, while p.E152K-mutant EDARADD showed a mild reduction in the affinity. Our findings will provide crucial information toward unraveling the molecular mechanisms how EDARADD gene mutations cause the disease.

BackgroundHypohidrotic Ectodermal Dysplasia (HED) is a genetic disorder which affects structures of ectodermal origin. X-linked hypohidrotic ectodermal dysplasia (XLHED) is the most common form of disease. XLHED is characterized by hypotrichosis, hypohydrosis and hypodontia. The cardinal features of classic HED become obvious during childhood.Identification of a hemizygous EDA pathogenic variant in an affected male confirms the diagnosis.Case presentationWe report on a male newborn with the main clinical characteristics of the X-linked HED including hypotrichosis, hypodontia and hypohidrosis. Gene panel sequencing identified a new hemizygous missense variant of uncertain significance (VUS) c.1142G > C (p.Gly381Ala) in the EDA gene, located on the X chromosome and inherited from the healthy mother.ConclusionDespite the potential functional impact of VUS remains uncharacterized, our goal is to evaluate the clinical potential consequences of missense VUS on EDA gene. Even if the proband’s phenotype is characteristic for classic HED, further reports of patients with same clinical phenotype and the same genomic variant are needed to consider this novel VUS as responsible for the development of HED.

The objective of this study was to review the published literature on X-linked hypohidrotic ectodermal dysplasia (XLHED) for the prevalence and characteristics of three features of XLHED: hypodontia, hypohidrosis, and hypotrichosis. A systematic search of English-language articles was conducted in May 2019 to identify publications with information on any of the three features of XLHED. We excluded studies with five or fewer participants, that did not specify X-linked inheritance or an EDA mutation, and discussed only management of features. The weighted means for total missing teeth, location of missing teeth, prevalence of reduced and absent sweating ability, and sparse or absent hair were analyzed across all studies. Additional findings for hypodontia, hypohidrosis, and hypotrichosis were summarized qualitatively. Twenty publications (18 studies) were accepted. Reported findings for males tended to be more informative than for carrier females. The weighted mean for missing teeth for affected males was 22.4 (range: 10-28) and carrier females was 3.4 (range: 0-22). The most common conserved teeth for males were the canines. The most common missing teeth for females were the maxillary lateral incisors. The weighted mean prevalence of reduced or absent sweating ability was 95.7% for males and 71.6% for females. The weighted mean prevalence for hypotrichosis was 88.1% for males and 61.6% for females. This systematic review provides insight into the prevalence, characteristics, and variability of the three classic features of XLHED. These findings provide detailed natural history information for families with XLHED as well as key characteristics that can aid in diagnosis.

Background Hypohidrotic ectodermal dysplasia (HED) is mainly caused by ectodysplasin A (EDA) gene mutation. Fetus with genetic deficiency of EDA can be prenatally corrected. This study aimed at revealing the pathogenesis of two HED families and making a prenatal diagnosis for one pregnant female carrier. Designs Genomic DNA was extracted from two HED patients and sequenced using whole exome sequencing (WES). The detected mutations were confirmed in patients and family members using Sanger sequencing. The expression of soluble ectodysplasin A1 (EDA1) protein was studied by western blot. The transcriptional activity of NF‐κB pathway was tested by dual luciferase assay. The genomic DNA of fetus was extracted from shed chorion cells and EDA gene was screened through Sanger sequencing. Results We identified two novel EDA mutations: c.1136T>C (p.Phe379Ser) and c.[866G>C;868A>T] (p.[Arg289Pro;Ser290Cys]). Further examinations revealed that these two mutated EDA1 proteins showed completely impaired solubility, and the transcriptional NF‐κB activation induced by these missense mutant‐type EDA1 proteins was significantly reduced compared with wild‐type EDA1. Furthermore, the analysis of amniotic fluid samples from a pregnant heterozygote indicated that the fetus was a c.1136T>C mutation female carrier. Conclusions This study extended the mutation spectrum of X‐linked hypohidrotic ectodermal dysplasia (XLHED) and applied prenatal diagnosis for the pregnant carrier, which can be helpful in genetic counseling, prenatal diagnosis, and intervention for the XLHED family., The study identified two novel EDA gene mutations by whole exome sequencing and made a prenatal diagnosis for a pregnant female carrier.

Background Ectodermal dysplasia is a rare genetic disorder that affects ectodermally derived structures, including teeth, nails, hair, and sweat glands. Hypohidrotic ectodermal dysplasia is the most common type, with oligodontia being the most striking dental feature. Prosthetic rehabilitation in children with ectodermal dysplasia is an important step toward improving their overall quality of life. The fixed prosthesis has the advantages of being more stable in the mouth with good child compliance and a good aesthetic outcome. Case presentation Our patient was a 5-year-old Middle Eastern boy with oligodontia caused by ectodermal dysplasia. He was managed by fabrication of an upper functional space maintainer and a lower fixed partial denture to restore occlusion, masticatory function, aesthetics, and overall quality of life. Conclusions The use of the fixed prosthesis in children is a new and evolving treatment modality that resolves many of the issues caused by removable prostheses. It accommodates jaw growth in the mandible, reduces the need to remake the prosthesis, and has an overall better aesthetic outcome.

Purpose Ectodermal dysplasias are characterized by developmental abnormalities in ectodermal structures. Hypohidrotic ectodermal dysplasias (HED) are the most common subtype. They are most commonly inherited via X-linked recessive routes. We report on a novel ectodysplasin-A (EDA) mutation that is expected to be involved in pathogenesis of HED. Methods Hypohidrotic ectodermal dysplasia genes, including EDA, EDAR and EDARADD, were analyzed using next-generation sequencing (NGS). The detected mutation on the EDA gene was confirmed in the patient and his mother using Sanger sequencing. Results The patient presented with adontia, absence of gum development, hyperthermia and hypohidrosis. Our genetic analysis of the patient revealed a novel frameshift hemizygous mutation (c.898_924 + 8del35ins4CTTA) on the EDA gene. The patient’s mother showed a mild HED phenotype. Direct sequencing of the EDA gene in the region where her son had the mutation showed the same mutation in a heterozygous state. Conclusion We identified a novel frameshift mutation in the EDA gene in an Iranian patient affected by X-linked HED. The difference between our patient’s symptoms and those recorded for some previous subjects may be due to the differences in the mutations involved. Electronic supplementary material The online version of this article (10.1186/s11658-019-0174-9) contains supplementary material, which is available to authorized users.

