Search

Zika virus (ZIKV) is transmitted mostly via mosquito bites and no vaccine is available, so it may reemerge. We and others previously demonstrated that neonatal infection of ZIKV results in heart failure and can be fatal. Animal models implicated ZIKV involvement in viral heart diseases. It is unknown whether and how ZIKV causes heart failure in adults. Herein, we studied the effects of ZIKV infection on the heart function of adult A129 mice. First, we found that ZIKV productively infects the rat-, mouse-, or human-originated heart cell lines and caused ubiquitination-mediated degradation of and distortive effects on connexin 43 (Cx43) protein that is important for communications between cardiomyocytes. Second, ZIKV infection caused 100% death of the A129 mice with decreasing body weight, worsening health score, shrugging fur, and paralysis. The viral replication was detected in multiple organs. In searching for the viral effects on heart of the A129 mice, we found that ZIKV infection resulted in the increase of cardiac muscle enzymes, implicating a viral acute myocardial injury. ZIKV-caused heart injury was also demonstrated by electrocardiogram (ECG) showing widened and fragmented QRS waves, prolonged PR interval, and slower heart rate. The intercalated disc (ICD) between two cardiomyocytes was destroyed, as shown by the electronic microscopy, and the Cx43 distribution in the ICDs was less organized in the ZIKV-infected mice compared to that in the phosphate-buffered saline (PBS)-treated mice. Consistently, ZIKV productively infected the heart of A129 mice and decreased Cx43 protein. Therefore, we demonstrated that ZIKV infection caused heart failure, which might lead to fatal sequelae in ZIKV-infected A129 mice.

SARS-CoV-2 has been the causative pathogen of the pandemic of COVID-19, resulting in catastrophic health issues globally. It is important to develop human-like animal models for investigating the mechanisms that SARS-CoV-2 uses to infect humans and cause COVID-19. Several studies demonstrated that the non-human primate (NHP) is permissive for SARS-CoV-2 infection to cause typical clinical symptoms including fever, cough, breathing difficulty, and other diagnostic abnormalities such as immunopathogenesis and hyperplastic lesions in the lung. These NHP models have been used for investigating the potential infection route and host immune response to SARS-CoV-2, as well as testing vaccines and drugs. This review aims to summarize the benefits and caveats of NHP models currently available for SARS-CoV-2, and to discuss key topics including model optimization, extended application, and clinical translation.

Human cytomegalovirus (HCMV) infects a large portion of the human population globally. Several HCMV-derived noncoding RNAs are involved in the regulation of viral gene expression and the virus life cycle. Here, we reported that circRNAs are a new class of HCMV transcripts. We bioinformatically predict 704 candidate circRNAs encoded by the TB40/E strain and 230 encoded by the HAN strain. We also systematically compare circRNA features, including the breakpoint sequence consensus, strand preference, length distribution, and exon numbers between host genome-encoded circRNAs and viral circRNAs, and showed that the unique characteristics of viral circRNAs are correlated with their genome types. Furthermore, we experimentally confirmed 324 back-splice junctions (BSJs) from three HCMV strains, Towne, TB40/E, and Toledo, and identified 4 representative HCMV circRNAs by RNase R treatment. Interestingly, we also showed that HCMV contains alternative back-splicing circRNAs. We developed a new amplified FISH method that allowed us to visualize circRNAs and quantify the number of circRNA molecules in the infected cells. The competitive endogenous RNA network analysis suggests that HCMV circRNAs play important roles in viral DNA synthesis via circRNA-miRNA-mRNA networks. Our findings highlight that circRNAs are an important component of the HCMV transcriptome that may contribute to viral replication and pathogenesis.

