Search

Encorafenib plus cetuximab with or without binimetinib showed increased objective response rate (ORR), progression-free survival (PFS), and overall survival (OS) compared with chemotherapy plus anti-EGFR in previously treated patients with BRAF V600E-mutated (mut) metastatic colorectal cancer (mCRC). Although no formal comparison was planned, addition of binimetinib to encorafenib plus cetuximab did not provide significant efficacy advantage.This real-life study was aimed at evaluating safety, activity, and efficacy of encorafenib plus cetuximab with or without binimetinib in patients with BRAF V600E-mut mCRC treated at 21 Italian centers within a nominal use program launched in May 2019.Out of 133 patients included, 97 (73%) received encorafenib plus cetuximab (targeted doublet) and 36 (27%) the same therapy plus binimetinib (targeted triplet). Most patients had Eastern Cooperative Group Performance Status (ECOG-PS) of 0 or 1 (86%), right-sided primary tumor (69%), and synchronous disease (66%). Twenty (15%) tumors were DNA mismatch repair deficiency (dMMR)/microsatellite instability (MSI)-high. As many as 44 (34%) patients had received two or more prior lines of therapy, 122 (92%) were previously exposed to oxaliplatin, and 109 (82%) to anti-vascular endothelial growth factor (anti-VEGF). Most frequent adverse events were asthenia (62%) and anti-EGFR-related skin rash (52%). Any grade nausea (P = 0.03), vomiting (P = 0.04), and diarrhea (P = 0.07) were more frequent with the triplet therapy, while melanocytic nevi were less common (P = 0.06). Overall, ORR and disease control rate (DCR) were 23% and 69%, respectively, with numerically higher rates in the triplet group (ORR 31% versus 17%, P = 0.12; DCR 78% versus 65%, P = 0.23). Median PFS and OS were 4.5 and 7.2 months, respectively. Worse ECOG-PS, peritoneal metastases, and more than one prior treatment were independent poor prognostic factors for PFS and OS. Clonality of BRAF mutation measured as adjusted mutant allele fraction in tumor tissue was not associated with clinical outcome.Our real-life data are consistent with those from the BEACON trial in terms of safety, activity, and efficacy. Patients in good general condition and not heavily pretreated are those more likely to derive benefit from the targeted treatment.

Introduction: In the current study, we have investigated the effects of the different modalities of treatment (volume of radiotherapy [RT], previous surgery) as well as the Gleason score of prostate cancer (PC) on the lymphocyte composition of PC patients undergoing RT. Methods: This is a monoinstitutional study that prospectively included PC patients that underwent RT from January 2016 until December 2017. To compare the different evaluations, the Wilcoxon signed-rank test was used among 2 times (Timepoint 0 to Timepoint 1). Percentage variation was calculated for all the lymphocyte subpopulation and was correlated with clinical parameters (previous surgery, Gleason score, and pelvic irradiation) with the χ2test. The statistical analysis was repeated also on the stratified dataset according to the above parameters (previous surgery, Gleason score, and whole pelvic radiotherapy [WPRT]). Results: One hundred and eleven patients were included in the present analysis. All the lymphocyte subpopulations resulted significantly lower after RT. The modifications of several lymphocyte subpopulations correlated with previous surgery, Gleason score, and WPRT, although stratified analysis demonstrated that WPRT showed the greatest correlation. Conclusion: Our results could be used to design a prospective trial in order to study the use of WPRT on the lymphocyte subpopulations.