Hypohidrotic ectodermal dysplasia (HED) is a rare genetic disorder characterized by hypotrichosis, hypohidrosis and hypodontia. The disease shows X-linked recessive, autosomal dominant or autosomal recessive inheritance traits. The X-linked form of HED is caused by mutations in the EDA gene, while autosomal forms result from mutations in either EDAR or EDARADD genes. Regarding recessive mutations in the EDAR gene, the pathomechanisms have been well characterized. However, it has remained largely unknown how dominant mutations in the EDAR cause HED. In this study, we performed in vitro analyses for a dominant EDAR gene mutation, p.F398*, as a representative. We showed that the p.F398* mutant EDAR completely lost its affinity to EDARADD, and suppressed the downstream nuclear factor-κB activation induced by wild-type EDAR in a dominant-negative manner. Furthermore, we demonstrated that the mutant EDAR was capable of binding with the wild-type EDAR, which led to reduced interaction between the wild-type EDAR and EDARADD. Our findings not only underscore an essential role of the interaction between EDAR and EDARADD in ectodermal development, but also disclose, in part, the molecular basis of autosomal dominant HED.

In mice, rats, dogs and humans the growth and function of sebaceous glands and eyelid Meibomian glands depend on the ectodysplasin signalling pathway. Mutation of genes encoding the ligand EDA, its transmembrane receptor EDAR, and the intracellular signal transducer EDARADD leads to Hypohidrotic Ectodermal Dysplasia characterised by impaired development of teeth and hair as well as cutaneous glands. The rodent ear canal has a large auditory sebaceous gland, the Zymbal’s gland, whose function in the health of the ear canal and tympanic membrane has not been determined. We report that the EDA deficient Tabby (EdaTa) mouse, the EDAR deficient mouse (EdarOVE1B/OVE1B) and the EDARADD deficient sparse and wavy hair rat (Edaraddswh/swh) have Zymbal’s gland hypoplasia. EdaTa mice also have ear canal hypotrichosis and a 25% prevalence of otitis externa at P21. Treatment with agonist anti-EDAR antibodies rescues Zymbal’s glands and ear canal pilosebaceous units. The aetiopathogenesis of otitis externa involves infection with Gram-positive cocci and dosing pregnant and lactating EdaTa females and pups with Enrofloxacin reduces the prevalence of otitis externa. We infer the deficit of sebum is the principal factor in predisposition to bacterial infection and the EdaTa mouse is a potentially useful microbial challenge model for human acute otitis externa, commonly known as swimmer’s ear.

Background Hypohidrotic ectodermal dysplasia (HED) is a group of genodermatoses in which deficient ectodysplasin A signalling leads to maldevelopment of skin appendages, various eccrine glands, and teeth. Individuals with HED often have disrupted epithelial barriers and, therefore, were suspected to be more susceptible to coronavirus infection. Methods 56 households with at least one member who had coronavirus disease of 2019 (COVID-19) were enrolled in a longitudinal study to compare the course of illness, immune responses, and long-term consequences of severe acute respiratory syndrome-coronavirus 2 (SARS-CoV-2) infection in HED patients (n = 15, age 9–52 years) and control subjects of the same age group (n = 149). Results In 14 HED patients, mild or moderate typical COVID-19 symptoms were observed that lasted for 4–45 days. Fever during the first days sometimes required external cooling measures. The course of COVID-19 was similar to that in control subjects if patients developed antibodies blocking the SARS-CoV-2 spike protein. Five out of six HED patients with completely abrogated ectodysplasin A signalling (83%) suffered from chronic, in two cases very severe fatigue following COVID-19, while only 25% of HED patients with residual activity of this pathway and 21% of control subjects recovering from COVID-19 experienced postinfectious fatigue. Hair loss after COVID-19 was also more frequent among HED patients (64%) than in the control group (13%). Conclusions HED appears to be associated with an increased risk of long-term consequences of a SARS-CoV-2 infection. Preventive vaccination against COVID-19 should be recommended for individuals affected by this rare genetic disorder. Supplementary Information The online version contains supplementary material available at 10.1186/s13023-021-02011-z.

A 17-month old boy was referred to the genetic clinic in view of anodontia, hypohidrosis, scalp hypotrichosis, atrichia of the eyelashes, xerotic skin and a short columella. A diagnosis of X-Linked hypohidrotic ectodermal dysplasia (XLHED) was considered. The boy was born to healthy non-consanguineous parents of Maltese-Caucasian ethnicity at 38 weeks by emergency lower segment Caesarean section in view of fetal decelerations in the setting of documented intrauterine growth restriction (birth weight was 2.49kg [2.5th centile for age]). The genetic family history of the patient was unremarkable.

Introduction Hypohidrotic ectodermal dysplasia (HED) is a genetic condition typified by alterations in skin structures including sweat glands, hair, nails, and teeth. Hair findings in HED have been poorly characterized in larger series. Objective To characterize scalp and hair findings of patients with HED clinically and with trichoscopy and light microscopy. Methods A cross-sectional study in 21 pediatric HED patients was performed using available clinical and scalp dermatoscopic images, as well as pulled-hair samples for clinical evaluation, trichoscopic, and light microscopic analyses. Results Seventeen out of 21 patients (81%) were men. Twenty patients had straight hair. Sixteen patients had decreased hair density, 6 of whom had hair loss mainly in the temporal and occipital regions. Fourteen patients had hair whorls. On trichoscopy, we observed: single-hair follicular units (n = 19, 90%), scalp hyperpigmentation (n = 13, 62%), variable diameter of the hair shafts (n = 12, 57%), perifollicular scales (n = 8, 38%), scalp erythema (n = 8, 38%), and short curly pigtail hairs (n = 6, 29%). On light microscopy, findings included: hair shafts with irregular diameter (n = 7, 33%), heterogeneous hair color (n = 6, 29%), trichoptilosis (n = 2, 10%), and pili torti (n = 1, 5%). Conclusions In this series, hair findings in HED were similar to those described in previous studies. However, we describe two new clinical and two trichoscopic findings: decreased hair density mainly in the temporal and occipital regions, oblique upwards occipital hair follicles orientation, angled hairs, and short curly pigtail hairs. These heterogeneous findings may reflect the multiple factors and signaling pathways that can be affected in these syndromes.

