Search

Retinal endothelial cells line the arborizing microvasculature that supplies and drains the neural retina. The anatomical and physiological characteristics of these endothelial cells are consistent with nutritional requirements and protection of a tissue critical to vision. On the one hand, the endothelium must ensure the supply of oxygen and other nutrients to the metabolically active retina, and allow access to circulating cells that maintain the vasculature or survey the retina for the presence of potential pathogens. On the other hand, the endothelium contributes to the blood-retinal barrier that protects the retina by excluding circulating molecular toxins, microorganisms, and pro-inflammatory leukocytes. Features required to fulfill these functions may also predispose to disease processes, such as retinal vascular leakage and neovascularization, and trafficking of microbes and inflammatory cells. Thus, the retinal endothelial cell is a key participant in retinal ischemic vasculopathies that include diabetic retinopathy and retinopathy of prematurity, and retinal inflammation or infection, as occurs in posterior uveitis. Using gene expression and proteomic profiling, it has been possible to explore the molecular phenotype of the human retinal endothelial cell and contribute to understanding of the pathogenesis of these diseases. In addition to providing support for the involvement of well-characterized endothelial molecules, profiling has the power to identify new players in retinal pathologies. Findings may have implications for the design of new biological therapies. Additional progress in this field is anticipated as other technologies, including epigenetic profiling methods, whole transcriptome shotgun sequencing, and metabolomics, are used to study the human retinal endothelial cell.

Retinal infection is the most common clinical manifestation of toxoplasmosis. The route by which circulating Toxoplasma gondii tachyzoites cross the vascular endothelium to enter the human retina is unknown. Convincing studies using murine encephalitis models have strongly implicated leukocyte taxis as one pathway used by the parasite to access target organs. To establish whether tachyzoites might also interact directly with vascular endothelium, we populated a transwell system with human ocular endothelial cells. Human retinal endothelial monolayers permitted transmigration of tachyzoites of RH and three natural isolate strains. Antibody blockade of intercellular adhesion molecule-1 significantly reduced this migration, but did not impact tachyzoite movement across an endothelial monolayer derived from the choroid, which lies adjacent to the retina within the eye. In demonstrating that tachyzoites are capable of independent migration across human vascular endothelium in vitro, this study carries implications for the development of therapeutics aimed at preventing access of tachyzoites to the retina.

In the human host, infection with the protozoan parasite, Toxoplasma gondii, most commonly involves the eye and/or the brain. Previous work indicates a relative susceptibility of the human retinal vascular endothelium to infection with the T. gondii tachyzoite, which may contribute to this tissue localization. To facilitate the investigation of potential adhesive interactions between parasite and endothelium in the retina, we have modified the Woodruff-Stamper assay, originally described to study lymphocytic-endothelial binding. Vascular endothelium was identified in sections of human retina by Alexa Fluor 594-tagged anti-von Willebrand factor antibody. Binding of yellow fluorescent protein-expressing tachyzoites to endothelium under conditions of flow, simulated by rotation on an orbital shaker, was quantified in a masked fashion using imaging software. We observed multiple yellow spots in contact with Alexa Fluor 594-positive retina, indicating binding of T. gondii tachyzoites to retinal vascular endothelium. This modification of the Woodruff-Stamper assay provides an opportunity to evaluate potential host receptors for T. gondii on the retinal vascular endothelium. In addition, the assay suggests a methodology that could be used to examine adhesion of other microbes to microvasculature in different tissues.