Importance: The protein p53 is an unequivocal tumor suppressor that is altered in half of all cancers. The immune system produces systemic p53 autoantibodies (p53 Abs) in many cancer patients. Objective: This systemic review and meta-analysis focuses on the prognostic value of p53 Abs expressed in the serum of patients with solid tumors. Data Sources: All the clinical investigations were searched on PubMed from the first study dated 1993 until May 2021 (date of submission of the manuscript). Study Selection: Studies were included that met the following criteria: (1) participants with cancer, (2) outcome results expressed in relation to the presence of a p53 antibody, (3) a primary outcome (disease-free survival, overall survival or progression-free survival) expressed as hazard ratio (HR). The following exclusion criteria were used: (1) insufficient data available to evaluate outcomes, (2) animal studies, (3) studies with less than 10 participants. As a result, 12 studies were included in the analysis. Data Extraction and Synthesis: PRISMA guidelines were used for abstracting and assessing data quality and validity by three independent observers. The summary estimates were generated using a fixed-effect model (Mantel–Haenszel method) or a random-effect model (DerSimonian–Laird method), depending on the absence or presence of heterogeneity (I2). Main Outcome(s) and Measure(s): The primary study outcome was to determine the prognostic value of p53 Abs from a large population of patients with solid tumors, as determined before data collection. Results: In total, 12 clinical studies involving 2094 patients were included in the meta-analysis, and it was determined that p53 Abs expression in the serum significantly correlated with poorer survival outcomes of cancer patients (95% CI 1.48 [1.24, 1.77], p &lt, 0.00001). Conclusions and Relevance: This is the first meta-analysis proving the diagnostic utility of p53-Abs for cancer patients in predicting poorer outcomes. The serum-p53 value (s-p53-value) may be useful for future theranostics.

Therapeutic vaccines are currently at the forefront of medical innovation. Various endeavors have been made to develop more consolidated approaches to producing nucleic acid-based vaccines, both DNA and mRNA vaccines. These innovations have continued to propel therapeutic platforms forward, especially for mRNA vaccines, after the successes that drove emergency FDA approval of two mRNA vaccines against SARS-CoV-2. These vaccines use modified mRNAs and lipid nanoparticles to improve stability, antigen translation, and delivery by evading innate immune activation. Simple alterations of mRNA structure- such as non-replicating, modified, or self-amplifying mRNAs- can provide flexibility for future vaccine development. For protein vaccines, the use of long synthetic peptides of tumor antigens instead of short peptides has further enhanced antigen delivery success and peptide stability. Efforts to identify and target neoantigens instead of antigens shared between tumor cells and normal cells have also improved protein-based vaccines. Other approaches use inactivated patient-derived tumor cells to elicit immune responses, or purified tumor antigens are given to patient-derived dendritic cells that are activated in vitro prior to reinjection. This review will discuss recent developments in therapeutic cancer vaccines such as, mode of action and engineering new types of anticancer vaccines, in order to summarize the latest preclinical and clinical data for further discussion of ongoing clinical endeavors in the field.

Purpose Monitoring mutation status in circulating free DNA (cfDNA) during target therapy could hold significant clinical importance in non-small cell lung cancer (NSCLC). Our aim is to establish if EGFR mutational status change on cfDNA has predictive value that can impact clinical management of NSCLC patients care. Methods This study included 30 patients with EGFR-mutated NSCLC. Blood samples were collected at diagnosis (T0) and in 19 patients during therapy (T1). Results Concordance between T0 and T1 EGFR mutation status for patients evaluable for both samples (n = 19) was 79%, with a sensitivity of 100% (95% CI: 55.5–100.0) and specificity of 60.0% (95% CI: 26.2–86.8). For the patients in oncological therapy with targeted drug and with T1 sample available (n = 18), survival outcomes were evaluated. For both mutation-negative T0 and T1 patients, 12-month progression-free survival (PFS) was 66.7% (95% CI: 27.2–100.0) and 12-month overall survival (OS) was 100% (95% CI: 1.00–1.00); for patients mutated both at T0 and T1, PFS was 22.2% (95% CI: 6.5–75.4%) and OS was 55.6% (95% CI: 20.4–96.1%). Conclusion EGFR mutation status can be assessed using cfDNA for routine purposes and longitudinal assessment of plasma mutation is an easy approach to monitor the therapeutic response or resistance onset.