A mutation in the epithelial morphogen gene ectodysplasin-A1 (EDA1) is responsible for the disorder X-linked hypohidrotic ectodermal dysplasia (XLHED), the most common form of ectodermal dysplasia. XLHED is characterized by impaired development of hair, eccrine sweat glands, and teeth. This study aimed to identify potentially pathogenic mutations in four Chinese XLHED families. Genomic DNA was extracted from the peripheral blood and sequenced. Sanger sequencing was used to carry out mutational analysis of the EDA1 gene, and the three-dimensional structure of the novel mutant residues in the EDA trimer was determined. Transcriptional activity of NF-κB was tested by Dual luciferin assay. We identified a novel EDA1 mutation (c.1046C>T) and detected 3 other previously-reported mutations (c.146T>A; c.457C>T; c.467G>A). Our findings demonstrated that novel mutation c.1046C>T (p.A349 V) resulted in XLHED. The novel mutation could cause volume repulsion in the protein due to enlargement of the amino acid side chain. Dual luciferase assay revealed that transcriptional NF-κB activation induced by XLHED EDA1 protein was significantly reduced compared with wild-type EDA1. These results extend the spectrum of EDA1 mutations in XLHED patients and suggest a functional role of the novel mutation in XLHED.

Background X-linked hypohidrotic ectodermal dysplasia (XLHED) is caused by pathogenic variants of the gene EDA disrupting the prenatal development of ectodermal derivatives. Cardinal symptoms are hypotrichosis, lack of teeth, and hypo- or anhidrosis, but the disease may also evoke other clinical problems. This study aimed at investigating the clinical course of XLHED in early childhood as the basis for an evaluation of the efficacy of potential treatments. Methods 25 children (19 boys and 6 girls between 11 and 35 months of age) with genetically confirmed XLHED were enrolled in a long-term natural history study. Clinical data were collected both retrospectively using parent questionnaires and medical records (pregnancy, birth, infancy) and prospectively until the age of 60 months. General development, dentition, sweating ability, ocular, respiratory, and skin involvement were assessed by standardized clinical examination and yearly quantitative surveys. Results All male subjects suffered from persistent anhidrosis and heat intolerance, although a few sweat ducts were detected in some patients. Sweating ability of girls with XLHED ranged from strongly reduced to almost normal. In the male subjects, 1–12 deciduous teeth erupted and 0–8 tooth germs of the permanent dentition became detectable. Tooth numbers were higher but variable in the female group. Most affected boys had no more than three if any Meibomian glands per eyelid, most girls had fewer than 10. Many male subjects developed additional, sometimes severe health issues, such as obstructive airway conditions, chronic eczema, or dry eye disease. Adverse events included various XLHED-related infections, unexplained fever, allergic reactions, and retardation of psychomotor development. Conclusions This first comprehensive study of the course of XLHED confirmed the early involvement of multiple organs, pointing to the need of early therapeutic intervention.

X-linked hypohidrotic ectodermal dysplasia (XLHED) is a genetic disease characterized by hypoplasia or absence of hair, teeth and sweat glands. The EDA gene, located on the X chromosome, encodes the type II transmembrane protein ectodysplasin A. Variants in the EDA gene can lead to XLHED in humans, mice, cattle and dogs. In the present study, we investigated a litter of Dachshund puppies, of which four male puppies showed clinical signs of XLHED. We performed a candidate gene analysis in one affected puppy and several non-affected relatives. This analysis revealed a single base-pair deletion in the coding sequence of the EDA gene in the affected puppy (NM_001014770.2:c.842delT). The deletion is predicted to cause a frameshift, NP_001014770.1:p.(Leu281HisfsTer22), leading to a premature stop codon which truncates more than one quarter of the EDA protein. Sanger sequencing results confirmed that this variant was inherited from the dam. Based on knowledge about the functional impact of EDA variants in dogs and other species, c.842delT is a convincing candidate causative variant for the observed XLHED in the male puppies.

Background Ectodermal dysplasias (ED) are a group of genetic conditions affecting the development and/or homeostasis of two or more ectodermal derivatives. An attenuated phenotype is considered a non-syndromic trait when the patient is affected by only one impaired ectodermal structure, such as in non-syndromic tooth agenesis (NSTA) disorder. Hypohidrotic ectodermal dysplasia (HED) is the most highly represented ED. X-linked hypohidrotic ectodermal dysplasia (XLHED) is the most common subtype, with an incidence of 1/50,000–100,000 males, and is associated with the EDA gene (Xq12-q13.1); the dominant and recessive subtypes involve the EDAR (2q13) and EDARADD (1q42.3) genes, respectively. The WNT10A gene (2q35) is associated more frequently with NSTA. Our goal was to determine the mutational spectrum in a cohort of 72 Spanish patients affected by one or more ectodermal derivative impairments referred to as HED (63/72) or NSTA (9 /72) to establish the prevalence of the allelic variants of the four most frequently associated genes. Sanger sequencing of the EDA, EDAR, EDARADD and WNT10A genes and multiplex ligation-dependent probe amplification (MLPA) were performed. Results A total of 61 children and 11 adults, comprising 50 males and 22 females, were included. The average ages were 5.4 and 40.2 years for children and adults, respectively. A molecular basis was identified in 51/72 patients, including 47/63 HED patients, for whom EDA was the most frequently involved gene, and 4/9 NSTA patients, most of whom had variants of WNT10A. Among all the patients, 37/51 had variants of EDA, 8/51 had variants of the WNT10A gene, 4/51 had variants of EDAR and 5/51 had variants of EDARADD. In 42/51 of cases, the variants were inherited according to an X-linked pattern (27/42), with the remaining showing an autosomal dominant (10/42) or autosomal recessive (5/42) pattern. Among the NSTA patients, 3/9 carried pathogenic variants of WNT10A and 1/9 carried EDA variants. A total of 60 variants were detected in 51 patients, 46 of which were different, and out of these 46 variants, 12 were novel. Conclusions This is the only molecular study conducted to date in the Spanish population affected by ED. The EDA, EDAR, EDARADD and WNT10A genes constitute the molecular basis in 70.8% of patients with a 74.6% yield in HED and 44.4% in NSTA. Twelve novel variants were identified. The WNT10A gene has been confirmed as the second molecular candidate that has been identified and accounts for one-half of non-EDA patients and one-third of NSTA patients. Further studies using next generation sequencing (NGS) will help to identify other contributory genes in the remaining uncharacterized Spanish patients.