Dear Editor, CD44 is a widely expressed type I transmembrane glycoprotein that functions as the receptor for hyaluronic acid, as well as multiple other ligands.1 In humans, the extracellular domain of “standard isoform” CD44 is encoded by 7 invariant exons (i.e., exons 1 – 5 and exons 15 – 16), but 9 additional alternatively spliced exons (i.e., exons 6 – 14) code for numerous “variant isoforms”.2, 3 Exon 17 encodes a transmembrane segment, and exons 18 or 19 encode a cytoplasmic domain. Although the function of specific variant isoforms is still a subject of investigation, it is clear that differences in CD44 structure translate to differences in function.1 Studies in experimental models have implicated retinal endothelial CD44 in leukocyte trafficking in posterior uveitis,4 and choroidal endothelial CD44 in the neovascularization that characterizes wet age-related macular degeneration (AMD).5 Human retinal and choroidal endothelial cells express CD44.6 Surprisingly, however, the CD44 isoform(s) present in these cell populations are unknown. Using standard RT-PCR and dye-terminator sequencing, and human primary ocular endothelial cell isolates, we confirmed the presence of standard CD44 and investigated the potential expression of CD44 variants in human retinal and choroidal endothelial cells. Retinal and choroidal endothelial cells were isolated from paired eyes of 5 human cadaver donors with no history of ocular pathology, according to our previously described method.6 In brief, isolation involved type II collagenase (Sigma-Aldrich, St. Louis, MO) and Dispase (GIBCO-Invitrogen, Grand Island, NY) digestion of dissected tissue, followed by endothelial purification using magnetic Dynabeads (Dynal-Invitrogen, Brown Deer, WI) conjugated to murine anti-human CD31 antibody (BD Pharmingen, San Diego, CA). Timing was as short as practical to minimize processing-related gene expression changes; isolation was commenced 14 to 19 hours after death, and cells were used in experiments at passage 2 to 5. Total RNA was prepared from confluent endothelial cultures, using the RNeasy Mini Kit (Qiagen, Valencia, CA) with optional on-column DNAse treatment, and cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). The PCR was performed on a GeneAmp PCR System 9700 Thermal Cycler (Applied Biosystems, Carlsbad, CA), using published primers designed to recognize sequence in invariant CD44 exons 4 (forward: 5’- ACATCAGTCACAGACCTGCC -3’) and 17 (reverse: 5’- GCAAACTGCAAGAATCAAAGCC-3),3 as well as GAPDH (5’-AGCTGAACGGGAAGCTCACTGG-3’ and 5-GGAGTGGGTGTCGCTGTGAAGTC-3’).6 Additional PCRs were performed using forward primers for variant CD44 exons 6 (5’- CCTGGGATTGGTTTTCATGGTT -3’), 8 (5’- AACCAGGACTGGACCCAGTGGAA -3’), 10 (5’- AGGAACAGTGGTTTGGCAAC-3’) and 12 (5’- GACAGGACCTCTTTCAATGAC -3’), designed in-house, and the reverse primer for invariant exon 17. All CD44 PCR products was purified with QIAquick Gel Extraction kit (Qiagen, Valencia, CA) and sequenced on the ABI 3130xl Genetic Analyzer (Applied Biosystems). By RT-PCR using primers located at either side of the variant exon sequence in the extracellular domain of CD44, we confirmed the expression of standard CD44 in retinal and choroidal endothelial cells from the five human donors. In addition, with forward primers located within the variant exon sequence and a reverse primer in conserved sequence, we detected 10 alternatively spliced transcripts containing one or more of the 9 variant exons, although interestingly, choroidal endothelial cells from some donors did not express all isoforms (Table 1). Table 1 Exonic sequence of the variable segment of the extracellular domain in CD44 variant isoforms. Nine alternatively spliced exons (i.e., exons 6 – 14) encode for variants. Results are for human retinal and choroidal endothelial isolates from 5 human ... Our work demonstrates that, not unexpectedly, human retinal and choroidal endothelial cells express standard CD44. However, and importantly, multiple variant CD44 isoforms are synthesized by these cell types, although not universally. We identified 10 variant isoforms in both ocular endothelial cell populations, with all variant exons represented, and we anticipate additional isoforms would be detected by other methods. CD44 has been identified as a potential therapeutic target in ocular vascular disease.5 Given that the function of CD44 may vary, depending on the isoform, our findings have implications for further studies in this area. In such work, it would be critical to identify the specific CD44 isoform(s) involved in any pathological process(es) responsible for the disease in question. The potential for donor-specific splicing events should be an additional consideration.