Circular RNAs (circRNAs) are a newly recognized component of the transcriptome with critical roles in autoimmune diseases and viral pathogenesis. To address the importance of circRNA in RNA viral transcriptome, we systematically identified and characterized circRNAs encoded by the RNA genomes of betacoronaviruses using both bioinformatical and experimental approaches. We predicted 351, 224, and 2764 circRNAs derived from severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), SARS-CoV, and Middle East respiratory syndrome coronavirus, respectively. We experimentally identified 75 potential SARS-CoV-2 circRNAs from RNA samples extracted from SARS-CoV-2-infected Vero E6 cells. A systematic comparison of viral and host circRNA features, including abundance, strand preference, length distribution, circular exon numbers, and breakpoint sequences, demonstrated that coronavirus-derived circRNAs had a spliceosome-independent origin. We further showed that back-splice junctions (BSJs) captured by inverse reverse-transcription polymerase chain reaction have different level of resistance to RNase R. Through northern blotting with a BSJ-spanning probe targeting N gene, we identified three RNase R-resistant bands that represent SARS-CoV-2 circRNAs that are detected cytoplasmic by single-molecule and amplified fluorescence in situ hybridization assays. Lastly, analyses of 169 sequenced BSJs showed that both back-splice and forward-splice junctions were flanked by homologous and reverse complementary sequences, including but not limited to the canonical transcriptional regulatory sequences. Our findings highlight circRNAs as an important component of the coronavirus transcriptome, offer important evaluation of bioinformatic tools in the analysis of circRNAs from an RNA genome, and shed light on the mechanism of discontinuous RNA synthesis.

The spike (S) glycoprotein of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is responsible for the binding to the permissive cells. The receptor-binding domain (RBD) of SARS-CoV-2 S protein directly interacts with the human angiotensin-converting enzyme 2 (ACE2) on the host cell membrane. In this study, we used computational saturation mutagenesis approaches, including structure-based energy calculations and sequence-based pathogenicity predictions, to quantify the systemic effects of missense mutations on SARS-CoV-2 S protein structure and function. A total of 18 354 mutations in S protein were analyzed, and we discovered that most of these mutations could destabilize the entire S protein and its RBD. Specifically, residues G431 and S514 in SARS-CoV-2 RBD are important for S protein stability. We analyzed 384 experimentally verified S missense variations and revealed that the dominant pandemic form, D614G, can stabilize the entire S protein. Moreover, many mutations in N-linked glycosylation sites can increase the stability of the S protein. In addition, we investigated 3705 mutations in SARS-CoV-2 RBD and 11 324 mutations in human ACE2 and found that SARS-CoV-2 neighbor residues G496 and F497 and ACE2 residues D355 and Y41 are critical for the RBD–ACE2 interaction. The findings comprehensively provide potential target sites in the development of drugs and vaccines against COVID-19.

The emergences of coronaviruses have caused a serious global public health problem because their infection in humans caused the severe acute respiratory disease and deaths. The outbreaks of lethal coronaviruses have taken place for three times within recent two decades (SARS-CoV in 2002, MERS-CoV in 2012 and SARS-CoV-2 in 2019). Much more serious than SARS-CoV in 2002, the current SARS-CoV-2 infection has been spreading to more than 213 countries, areas or territories and causing more than two million cases up to date (17 April 2020). Unfortunately, no vaccine and specific anti-coronavirus drugs are available at present time. Current clinical treatment at hand is inadequate to suppress viral replication and inflammation, and reverse organ failure. Intensive research efforts have focused on increasing our understanding of viral biology of SARS-CoV-2, improving antiviral therapy and vaccination strategies. The animal models are important for both the fundamental research and drug discovery of coronavirus. This review aims to summarize the animal models currently available for SARS-CoV and MERS-CoV, and their potential use for the study of SARS-CoV-2. We will discuss the benefits and caveats of these animal models and present critical findings that might guide the fundamental studies and urgent treatment of SARS-CoV-2-caused diseases.