AIM: Morphological deviations in the upper cervical spine and craniofacial morphology in patients with X-linked hypohidrotic ectodermal dysplasia (XLHED) were compared to non-syndromic controls.METHODS: All children and adolescents with genetically verified XLHED, registered at the Resource Centres for Oral Health in Rare Diseases, who met the inclusion criteria, were included. The group thus comprised 15 XLHED patients (3 girls and 12 boys, aged 8-16 years, mean 11.2 years). The control group comprised 22 non-syndromic pre-orthodontic children (14 girls and 8 boys aged 9-16 years, mean 11.9 years) with agenesis of one tooth, neutral occlusion and normal craniofacial morphology. The craniofacial and upper spine morphology was analysed on lateral cephalograms by standard methods. Differences between XLHED patients and controls were tested and adjusted for age and gender by multiple regression analyses.RESULTS: Morphological deviations in the upper spine occur significantly more often in XLHED patients compared to controls (60 vs. 9.1%; p CONCLUSIONS: The upper spine and the craniofacial morphology were different in XLHED patients compared to controls. The results of this study may contribute to a further understanding of the craniofacial and spinal phenotypic spectrum in patients with XLHED and thus have implications for diagnosis and treatment planning of these patients.

Mutations in the ectodysplasin A gene ( EDA) cause X-LHED (X-linked hypohidrotic ectodermal dysplasia), the most common human form of ectodermal dysplasia. Defective EDA signaling is linked to hypoplastic development of epithelial tissues, resulting in hypotrichosis, hypodontia, hypohidrosis, and xerostomia. The primary objective of the present study was to better understand the salivary gland dysfunction associated with ectodermal dysplasia using the analogous murine disorder. The salivary flow rate and ion composition of the 3 major salivary glands were determined in adult Eda-deficient Tabby hemizygous male (Ta/Y) and heterozygous female (Ta/X) mice. Submandibular and sublingual glands of Eda-mutant mice were smaller than wild-type littermates, while parotid gland weight was not significantly altered. Fluid secretion by the 3 major salivary glands was essentially unchanged, but the decrease in submandibular gland size was associated with a dramatic loss of ducts in Ta/Y and Ta/X mice. Reabsorption of Na+ and Cl–, previously linked in salivary glands to Scnn1 Na+ channels and Cftr Cl- channels, respectively, was markedly reduced at high flow rates in the ex vivo submandibular glands of Ta/Y mice (~60%) and, to a lesser extent, Ta/X mice (Na+ by 14%). Consistent with decreased Na+ reabsorption in Ta/Y mice, quantitative polymerase chain reaction analysis detected decreased mRNA expression for Scnn1b and Scnn1g, genes encoding the β and γ subunits, respectively. Moreover, the Na+ channel blocker amiloride significantly inhibited Na+ and Cl– reabsorption by wild-type male submandibular glands to levels comparable to those observed in Ta/Y mice. In summary, fluid secretion was intact in the salivary glands of Eda-deficient mice but displayed marked Na+ and Cl– reabsorption defects that correlated with the loss of duct cells and decreased Scnn1 Na+ channel expression. These results provide a likely mechanism for the elevated NaCl concentration observed in the saliva of affected male and female patients with X-LHED.

Hypohidrotic ectodermal dysplasia (HED) is characterized by hypohidrosis, hypodontia, sparse hair, and characteristic facial features. This condition is caused by an ectodysplasin A (EDA) gene mutation. In this study, we examined two HED pedigrees and investigated the molecular genetics of the defect. Direct sequencing analysis revealed a previously unidentified mutation in the EDA splice donor site (c.526 + 1G>A). The function of the mutant EDA gene was predicted through online investigations and subsequently confirmed by splicing analysis in vitro. The mutation resulted in the production of a truncated EDA-A1 protein caused by complete omission of exon 3. This novel functional skipping-splicing EDA mutation was considered to be the cause of HED in the two pedigrees reported here. Our findings, combined with those reported elsewhere, provide an improved understanding of the pathogenic mechanism of HED as well as important information for a genetic diagnosis.

Hypohidrotic ectodermal dysplasia (HED) comprises a large group of inherited disorders of ectodermal structures, characterised by hypo- or anhidrosis, hypotrichosis and hypo- or oligo- or anodontia. We aimed to systematically assess the spectrum of prosthodontic approaches with regard to the patients' age and to provide clinical implications for practicing dentists. An electronic and manual search was conducted in four databases (Medline, LIVIVO, Cochrane Library, Web of Science Core Collection). Publications of multiple study designs written in English or German without data restrictions, reporting on prosthodontic treatment of patients diagnosed with HED and afflicted with oligo- or anodontia, were included. In total, 75 articles on 146 patients were analysed according to the patients' age. In children aged 2-17 years, removable full or partial (over)dentures represented standard treatment. In the mandible, implant-supported removable dentures on two interforaminal implants presented an alternative, already in young childhood. In cases with more than six teeth per jaw, also fixed (resin) bridges were used, frequently after orthodontic treatment. In adults, fixed or removable reconstructions with the help of up to eight implants per jaw, usually placed after bone augmentation procedures, were standard. Ten case reports/series with long-term follow-up illustrated the need for consistent maintenance including denture renewals. Prosthodontic rehabilitation should start in early childhood and needs to be revised in accordance with the patients' growth. Treatment should be carried out by a multidisciplinary team addressing variable demands in different age groups.

X-linked hypohidrotic ectodermal dysplasia (XLHED) is a genetic disorder that affects ectodermal structures and presents with a characteristic facial appearance. The ability of automated facial recognition technology to detect the phenotype from images was assessed . In Phase 1 of this study we examined if the age of male patients affected the technology's recognition. In Phase 2 we investigated how well the technology discriminated affected males cases from female carriers and from individuals with other ectodermal dysplasia syndromes. The system detected XLHED to be the most likely diagnosis in all genetically confirmed affected male patients of all ages, and in 55% of heterozygous females. Interestingly, patients with other ED syndromes were also detected by the XLHED-targeted analysis, consistent with shared developmental features. Thus the automated facial recognition system represents a promising non-invasive technology to screen patients at all ages for a possible diagnosis of ectodermal dysplasia, with greatest sensitivity and specificity for males affected with XLHED.

Hypohidrotic ectodermal dysplasia is a common variation of ectodermal dysplasia, characterized by hypohidrosis (or anhidrosis), hypotrichosis, hypodontia, and other distinct facial features. Furthermore, ocular tissues of ectodermal origin may also be affected in this disease. The most common ocular manifestations of hypohidrotic ectodermal dysplasia are dry eye, madarosis, alterations in the meibomian glands, abnormalities in the nasolacrimal duct, and infantile glaucoma. Herein, author reports a case of hypohidrotic ectodermal dysplasia in a 12-year-old Indian boy with dry eye and lacrimal sac mucocele.