Although the pathogenesis of primary central nervous system lymphoma (PCNSL) remains unclear, it is hypothesized that specific chemokine-chemokine receptor interactions may attract malignant B lymphocytes into the CNS. Formalin-fixed, paraffin-embedded brain biopsy specimens from 40 patients with PCNSL were immunostained by an indirect immunohistochemical method incorporating antigen retrieval to detect the presence of B-cell chemokines, stromal cell-derived factor-1 (SDF-1; CXCL12) and macrophage inflammatory protein-3alpha (MIP-3alpha, CCL20), and the SDF-1 receptor, CXCR4. To assist in phenotyping of SDF-1 + cells, specimens were also stained for CD20 (B cells). Positive staining for SDF-1 was identified in all PCNSL cases and in tonsil. In biopsy specimens, SDF-1 expression was localized to resident brain cells and, in 80% of specimens, CD20+ malignant lymphocytes. Tumor cells also stained positively for CXCR4. In contrast, although expression ofMIP-3alpha was detected in tonsil, no expression of this chemokine could be demonstrated in PCNSL biopsy specimens. Our observations raise the possibility of targeting the SDF-1-CXCR4 signaling pathway as a potential treatment for PCNSL.

Toxoplasmic retinochoroiditis is a common blinding retinal infection caused by the parasite, Toxoplasma gondii. Basic processes relating to establishment of infection in the human eye by T. gondii tachyzoites have not been investigated. To evaluate the ability of tachyzoites to navigate the human retina, we developed an ex vivo assay, in which a suspension containing 1.5 × 10(7) parasites replaced vitreous in a posterior eyecup. After 8 hours, the retina was formalin-fixed and paraffin-embedded, and sections were immunostained to identify tachyzoites. To determine the preference of tachyzoites for human retinal neuronal versus glial populations, we infected dissociated retinal cultures, subsequently characterized by neuron-specific enolase or glial fibrillary acidic protein expression, and retinal cell lines, with YFP-expressing tachyzoites. In migration assays, retinas contained 110-250 live tachyzoites; 64.5-95.2% (mean =79.6%) were localized to the nerve fiber layer, but some were detected in the outer retina. Epifluorescence imaging of dissociated retinal cultures 24 hours after infection indicated preferential infection of glia. This observation was confirmed in growth assays, with significantly higher (p ≤ 0.005) numbers of tachyzoites measured in glial verus neuronal cell lines. Our translational studies indicate that, after entering retina, tachyzoites may navigate multiple tissue layers. Tachyzoites preferentially infect glial cells, which exist throughout the retina. These properties may contribute to the success of T. gondii as a human pathogen.

PURPOSE. Consistent with clinical observations that posterior uveitis frequently involves the retinal vasculature and recent recognition of vascular heterogeneity, the hypothesis for this study was that retinal vascular endothelium was a cell population of unique molecular phenotype. METHODS. Donor-matched cultures of primary retinal and choroidal endothelial cells from six human cadavers were incubated with either Toxoplasma gondii tachyzoites (10:1, parasites per cell) or Escherichia coli lipopolysaccharide (100 ng/ mL); control cultures were simultaneously incubated with medium. Gene expression profiling of endothelial cells was performed using oligonucleotide arrays containing probes designed to detect 8746 human transcripts. After normalization, differential gene expression was assessed by the significance analysis of microarrays, with the false-discovery rate set at 5%. For selected genes, differences in the level of expression between retinal and choroidal cells were evaluated by real-time RT-PCR. RESULTS. Graphic descriptive analysis demonstrated a strong correlation between gene expression of unstimulated retinal and choroidal endothelial cells, but also highlighted distinctly different patterns of expression that were greater than differences noted between donors or between unstimulated and stimulated cells. Overall, 779 (8.9%) of 8746 transcripts were differentially represented. Of note, the 330 transcripts that were present at higher levels in retinal cells included a larger percentage of transcripts encoding molecules involved in the immune response. Differential gene expression was confirmed for 12 transcripts by RT-PCR. CONCLUSIONS. Retinal and choroidal vascular endothelial cells display distinctive gene expression profiles. The findings suggest the possibility of treating posterior uveitis by targeting specific interactions between the retinal endothelial cell and an infiltrating leukocyte. (Invest Ophthalmol Vis Sci. 2007;48: 2676‐2684) DOI:10.1167/iovs.06-0598