Coronavirus possesses the largest RNA genome among all the RNA viruses. Its genome encodes about 29 proteins. Most of the viral proteins are non-structural proteins (NSP) except envelop (E), membrane (M), nucleocapsid (N) and Spike (S) proteins that constitute the viral nucleocapsid, envelop and surface. We have recently cloned all the 29 SARS-CoV-2 genes into vectors for their expressions in mammalian cells except NSP11 that has only 14 amino acids (aa). We are able to express all the 28 cloned SARS-CoV-2 genes in human cells to characterize their subcellular distributions. The proteins of SARS-CoV-2 are mostly cytoplasmic but some are both cytoplasmic and nuclear. Those punctate staining proteins were further investigated by immunofluorescent assay (IFA) using specific antibodies or by co-transfection with an organelle marker-expressing plasmid. As a result, we found that NSP15, ORF6, M and ORF7a are related to Golgi apparatus, and that ORF7b, ORF8 and ORF10 colocalize with endoplasmic reticulum (ER). Interestingly, ORF3a distributes in cell membrane, early endosome, endosome, late endosome and lysosome, which suggests that ORF3a might help the infected virus to usurp endosome and lysosome for viral use. Furthermore, we revealed that NSP13 colocalized with SC35, a protein standing for splicing compartments in the nucleus. Our studies for the first time visualized the subcellular locations of SARS-CoV-2 proteins and might provide novel insights into the viral proteins’ biological functions.

Rationale: Hepatocyte-like cells (HLCs) derived from human induced pluripotent stem cells (hiPSCs) have been developed to address the shortage of primary human hepatocytes (PHHs) for therapeutic applications. However, the in vivo repopulation capacity of HLCs remains limited. This study investigated the roles of agonist antibody activating the c-Met receptor in promoting the in vivo proliferation and repopulation of engrafted PHHs and/or HLCs in mice with liver injuries due to different causes. Methods: An agonist c-Met receptor antibody (5D5) was used to treat PHHs and hiPSC-HLCs in both cell culture and hepatocyte-engrafted immunodeficient mice mimicking various inherited and acquired liver diseases. The promoting roles and potential influence on the hepatic phenotype of the 5D5 regimen in cell transplantation-based therapeutic applications were systematically evaluated. Results: In hiPSC-HLC cell cultures, 5D5 treatment significantly stimulated c-Met receptor downstream signalling pathways and accelerated cell proliferation in dose-dependent and reversible manners. In contrast, only slight but nonsignificant promotion was observed in 5D5-treated PHHs. In vivo administration of 5D5 greatly promoted the expansion of implanted hiPSC-HLCs in fumarylacetoacetate hydrolase (Fah) deficient mice, resulting in significantly increased human albumin levels and high human liver chimerism (over 40%) in the transplanted mice at week 8 after transplantation. More importantly, transplantation of hiPSC-HLCs in combination with 5D5 significantly prolonged animal survival and ameliorated liver pathological changes in mice with acute and/or chronic liver injuries caused by Fas agonistic antibody treatment, carbon tetrachloride treatment and/or tyrosinemic stress. Conclusion: Our results demonstrated that the proliferation of hiPSC-HLCs can be enhanced by antibody-mediated modulation of c-Met signalling and facilitate hiPSC-HLC-based therapeutic applications for life-threatening liver diseases.

KPNA2/importin-alpha1 (karyopherin subunit alpha 2) is the primary nucleocytoplasmic transporter for some transcription factors to activate cellular proliferation and differentiation. Aberrant increase of KPNA2 level is identified as a prognostic marker in a variety of cancers. Yet, the turnover mechanism of KPNA2 remains unknown. Here, we demonstrate that KPNA2 is degraded via the chaperone-mediated autophagy (CMA) and that Zika virus (ZIKV) enhances the KPNA2 degradation. KPNA2 contains a CMA motif, which possesses an indispensable residue Gln109 for the CMA-mediated degradation. RNAi-mediated knockdown of LAMP2A, a vital component of the CMA pathway, led to a higher level of KPNA2. Moreover, ZIKV reduced KPNA2 via the viral NS2A protein, which contains an essential residue Thr100 for inducing the CMA-mediated KPNA2 degradation. Notably, mutant ZIKV with T100A alteration in NS2A replicates much weaker than the wild-type virus. Also, knockdown of KPNA2 led to a higher ZIKV viral yield, which indicates that KPNA2 mediates certain antiviral effects. These data provide insights into the KPNA2 turnover and the ZIKV-cell interactions.