Ectodermal dysplasias are a family of genodermatoses commonly associated with variants in the ectodysplasin/NF-κB or the Wnt/β-catenin pathways. Both pathways are involved in signal transduction from ectoderm to mesenchyme during the development of ectoderm-derived structures. Wnt/β-catenin pathway requires the lymphoid enhancer-binding factor 1 (LEF1), a nuclear mediator, to activate target gene expression. In mice, targeted inactivation of the LEF1 gene results in a complete block of development of multiple ectodermal appendages. We report two unrelated patients with 4q25 de novo deletion encompassing LEF1, associated with severe oligodontia of primary and permanent dentition, hypotrichosis and hypohidrosis compatible with hypohidrotic ectodermal dysplasia. Taurodontism and a particular alveolar bone defect were also observed in both patients. So far, no pathogenic variants or variations involving the LEF1 gene have been reported in human. We provide further evidence for LEF1 haploinsufficiency role in ectodermal dysplasia and delineate its clinical phenotype.

The dental abnormalities are the typical features of many ectodermal dysplasias along with congenital malformations of nails, skin, hair, and sweat glands. However, several reports of non-syndromic/isolated tooth agenesis have also been found in the literature. The characteristic features of hypohidrotic ectodermal dysplasia (HED) comprise of hypodontia/oligodontia, along with hypohidrosis/anhidrosis, and hypotrichosis. Pathogenic variants in EDA, EDAR, EDARADD, and TRAF6, cause the phenotypic expression of HED. Genetic alterations in EDA and WNT10A cause particularly non-syndromic/isolated oligodontia. In the current project, we recruited 57 patients of 17 genetic pedigrees (A-Q) from different geographic regions of the world, including Pakistan, Egypt, Saudi Arabia, and Syria. The molecular investigation of different syndromic and non-syndromic dental conditions, including hypodontia, oligodontia, generalized odontodysplasia, and dental crowding was carried out by using exome and Sanger sequencing. We have identified a novel missense variant (c.311G>A; p.Arg104His) in WNT10A in three oligodontia patients of family A, two novel sequence variants (c.207delinsTT, p.Gly70Trpfs*25 and c.1300T>G; p.Try434Gly) in EDAR in three patients of family B and four patients of family C, respectively. To better understand the structural and functional consequences of missense variants in WNT10A and EDAR on the stability of the proteins, we have performed extensive molecular dynamic (MD) simulations. We have also identified three previously reported pathogenic variants (c.1076T>C; p.Met359Thr), (c.1133C>T; p.Thr378Met) and (c.594_595insC; Gly201Argfs*39) in EDA in family D (four patients), E (two patients) and F (one patient), correspondingly. Presently, our data explain the genetic cause of 18 syndromic and non-syndromic tooth agenesis patients in six autosomal recessive and X-linked pedigrees (A-F), which expand the mutational spectrum of these unique clinical manifestations.

Background: Hypohidrotic ectodermal dysplasia (HED) is a rare congenital disorder arising from the abnormal development of ectoderm derived structures, including skin, hair, nails, teeth and glands. These patients have sparse hair on the whole body, including the scalp, as well as hypoplastic teeth. They have no resistance to heat as a result of abnormal sweat glands. In total, four genes, namely ectodysplasin A (EDA), ectodysplasin A receptor (EDAR), EDAR‐associated death domain protein (EDARADD) and Wnt family member 10A (WNT10A), are known to be involved in the etiology of HED. Methods: In the present study, we investigated two consanguineous Kashmiri families (A &B) with an autosomal recessive form of HED. Using whole exome sequencing and different bioinformatics tools, we detected a recurrent mutation causing severe HED. Results: We identified an already known rare homozygous missense (NM_022336 c.1300 T>C; p.W434R; minor allele frequency 0.00007) variant in exon 12 of the EDAR gene. This variant segregated with a homozygous form in all patients and their obligate carriers were heterozygous. A panel of > 100 unrelated ethnically matched controls was screened, and the mutation was not identified outside the families. Furthermore, the candidate variant is predicted to be damaging by in silico software giving a CADD (Combined Annotation Dependent Depletion) score of 25.5, which indicates that the variant is among the top 1% of the deleterious variants in the human genome. Conclusions: The identification of the same homozygous mutation segregating with disease in two different families supports the important role of the gene in the development of the disorder and this may contribute to novel approaches, prenatal diagnosis and genetic counseling of families with EDAR related disorders. Accepted version

X-linked hypohidrotic ectodermal dysplasia (XLHED) is a genetic disorder characterized by abnormalities in ectodermal derivatives such as sweat glands, hair, and teeth. In animals, the highest number of cases has been reported in dogs, which show characteristic congenital alopecia and develop abnormalities in the shape and number of teeth. Although the clinical phenotype of the affected individuals is typical, this disorder remains almost unknown in veterinary clinical practice. With the aim of making it better known, we gathered in this review the main clinical and genetic aspects of XLHED, placing emphasis on dental abnormalities.

Human epidermal keratinocytes sense the presence of human skin microbiota through pathogen recognition receptors, such as toll-like receptors, and induce innate immune and inflammatory events. In healthy epidermis there is an absence of inflammation despite the continuous presence of cutaneous microbes, which is evidence of an effective immune regulatory mechanism. The aim of this study was to investigate tumour necrosis factor alpha-induced protein 3 (TNFAIP3), a negative regulator of toll-like receptor and nuclear factor kappa B signalling pathways, and its role in these regulatory events. A broad spectrum of toll-like receptor ligands induced TNFAIP3 expression, as did live Cutibacterium acnes, which is involved in the pathogenesis of acne. Changes in bacterium-induced, dose-dependent TNFAIP3 expression were Jun kinase- and nuclear factor kappa B-dependent, and resulted in altered cytokine and chemokine levels in in vitro cultured human keratinocytes. In acne lesions, TNFAIP3 mRNA expression was elevated compared with non-lesional skin samples from the same individuals. These results suggest that TNFAIP3 may have a general role in fine regulation of microbiota-induced cutaneous immune homeostasis.