Background: Nucleopeptides are chimeric compounds of biomedical importance carrying DNA nucleobases anchored to peptide backbones with the ascertained capacity to bind nucleic acids. However, their ability to interact with proteins involved in pathologies of social relevance is a feature that still requires investigation. The worrying situation currently observed worldwide for the COVID-19 pandemic urgently requires the research on novel anti-SARSCoV- 2 molecular weapons, whose discovery can be aided by in silico predictive studies. Objective: The aim of this work is to explore by spectroscopic methods novel features of a thymine-bearing nucleopeptide based on L-diaminopropanoic acid, including conformational aspects as well as its ability to bind proteins, starting from bovine serum albumin (BSA) as a model protein. Moreover, in consideration of the importance of targeting viral proteins in the current fight against COVID-19, we evaluated in silico the interaction of the nucleopeptide with some of the most relevant coronavirus protein targets. Methods: First, we investigated via circular dichroism (CD) the conformational behaviour of this thymine-bearing nucleopeptide with temperature: we observed CD spectral changes, particularly passing from 15 to 35 °C. Scanning Electron Microscopy (SEM) analysis of the nucleopeptide was also conducted on nucleopeptide solid samples. Additionally, CD binding and preliminary in silico investigations were performed with BSA as a model protein. Moreover, molecular dockings were run using as targets some of the main SARS-CoV-2 proteins. Results: The temperature-dependent CD behaviour reflected the three-dimensional rearrangement of the nucleopeptide at different temperatures, with higher exposure to the solvent of its chromophores at higher temperatures compared to a more stacked structure at a low temperature. SEM analysis of nucleopeptide samples in the solid-state showed a granular morphology, with a low roughness and some thread structures. Moreover, we found through spectroscopic studies that the modified peptide bound the albumin target by inducing significant changes to the protein secondary structure. Conclusion: CD and preliminary in silico studies suggested that the nucleopeptide bound the BSA protein with high affinity according to different binding modes, as testified by binding energy scores lower than -11 kcal/mol. Interestingly, a predictive study performed on 3CLpro and other SARS-CoV-2 protein targets suggested the potential ability of the nucleopeptide to bind with good affinity the main protease of the virus and other relevant targets, including the RNAdependent RNA polymerase, especially when complexed with RNA, the papain-like protease, and the coronavirus helicase at the nucleic acid binding site.

The practice of spending time in green areas to gain the health benefits provided by trees is well known, especially in Asia, as ‘forest bathing’, and the consequent protective and experimentally detectable effects on the human body have been linked to the biogenic volatile organic compounds released by plants. Houseplants are common in houses over the globe and are particularly appreciated for aesthetic reasons as well for their ability to purify air from some environmental volatile pollutants indoors. However, to the best of our knowledge, no attempt has been made to describe the health benefits achievable from houseplants thanks to the biogenic volatile organic compounds released, especially during the day, from some of them. Therefore, we performed the present study, based on both a literature analysis and in silico studies, to investigate whether the volatile compounds and aerosol constituents emitted by some of the most common houseplants (such as peace lily plant, Spathiphyllum wallisii, and iron plant, Aspidistra eliator) could be exploited in ‘indoor forest bathing’ approaches, as proposed here for the first time not only in private houses but also public spaces, such as offices, hospitals, and schools. By using molecular docking (MD) and other in silico methodologies for estimating vapor pressures and chemico-physical/pharmacokinetic properties prediction, we found that β-costol is an organic compound, emitted in appreciable amounts by the houseplant Spathiphyllum wallisii, endowed with potential antiviral properties as emerged by our MD calculations in a SARS-CoV-2 Mpro (main protease) inhibition study, together with sesquirosefuran. Our studies suggest that the anti-COVID-19 potential of these houseplant-emitted compounds is comparable or even higher than known Mpro inhibitors, such as eugenol, and sustain the utility of houseplants as indoor biogenic volatile organic compound emitters for immunity boosting and health protection.

Here we describe the synthesis, chromatographic purification, MS and NMR characterization of a new lactosyl-derivative, i.e. a lactosyl thiophenyl-substituted triazolyl-thione l-alanine (Lac-L-TTA). This amino acid–sugar conjugate was prepared by solution synthesis in analogy to the natural fructosyl-amino acids. Furthermore, we investigated the inhibition of PC-3 prostate cancer cell colony formation by this lactose derivative in comparison with the less polar fructose-based derivative, Fru-L-TTA. This let us to compare the properties of the artificial derivative, object of the present work, with the monosaccharide-based counterpart and to obtain a preliminary information on the influence of polarity on such biological activity. A significantly higher anticancer effect of Lac-L-TTA with respect to the fructose analogue emerged from our study suggesting that the anti-metastatic potential of fructosyl-amino acids can be enhanced by increasing the polarity of the compounds, for example by introducing disaccharide moieties in place of fructose.