Objective Mutations in the EDA gene, encoding the epithelial morphogen ectodysplasin-A, can result in different but overlapping phenotypes. Therefore the aim of the study was to search for etiological variations of EDA and other candidate genes in two unrelated Egyptian male children with sporadic non-syndromic tooth agenesis (NTA) and hypohidrotic ectodermal dysplasia (HED). Design Direct sequencing of the coding regions including exon-intron boundaries of EDA, MSX1, PAX9, WNT10A and EDAR was performed in probands and their available family members. Results Two etiological mutations were found in the EDA coding region. The patient with NTA in both deciduous and permanent dentition was a carrier of a novel in-frame deletion situated in the short collagenous domain (c.663-680delTCCTCCTGGTCCTCAAGG, p.222-227delPPGPQG). The second mutation, located outside the minimal furin consensus motif (c.463C>T, p.Arg155Cys, rs132630312), was identified in the patient exhibiting all typical features of HED. The identified EDA mutations were not detected in probands’ family members as well as in 188 unrelated control individuals. No pathogenic variants were found in the MSX1, PAX9, WNT10A and EDAR genes. Conclusion Our results increase the knowledge of the spectrum of EDA mutations and confirm that this gene is an important candidate gene for two developmental diseases sharing the common feature of the congenital lack of teeth. In addition, these results can support the hypothesis that X-linked HED and EDA-related NTA are the same disease with different degrees of severity.

Christ-Siemens-Touraine (CST) is a rare hereditary disorder of X-linked recessive trait, characterized by abnormal development of two or more structures or tissues of ectodermal origin. The common clinical findings include hypodontia, hypohydrosis, hypotrichosis, and onychodysplasia. Although hypodontia is common, anodontia is a rare feature. Most of the patients are suffering from social rejection and consequent psychological trauma because of the facial dysmorphism and absence of multiple teeth. Oral rehabilitation is of prime importance for such patients. This article presents a case in a 5½-year-old boy presenting with altered manifestations affecting almost all the ectodermal structures like skin, hair, nails, teeth, sebaceous glands, sweat glands, salivary glands, mammary glands, and tear glands. He also had complete anodontia and dry mouth. A multidisciplinary treatment was given to the patient with the collaboration of various health professionals. The child gained confidence and was relieved from the psychological impact following the prosthetic rehabilitation.

Hypohidrotic ectodermal dysplasias (HED) constitute a group of genetic disorders that affect ectodermal derivatives such as sweat glands, sebaceous glands, hair, and teeth. The vast majority of cases of HED are caused by a recessive mutation of the EDA gene located in the X chromosome. In these cases, affected individuals are usually male and have alopecia and hypotrichosis with characteristic distribution, in addition to malformed teeth and fewer than normal. From a canine HED isolated case (proband) andc in order to verify if this emerged from a new mutation, it was possible to construct a pedigree with 5 generations and 93 individuals representing an extended and informative family. The proband's mother crossed with 2 different males and generated 33 descendants in 9 gestations: 1 affected male (proband), 15 normal males, and 17 normal females, which together can be considered as 1 sibship. Through Bayesian inference, it was possible to establish that this case originated from a new mutation, with a 99.99% probability of the mother of the proband not being a carrier.

As the most common form of ectodermal dysplasia (ED), X-linked hypohidrotic ED (XLHED) is characterized by the triad of hypohidrosis, hypotrichosis, and anodontia in male patients. The gene responsible for XLHED is EDA. To date, more than 300 mutations have been identified in this gene, including point mutations, deletions, and insertions. Most of the mutations result in XLHED, while the rest cause X-linked dominant incisor hypodontia.Mutation screening was performed in seven Chinese families with XLHED.Mutations were identified in all seven families, including four previously reported missense mutations (p.M1T, p.R156C, p.G299S, and p.A349T) and three novel mutations; missense mutation (p.Q358 L), indel (P228Tfs*52), as well as a large deletion.Our results extend the mutational spectrum of EDA and can be helpful with genetic counseling and prenatal diagnosis for these families.

Objective\ud \ud In X‐linked hypohidrotic ectodermal dysplasia (XLHED), dysfunction of ectodysplasin A1 (EDA1) due to EDA mutations results in malformation of hair, teeth, and sweat glands. Hypohidrosis, which can cause life‐threatening hyperthermia, is amenable to intrauterine therapy with recombinant EDA1. This study aimed at evaluating tooth germ sonography as a noninvasive means to identify affected fetuses in pregnant carrier women. \ud \ud \ud Methods\ud \ud Sonography, performed at 10 study sites between gestational weeks 18 and 28, led to the diagnosis of XLHED if fewer than six tooth germs were detected in mandible or maxilla. The assessment was verified postnatally by EDA sequencing and/or clinical findings. Estimated fetal weights and postnatal weight gain of boys with XLHED were assessed using appropriate growth charts. \ud \ud \ud Results\ud \ud In 19 of 38 sonographic examinations (23 male and 13 female fetuses), XLHED was detected prenatally. The prenatal diagnosis proved to be correct in 37 cases; one affected male fetus was missed. Specificity and positive predictive value were both 100%. Tooth counts obtained by clinical examination corresponded well with findings on panoramic radiographs. We observed no weight deficits of subjects with XLHED in utero but occasionally during infancy.\ud \ud \ud Conclusion\ud \ud Tooth germ sonography is highly specific and reliable in detecting XLHED prenatally.

Background: Hypohidrotic ectodermal dysplasia (HED) is a genetic skin condition presenting as hypohidrosis, hypodontia, and hypotrichosis, resulting in an important burden for affected families. The most common form of HED has an X-linked inheritance and female carriers have the option of prenatal or preimplantation genetic testing (PGT) to avoid transmission of the disease. A combined PGT for a mutation in EDA gene and aneuploidies in a Mexican carrier of X-linked HED is reported. Materials and Methods: Ovarian stimulation and assisted reproduction procedures were performed in a private academic medical center. PGT for a novel c.707-1G>A (rs886039466) mutation in EDA gene and chromosomal aneuploidies was performed by massive parallel and Sanger sequencing. Results: In the first PGT, the transfer of two blastocysts did not result in a pregnancy. An accumulative stimulation approach was decided to improve pregnancy chances for a second PGT procedure. Three ovarian stimulations were performed and 10 blastocysts coming from fresh and vitrified oocytes were genetically analyzed. A single embryo transfer produced a healthy non-carrier euploid girl. Discussion: PGT combining aneuploidy and mutation analyses is an alternative for female carriers of X-linked and other Mendelian disorders in Latin-American countries. In the era of genomic and personalized medicine, medically assisted reproduction techniques, such as PGT, are shifting from only infertility to preventive genetics. (REV INVES CLIN. 2018;70:164-8)

Aim To make a gene diagnosis for a family with Ectodysplasin A (EDA) gene mutation as well as prenatal diagnosis, and report a novel EDA gene mutation. Methods All coding sequences and flanking sequences of EDA gene were analyzed by Sanger sequencing in the proband, and then, according to EDA gene mutation in the proband, the EDA gene sequencing was performed on the family members. Based on the results above, the pathogenic mutation in EDA gene was finally identified, which was used for making prenatal diagnosis. Results Sanger sequencing revealed c.302_303delCC [p.Pro101HisfsX11] mutation in EDA gene of the proband. This mutation induced EDA gene frame shift mutation which led to early termination of EDA gene translation because there was a termination codon TAA at the 11th codon behind the mutational site. Heterozygous deletion mutation (CC/--) at this locus was observed in the proband's mother and proband's grandmother, but the proband's aunt had no mutation at this locus. The analyses of amniotic fluid samples indicated negative sex-determining region on Y (SRY), and c.302_303delCC heterozygous deletion mutation. Conclusion We identified a pathogenetic mutation in EDA gene for the X-linked hypohidrotic ectodermal dysplasia family, made a prenatal diagnosis for the female carrier, and reported a novel EDA gene mutation.

Summary Genetic deficiency of ectodysplasin A (EDA) causes X-linked hypohidrotic ectodermal dysplasia (XLHED), in which the development of sweat glands is irreversibly impaired, an condition that can lead to life-threatening hyperthermia. We observed normal development of mouse fetuses with Eda mutations after they had been exposed in utero to a recombinant protein that includes the receptor-binding domain of EDA. We administered this protein intraamniotically to two affected human twins at gestational weeks 26 and 31 and to a single affected human fetus at gestational week 26; the infants, born in week 33 (twins) and week 39 (singleton), were able to sweat normally, and XLHED-related illness had not developed by 14 to 22 months of age. (Funded by Edimer Pharmaceuticals and others.)

Introduction Hypodontia, hypohidrosis, sparse hair and characteristic faces are the main characters of X-linked hypohidrotic ectodermal dysplasia (XLHED) which is caused by genetic ectodysplasin A (EDA) deficiency. Heterozygous female carriers tend to have mild to moderate XLHED phenotype, even though 30% of them present no obvious symptom. Methods A large Chinese XLHED family was reported and the entire coding region and exon–intron boundaries of EDA gene were sequenced. To elucidate the mechanism for carriers’ tempered phenotype, we analyzed the methylation level on four sites of the promoter of EDA by the pyrosequencing system. Results A known frameshift mutation (c.573–574 insT) was found in this pedigree. Combined with the pedigrees we reported before, 120 samples comprised of 23 carrier females from 11 families and 97 healthy females were analyzed for the methylation state of EDA promoter. Within 95% confidence interval (CI), 18 (78.26%) carriers were hypermethylated at these 4 sites. Conclusion Chinese XLHED carriers often have a hypermethylated EDA promoter.

Objectives X-linked hypohidrotic ectodermal dysplasia (XLHED) is characterized by abnormalities of hair, teeth, and sweat glands, while non-syndromic hypodontia (NSH) affects only teeth. Mutations in Ectodysplasin A (EDA) underlie both XLHED and NSH. This study investigated the genetic causes of six hypohidrotic ectodermal dysplasia (HED) patients and genotype–phenotype correlation. Methods The EDA gene of six patients with HED was sequenced. Bioinformatics analysis and structural modeling for the mutations were performed. The records of 134 patients with XLHED and EDA-related NSH regarding numbers of missing permanent teeth from this study and 20 articles were reviewed. Nonparametric tests were used to analyze genotype–phenotype correlations. Results In four of the six patients, we identified a novel mutation c.852T>G (p.Phe284Leu) and three reported mutations: c.467G>A (p.Arg156His), c.776C>A (p.Ala259Glu), and c.871G>A (p.Gly291Arg). They were predicted to be pathogenic by bioinformatics analysis and structural modeling. Genotype–phenotype correlation analysis revealed that truncating mutations were associated with more missing teeth. Missense mutations and the mutations affecting the TNF homology domain were correlated with fewer missing teeth. Conclusions This study extended the mutation spectrum of XLHED and revealed the relationship between genotype and the number of missing permanent teeth.

Hypohidrotic ectodermal dysplasia (HED) is a rare disorder characterized by deficient development of structures derived from the ectoderm including hair, nails, eccrine glands, and teeth. HED forms that are caused by mutations in the genes EDA, EDAR, or EDARADD may show almost identical phenotypes, explained by a common signaling pathway. Proper interaction of the proteins encoded by these three genes is important for the activation of the NF-κB signaling pathway and subsequent transcription of the target genes. Mutations in the gene EDARADD are most rarely implicated in HED. Here we describe a novel missense mutation, c.367G>A (p.Asp123Asn), in this gene which did not appear to influence the interaction between EDAR and EDARADD proteins, but led to an impaired ability to activate NF-κB signaling. Female members of the affected family showed either unilateral or bilateral amazia. In addition, an affected girl developed bilateral ovarian teratomas, possibly associated with her genetic condition.

Physical Primer sequence Annealing Exon locationa Forward Reverse temperature (◦C) 1–1 68,835,911 5′-CGGGACCTCCTCCTTCAT 5′CGCAACTCTAGGTAGCAGCAC 60 1–2 68,835,911 5′-GCCTCAAGAGAGTGGGTGTC 5′-CCTCTAAATTGGCTCGAGGTT 59 2 69,176,877 5′-TACAGTGGAGGGGAAGATGG 5′GGCTGGTTTTGAATTCCTCA 59 3 69,243,068 5′-ATGGGGAGGTTTGATAGTTGG 5′-CAAGGAAGAATGAAAGAGGTGAA 59 4 69,247,707 5′AGATCGTGCCACTGAACTCC 5′TCTGCATCCCTTATTGCACA 60 5 69,249,354 5′TGACTCTTCCTCCAGCTCTGA 5′GGAGGCTCAGGTGAATAGGTC 60 6 69,250,319 5′-CTGAGCAAGCAGCCATTACT 5′AGAATGCCTGGGCTAGATGAT 61 7 69,253,248 5′CAGAACAGCTTCTCTGCTTTCA 5′AGTTAGCCATTGGATGGTCTTG 59 8 69,255,207 5′-AAGAACAATGCCTGTCACCTG 5′TCCACAGCAGCACTTAGAGGT 60

Background Hypohidrotic ectodermal dysplasia (HED) is a human genetic disorder that affects structures of ectodermal origin such as hair, teeth, and sweat glands. Although there are autosomal recessive and dominant forms, X-linked (XL) is the most frequent form of the disease. This XL-HED phenotype is associated with mutations in the gene encoding the transmembrane protein ectodysplasin-1 (EDA1). We report the clinical and molecular analysis of a novel mutation in exon 1 affecting the transmembrane domain of the protein. Methods We have screened 20 members of a family from Yucatan, Mexico, nine men and 11 women, searching clinical and histopathological signs of HED. We searched mutations in EDA1 gene from patients with XL-HED, carriers, and controls. Results We identified seven men with clinical characteristics of HED showing short toes and plantar hyperkeratosis not reported previously in patients with HED. A mutational study of the EDA1 gene showed that all seven patients with HED carry a novel missense mutation of the nucleotide 409 (c.409T>C) in exon 1, which changes p.Leu56-Pro in the protein amino acid sequence; five women are heterozygous compatible with carrier status. Conclusions We found a novel missense mutation in exon 1 of the EDA1 gene in a putative Mayan family from Mexico with XL-HED. We identified in this population some novel clinical signs of HED.