&epsilon, poly-l-Lysine (&epsilon, PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. &epsilon, PLL and its synthetic analogue &alpha, poly-l-lysine (&alpha, PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of &alpha, PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with &alpha, PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that &alpha, PLL is capable of binding with &micro, M affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting &alpha, PLL/G4 complexes which support the use of &alpha, PLL as a G4 ligand capable of discriminating among different G4 topologies.

INTRODUCTION: Abiraterone acetate plus prednisone is approved in metastatic castration-resistant prostate cancer. There is some evidence in favour of the steroid switch from prednisone to dexamethasone in patients who progressed whilst on abiraterone acetate plus prednisone or prednisolone.MATERIALS AND METHODS: The aim of this review is to discuss the results from the clinical studies available, examining potential mechanisms of action and patient selection criteria for this treatment option.RESULTS: A total of four studies were evaluated. Among possible eligibility criteria for steroid switch, we found: PSA progression without any radiological or clinical progression during abiraterone acetate + prednisone; no high-grade adverse events related to CYP-17 inhibition; and unfitness for chemotherapy or radium-223.CONCLUSION: Although large randomized prospective trials are warranted, steroid switch seems to offer a good option for certain patients treated with abiraterone acetate plus prednisone or prednisolone.

Herein, we described the synthesis of two l-phenylalanines α-derivatized with a terminal alkyne moiety whose structures differed by phenyl ring halogen substitution (two o-Cl in 1 vs. one p-Br in 2) and investigated their effect on biological macromolecules and living cells. We explored their interaction with quadruplex DNA (G4 DNA), using tel26 and c-myc as models, and bovine serum albumin (BSA). By CD spectroscopy, we found that 1 caused minor tel26 secondary structure changes, leading also to a slight thermal stabilization of this hybrid antiparallel/parallel G4 structure, while the c-myc parallel topology remained essentially unchanged upon 1 binding. Other CD evidences showed the ability of 1 to bind BSA, while molecular docking studies suggested that the same molecule could be housed into the hydrophobic cavity between sub-domains IIA, IIB, and IIIA of the protein. Furthermore, preliminary aggregation studies, based on concentration-dependent spectroscopic experiments, suggested the ability of 1 to aggregate forming noncovalent polymeric systems in aqueous solution. Differently from 1, the bromine-modified compound was able to bind Cu(II) ion, likely with the formation of a CuL2 complex, as found by UV spectroscopy. Finally, cell tests excluded any cytotoxic effect of both compounds toward normal cells, but showed slight antiproliferative effects of 2 on PC3 cancerous cells at 24 h, and of 1 on both T98G and MDA-MB-231 cancer cells at 48 h.

Immunotherapy has recently changed the treatment of several cancers. We performed a literature-based meta-analysis of randomised controlled trials to assess the efficacy of the novel immune checkpoint inhibitors (ICIs) in metastatic gastric cancer. The main outcome was overall survival. Based on age (cut-off agreed at 65 years), tumour location (gastric vs. gastro-oesophageal junction), programmed death-ligand 1 (PD-L1) status, sex and Eastern Cooperative Oncology Group (ECOG) status (1 vs. 0), we scheduled a subgroup analysis for the overall survival. Three studies were included in the analysis for a total of 1456 cases (811 cases were in the experimental group and 645 cases in the control group). The pooled analysis showed improved overall survival in the experimental arm in the absence of statistical significance (hazard ratio (HR) = 0.87, 95% CI: 0.64&ndash, 1.18, p = 0.37). The subgroup of patients with PD-L1-positive tumours (HR = 0.82 vs. 1.04) and gastro-oesophageal junction cancer (HR = 0.82 vs. 1.04) showed a statistically significant advantage of overall survival. This study supports the efficacy of immune checkpoint inhibitors in the subgroup of patients with metastatic gastric cancer with PD-L1-positive and gastro-oesophageal junction tumour location. Future studies are needed with the aim of identifying reliable predictive biomarkers of ICI efficacy.

Here we report on the most recent updates on experimental drugs successfully employed in the treatment of the disease caused by SARS-CoV-2 coronavirus, also referred to as COVID-19 (COronaVIrus Disease-19). In particular, several cases of recovered patients have been reported after being treated with lopinavir/ritonavir [which is widely used to treat Human Immunodeficiency Virus (HIV) infection] in combination with the anti-flu drug oseltamivir. In addition, remdesivir, which has been previously administered to Ebola virus patients, has also proven effective in the U.S. against coronavirus, while antimalarial chloroquine and hydroxychloroquine, favipiravir and co-administered darunavir and umifenovir (in patient therapies) were also recently recorded as having anti-SARS-CoV-2 effects. Since the recoveries/deaths ratio in the last weeks significantly increased, especially in China, it is clear that the experimental antiviral therapy, together with the availability of intensive care unit beds in hospitals and rigorous government control measures, all play an important role in dealing with this virus. This also stresses the urgent need for the scientific community to devote its efforts to the development of other more specific antiviral strategies.

Background: An accurate risk-stratification is key to optimize the benefit-to-risk ratio of palliative treatment in advanced biliary cancer. We aimed at assessing the impact of the prognostic nutritional index (PNI) on survival and treatment response in advanced biliary cancer (ABC) receiving first-line chemotherapy. Methods: Medical records of ABC treated with standard chemotherapy at the Modena Cancer Centre were retrospectively reviewed for variables deemed of potential interest, including the PNI. Univariate and multivariate analyses were performed to investigate the association between the covariates and overall survival (OS). Results: 114 ABC fulfilled the inclusion criteria and made up the training cohort. A PNI cut-off value of 36.7 was established using the receiver operating characteristic (ROC) analysis. At both the univariate and the multivariate analysis, low PNI value (1 (P36.7 resulted in a higher disease control in patients treated with gemcitabine/platinum combination (61.4% vs 34.3%). These results were validated in an independent cohort of 253 ABC. Conclusions: We demonstrated and externally validated a prognostic role for the PNI in ABC treated with first-line chemotherapy. Although the PNI turned out to be predictive in the subset of patients receiving platinum/gemcitabine combination, future prospective confirmation is needed.

The aim of this report is to investigate the activity of ramucirumab in combination with paclitaxel in patients with metastatic gastric cancer (GC) and lung metastases. We retrospectively reviewed clinical data from patients with GC treated in second line with ramucirumab and paclitaxel according to the presence or not of lung metastases. Thirty-one patients were eligible. Five (16.1%) patients had lung metastases. The median progression-free survival was 156 days in patients without lung metastases compared with 54 days in patients with lung metastases. The median survival also showed a trend in favour of patients without lung metastases. Despite the small number of patients and the retrospective nature of the data, our analysis showed relatively poor efficacy of ramucirumab plus paclitaxel as a second-line treatment in patients with lung metastases from GC. Further studies are required to evaluate novel treatments in this subset of patients.

An artificial alanine-based amino acid {(S)-2-amino-3-[4-propyl-3-(thiophen-2-yl)-5-thioxo-4,5-dihydro-1H-1,2,4-triazol-1-yl]propanoic acid, here named TioxAla}, bearing a substituted triazolyl-thione group on the side chain and able to bind RNA biomedical targets, was here chosen as a valuable scaffold for the synthesis of new platinum complexes with potential dual action owing to the concomitant presence of the metal centre and the amino acid moiety. Three new platinum complexes, obtained from the reaction of TioxAla with K2PtCl4, were characterized by mass spectrometry, nuclear magnetic resonance and UV–vis spectroscopy: one compound (Pt1, bis-{(S)-2-amino-3-[4-propyl-3-(thiophen-2-yl)-5-thioxo-4,5-dihydro-1H-1,2,4-triazol-1-yl]propanoate-O,S} platinum(II)) consisted of two amino acid units coordinating the Pt(II) ion; the other two, Pt2 [potassium dichloro-{(S)-2-amino-3-[4-propyl-3-(thiophen-2-yl)-5-thioxo-4,5-dihydro-1H-1,2,4-triazol-1-yl]propanoate (O,S)} platinum(II)] and Pt3 [potassium dichloro-{(S)-2-amino-3-[4-propyl-3-(thiophen-2-yl)-5-thioxo-4,5-dihydro-1H-1,2,4-triazol-1-yl]propanoate (O,N)} platinum(II)], were isomers bearing one TioxAla unit, and two chlorides as Pt-ligands. Pt coordination involved preferentially the amino, carboxylic and thione functions of TioxAla. By preliminary antiproliferative assays, a moderate cytotoxic activity on cancer cells was observed only for Pt2 and Pt3, while no anticancer activity was found for both the chloride-free complex (Pt1) and TioxAla. This cytotoxicity, however lower than that of cisplatin, well correlated with the marked ability, here found only for Pt2 and Pt3 complexes, to bind DNA sequences either in random coil or in structured forms (duplex and G-quadruplex), as verified by spectroscopic and spectrometric analysis.