Ectodermal dysplasia (ED) represents a collection of rare disorders that result from a failure of development of the tissues derived from the embryonic ectoderm. ED is often associated with hair, teeth, and skin abnormalities, which are serious conditions affecting the quality of life of the patient. To date, a large number of genes have been found to be associated with this syndrome. Here, we report a patient with hypohidrotic ED (HED) without family history. We identified that this patient's disorder arises from an X-linked HED with a mutation in the EDA gene (G299D) found by whole-exome sequencing. In addition, in this paper we summarize the disease-causing mutations based on current literature. Overall, recent clinical and genetic research involving patients with HED have uncovered a large number of pathogenic mutations in EDA, which might contribute to a full understanding of the function of EDA and the underlying mechanisms of HED caused by EDA mutations.

X-linked Hypohidrotic Ectodermal Dysplasia (XLHED) is associated to a large spectrum of ectodermal and extra-ectodermal symptoms, especially craniofacial bone morphological, structural and metabolic anomalies. This skeletal phenotype described in affected patients and in the Ta mutant mouse model leads to craniofacial dysmorphies, endosseous implants and jaw bone grafts complications. Bone tissue bioengineering based on the use of PCL synthetic nanofibrous membrane and BMP nanoreservoirs appears as an original and promising approach to prevent such complications in the context of dysfunctional bone. Use of osteoblasts or stem cells seeded biomembranes appears as another strategy developed on the Tabby (Ta) model of XLHED. The Ta mouse experimental model is used to study the jaw bone response during the post-operative period after bone lesion and placement of synthetic PCL membrane functionalized with nanoreservoirs embedding different BMPs dimers or seeded with living cells.

Hypohidrotic ectodermal dysplasias (HED) are hereditary differentiation disorders of multiple ectodermal structures including the mammary gland. The X-linked form of HED (XLHED) is caused by a lack of the secreted signaling molecule ectodysplasin A1 (EDA1) which is encoded by the gene EDA and belongs to the tumor necrosis factor (TNF) superfamily. Although male patients (hemizygous) are usually more severely affected by XLHED, heterozygous female carriers of an EDA mutation may also suffer from a variety of symptoms, in particular from abnormal development of their breasts. In Tabby mice, a well-studied animal model of XLHED, EDA1 is absent. We investigated the effects of prenatal administration of Fc-EDA, a recombinant EDA1 replacement protein, on mammary gland development in female Tabby mice. Intra-amniotic delivery of Fc-EDA to fetal animals resulted later in improved breastfeeding and thus promoted the growth of their offspring. In detail, such treatment led to a normalization of the nipple shape (protrusion, tapering) that facilitated sucking. Mammary glands of treated female Tabby mice also showed internal changes, including enhanced branching morphogenesis and ductal elongation. Our findings indicate that EDA receptor stimulation during development has a stable impact on later stages of mammary gland differentiation, including lactation, but also show that intra-amniotic administration of an EDA1 replacement protein to fetal Tabby mice partially corrects the mammary gland phenotype in female adult animals.

Background To investigate the etiology of X-linked hypohidrotic ectodermal dysplasia (XLHED) in a family with an inversion of the X chromosome [inv(X)(p21q13)] and to achieve a healthy birth following preimplantation genetic diagnosis (PGD). Methods Next generation sequencing (NGS) and Sanger sequencing analysis were carried out to define the inversion breakpoint. Multiple displacement amplification, amplification of breakpoint junction fragments, Sanger sequencing of exon 1 of ED1, haplotyping of informative short tandem repeat markers and gender determination were performed for PGD. Results NGS data of the proband sample revealed that the size of the possible inverted fragment was over 42 Mb, spanning from position 26, 814, 206 to position 69, 231, 915 on the X chromosome. The breakpoints were confirmed by Sanger sequencing. A total of 5 blastocyst embryos underwent trophectoderm biopsy. Two embryos were diagnosed as carriers and three were unaffected. Two unaffected blastocysts were transferred and a singleton pregnancy was achieved. Following confirmation by prenatal diagnosis, a healthy baby was delivered. Conclusions This is the first report of an XLHED family with inv(X). ED1 is disrupted by the X chromosome inversion in this XLHED family and embryos with the X chromosomal abnormality can be accurately identified by means of PGD.

The EDA gene encodes ectodysplasin A (Eda), which if mutated causes X-linked hypohidrotic ectodermal dysplasia (XLHED) disease in humans. Ocular surface changes occur in XLHED patients whereas its underlying mechanism remains elusive. In this study, we found Eda was highly expressed in meibomian glands, and it was detected in human tears but not serum. Corneal epithelial integrity was defective and the thickness was reduced in the early postnatal stage of Eda mutant Tabby mice. Corneal epithelial cell proliferation decreased and the epithelial wound healing was delayed in Tabby mice, whereas it was restored by exogenous Eda. Eda exposure promoted mouse corneal epithelial wound healing during organ culture, whereas scratch wound assay showed that it did not affect human corneal epithelial cell line migration. Epidermal growth factor receptor (EGFR), phosphorylated EGFR (p-EGFR), and phosphorylated ERK1/2 (p-ERK) were down-regulated in Tabby mice corneal epithelium. Eda treatment up-regulated the expression of Ki67, EGFR, p-EGFR, and p-ERK in human corneal epithelial cells in a dose-dependent manner. In conclusion, Eda protein can be secreted from meibomian glands and promotes corneal epithelial cell proliferation through regulation of the EGFR signaling pathway. Eda release into the tears plays an essential role in the maintenance of corneal epithelial homeostasis.