Background: Novel hormonal therapies (NHTs) have enriched the therapeutic armamentarium available for patients with castration-resistant prostate cancer. However, there is a need for clinical indicators able to drive treatment decisions and timing. The aim of this report is to perform a pooled analysis based on all available literature focused on prediction of efficacy and survival in patients treated with NHTs before and postchemotherapy. Methods: After reviewing the studies included in this work, the efficacy and the survival of NHTs according to age and Gleason score (GS) was focused. Results: A total of eight studies were included in the analysis. With regard to age, the survival hazard ratio shows a better outcome, for both elderly and young patients, in postchemotherapy studies. With regard to progression-free survival, the subgroup analysis of pre- and postchemotherapy studies demonstrates the effect of NHTs on the reduction of risk of progression is greater in prechemotherapy studies irrespective of age. With regard to GS, NHTs show higher efficacy when administered postchemotherapy in patients with GS

Among polyphenols, trans-resveratrol (tRES) and trans-polydatin (tPD) exert multiple biological effects, particularly antioxidant and antiproliferative. In this work, we have investigated the interaction of tPD with three cancer-related DNA sequences able to form G-quadruplex (G4) structures, as well as with a model duplex, and compared its behaviour with tRES. Interestingly, fluorescence analysis evidenced the ability of tPD to bind all the studied DNA systems, similarly to tRES, with tRES displaying a higher ability to discriminate G4 over duplex with respect to tPD. However, neither tRES nor tPD produced significant conformational changes of the analyzed DNA upon binding, as determined by CD-titration analysis. Computational analysis and biological data confirmed the biophysical results: indeed, molecular docking evidenced the stronger interaction of tRES with the promoter of c-myc oncogene, and immunoblotting assays revealed a reduction of c-myc expression, more effective for tRES than tPD. Furthermore, in vitro assays on melanoma cells proved that tPD was able to significantly reduce telomerase activity, and inhibit cell proliferation, with tRES producing higher effects than tPD.

Background Endocrine treatment with Tamoxifen and aromatase inhibitors (AIs) is a staple in the management of hormone receptor positive breast cancer (HR + BC). It has become clear that HR + BC carries a consistent risk of relapse up to 15 years post-diagnosis. While increasing evidence supports the use of extended adjuvant Tamoxifen over 5 years, controversial data are available on the optimal duration of extended AIs adjuvant treatment. We performed a meta-analysis to assess the real impact of extended adjuvant therapy with AIs on disease-free survival (DFS). Methods A literature-based meta-analysis of randomized controlled trials (RCTs) was undertaken. Relevant publications from PubMed, the Cochrane Library, and abstracts from American Society of Clinical Oncology (ASCO) and San Antonio Breast Cancer (SABCS) symposia were searched. Primary and secondary endpoints were Disease Free Survival (DFS) and overall survival (OS) respectively. A subgroup analysis was also performed to elucidate the impact of nodal involvement. Results The pooled analysis revealed a significant increase in DFS in the extended AIs group (hazard ratio (HR): 0.78, 95% CI: 0.68–0.90; P = 0.0006). The subgroup analysis according to nodal status showed a greater DFS benefit with extended AIs in patients with positive nodes (HR = 0.67 versus 0.80). Our analysis also demonstrated no improvement in OS with extended AIs (HR = 0.99, 95%CI: 0.87–1.12; P = 0.84). Conclusion This work confirmed the efficacy of extended adjuvant treatment with AIs for HR + early breast cancer, with a 22% increase in DFS, but no impact on OS. Greater efficacy was observed in women with positive nodal status.

Gastric cancer (GC) is the fifth most common malignancy and the third cause of cancer-related deaths worldwide. Currently, surgery and chemotherapy remain the main therapeutic options and the prognosis of the disease is still poor in the metastatic setting. Avelumab is a human IgG1 antibody directed against PD-L1 approved for Merkel cell carcinoma and urothelial carcinoma that could be useful also for the treatment of GC. This review describes the chemical structure, the pharmacologic properties and the current knowledge of the efficacy of avelumab in the treatment of GC from the data available on the first and later phase clinical trials. The ongoing studies testing this drug either alone or in combination with other drugs are also described.

Malignant pleural mesothelioma (MPM) is a rare and aggressive form of tumour. Some mesotheliomas have been proven to be highly immunogenic. Here, we investigated the correlation between tumour infiltrating lymphocytes (TILs) or programmed cell death ligand 1 (PD-L1) expression with overall survival (OS) in patients with MPM. 62 Paraffin-embedded formalin fixed (PEFF) samples were analysed for TILs and PD-L1 expression. Patients were divided in 4 groups according to a cut-off of the percentage of TILs found per sample as measured by immunohistichemistry: “0” or absent (between 0 and 5%), “1” or low (between 6 and 25%), “2” or moderate (between 26 and 50%) and “3” or high (between 51 and 75%). OS was then correlated with different TILs’ expression patterns. Moreover, PD-L1 expression was assessed within the tumour as well as in the adjacent stroma on the same samples. Higher expression of peritumoral TILs (Group 2 + 3) versus Group 0 and 1 correlated with improved OS (p-value = 0.02). On the contrary PD-L1 expression seemed to be inversely correlated with clinical outcomes, even in the absence of statistical significance (HR 1.76; p = 0.083 95% IC 0.92–3.36 in areas within the tumour; HR 1.60; p = 0.176 95%; IC 0.80–3.19 in areas within the stroma). No relationship between TILs and PD-L1 expression was identified. Our research supports the use of TILs and PD-L1 expression as potential outcome predictors in patients with MPM. The use of TILs and PD-L1 as biomarkers for checkpoint inhibitors’ efficacy warrants future investigation.

Worldwide, gastric cancer represents the fifth most common cancer and the third leading cause of cancer deaths. Although the overall 5-year survival for resectable disease was more than 70% in Japan due to the implementation of screening programs resulting in detection of disease at earlier stages, in Western countries more than two thirds of gastric cancers are usually diagnosed in advanced stages reporting a 5-year survival rate of only 25.7%. Anyway surgical resection with extended lymph node dissection remains the only curative therapy for non-metastatic advanced gastric cancer, while neoadjuvant and adjuvant chemotherapies can improve the outcomes aimed at the reduction of recurrence and extension of survival. High-quality research and advances in technologies have contributed to well define the oncological outcomes and have stimulated many clinical studies testing multimodality managements in the advanced disease setting. This review article aims to outline and discuss open issues in current surgical management of advanced gastric cancer.

Introduction: Renal cell carcinoma (RCC) accounts for 2–3% of all solid tumors. Expression of the receptor for the vascular endothelial growth factor (VEGF) is one of the most common features of RCC. Areas covered: Lenvatinib is a novel multi-kinase inhibitor that has been studied in several solid tumors. It has shown promising results in the treatment of RCC, especially when combined with everolimus, In this review, we summarize the available data of lenvatinib for the treatment of advanced/metastatic renal cell carcinoma. Expert opinion: Lenvatinib in combination with everolimus has provided encouraging results in both clinical and laboratory investigations showing that blocking angiogenesis and the mTOR signalling pathway could be a remarkable approach for treating RCC. As an additive to this type of approach it would be interesting in future clinical settings testing also the combination of lenvatinib and everolimus with immune-therapy.

Background Histological status of axillary lymph nodes is an important prognostic factor in patients receiving surgery for breast cancer (BC). Sentinel lymph node (SLN) biopsy (B) has rapidly replaced axillary lymph node dissection (ALND), and is now the standard of care for axillary staging in patients with clinically node-negative (N0) operable BC. The aim of this study is to compare pretreatment lymphoscintigraphy with a post primary systemic treatment (PST) scan in order to reduce the false-negative rates for SLNB. Methods In this single-institution study we considered 170 consecutive T2-4 N0-1 M0 BC patients treated with anthracycline-based PST. At the time of incisional biopsy, we performed sentinel lymphatic mapping. After PST, all patients repeated lymphoscintigraphy with the same methodology. During definitive surgery we performed further sentinel lymphatic mapping, SLNB and ALND. Results The SLN was removed in 158/170 patients giving an identification rate of 92.9% (95% confidence interval (CI) = 88.0–96.3%) and a false-negative rate of 14.0% (95% CI = 6.3–25.8%). SLNB revealed a sensitivity of 86.0% (95% CI = 74.2–93.7%), an accuracy of 94.9% (95% CI = 90.3–97.8%) and a negative predictive value of 92.7% (95% CI = 86.1–96.8%). Conclusion Identification rate, sensitivity and accuracy are in accordance with other studies on SLNB after PST, even after clinically negative node conversion following PST. This study confirms that diagnostic biopsy and neoadjuvant chemotherapy maintain breast lymphatic drainage unaltered.

Here, we report the synthesis, purification, ESI MS and NMR characterization, as well as the SEM analysis of a fructosyl thiophenyl-substituted triazolyl-thione l-alanine (denominated Fru-l-TTA). This novel fructosyl derivative was obtained by solution synthesis using the Amadori reaction, in analogy to other natural fructosyl-amino acids, and fully characterized. In particular, we report an accurate NMR/MS/SEM characterization of Fru-l-TTA alongside some biological properties, and investigated to compare the properties of the artificial derivative of this work with the natural counterparts. In particular, Fru-l-TTA shares with natural fructosyl-amino acids the possibility to inhibit the colony formation of prostate cancer cells and additionally decreases their migration.

The aim of this study is to report first preliminary results of patients enrolled in a phase II study that will investigate the activity and safety of docetaxel, oxaliplatin, and 5-fluorouracil (DOF) in combination with trastuzumab in human epidermal receptor-2 (HER-2) positive patients with advanced gastric or gastroesophageal junction (GEJ) cancer.Treatment consisted of docetaxel 70 mg/m combined with oxaliplatin 130 mg/m on day 1, and continuous infusion

Targeting regulatory RNA regions to interfere with the biosynthesis of a protein is an intriguing alternative to targeting a protein itself. Regulatory regions are often unique in sequence and/or structure and, thus, ideally suited for specific recognition with a low risk of undesired side effects. Targeting regulatory RNA elements, however, is complicated by their complex three-dimensional structure, which poses kinetic and thermodynamic constraints to the recognition by a complementary oligonucleotide. Oligonucleotide mimics, which shift the thermodynamic equilibrium towards complex formation and yield stable complexes with a target RNA, can overcome this problem. Peptide nucleic acids (PNA) represent such a promising class of molecules. PNA are very stable, non-ionic compounds and they are not sensitive to enzymatic degradation. Yet, PNA form specific base pairs with a target sequence. We have designed, synthesised and characterised PNA able to enter infected cells and to bind specifically to a control region of the genomic RNA of coxsackievirus B3 (CVB3), which is an important human pathogen. The results obtained by studying the interaction of such PNA with their RNA target, the entrance into the cell and the viral inhibition are herein presented. Copyright © 2005 European Peptide Society and John Wiley & Sons, Ltd.

In order to develop new oligodeoxyribonucleotide (ODN) analogs to be used in biotechnological applications, we report here the synthesis, characterization and nucleic acid binding studies of novel nucleopeptides, that we called epsilon-lys/gamma-dabPNAs, containing a backbone of alternated L-diaminobutyric acid and L-lysine moieties. Exploring the hybridization properties of the new ODN analog, we found, by circular dichroism and UV spectroscopies, that a homothymine epsilon-lys/gamma-dabPNA hexamer binds both DNA and RNA of complementary sequence. Furthermore, human serum stability assays on the alternate nucleopeptide evidenced a noteworthy degradation resistance. These results encourage us to deepen the knowledge of this analog, in order to evaluate its possible use in antigene/antisense or diagnostic applications.