T98G cells have been shown to support long-term human cytomegalovirus (HCMV) genome maintenance without infectious virus release. However, it remains unclear whether these viral genomes could be reactivated. To address this question, a recombinant HCMV (rHCMV) containing a GFP gene was used to infect T98G cells, and the infected cells absent of infectious virus production were designated T98G-LrV. Upon dibutyryl cAMP plus IBMX (cAMP/IBMX) treatment, a serial of phenomena were observed, including GFP signal increase, viral genome replication, lytic genes expression and infectious viruses release, indicating the reactivation of HCMV in T98G-LrV cells from a latent status. Mechanistically, HCMV reactivation in the T98G-LrV cells induced by cAMP/IBMX was associated with the PKA-CREB signaling pathway. These results demonstrate that HCMV was latent in T98G-LrV cells and could be reactivated. The T98G-LrV cells represent an effective model for investigating the mechanisms of HCMV reactivation from latency in the context of neural cells.

Zika virus (ZIKV) encodes a precursor protein (also called polyprotein) of about 3424 amino acids that is processed by proteases to generate 10 mature proteins and a small peptide. In the present study, we characterized the chemical features, suborganelle distribution and potential function of each protein using Flag-tagged protein expression system. Western blot analysis revealed the molecular weight of the proteins and the polymerization of E, NS1, and NS3 proteins. In addition, we performed multi-labeled fluorescent immunocytochemistry and subcellular fractionation to determine the subcellular localization of these proteins in host cells. We found that 1) the capsid protein colocalizes with 3 different cellular organelles: nucleoli, Golgi apparatus, and lipid droplet; NS2b and NS4a are associated with the Golgi apparatus; 2) the capsid and NS1proteins distribute in both cytoplasm and nucleus, NS5 is a nuclear protein; 3) NS3 protein colocalizes with tubulin and affects Lamin A; 4) Envelope, PrM, and NS2a proteins co-localize with the endoplasmic reticulum; 5) NS1 is associated with autophagosomes and NS4b is related to early endosome; 6) NS5 forms punctate structures in the nucleus that associate with splicing compartments shown by SC35, leading to reduction of SC35 protein level and trafficking of SC35 from the nucleus to the cytoplasm. These data suggest that ZIKV generates 10 functional viral proteins that exhibit distinctive subcellular distribution in host cells.

The centrosome is a cytoplasmic nonenveloped organelle functioning as one of the microtubule-organizing centers and composing a centriole center surrounded by pericentriolar material (PCM) granules. PCM consists of many centrosomal proteins, including PCM1 and centrosomal protein 131 (CEP131), and helps maintain centrosome stability. Zika virus (ZIKV) is a flavivirus of the family Flaviviridae whose RNA and viral particles are replicated in the cytoplasm. However, how ZIKV interacts with host cell components during its productive infection stage is incompletely understood. Here, using several primate cell lines, we report that ZIKV infection disrupts and disperses the PCM granules. We demonstrate that PCM1- and CEP131-containing granules are dispersed in ZIKV-infected cells, whereas the centrioles remain intact. We found that ZIKV does not significantly alter cellular skeletal proteins, and, hence, these proteins may not be involved in the interaction between ZIKV and centrosomal proteins. Moreover, ZIKV infection decreased PCM1 and CEP131 protein, but not mRNA, levels. We further found that the protease inhibitor MG132 prevents the decrease in PCM1 and CEP131 levels and centriolar satellite dispersion. Therefore, we hypothesized that ZIKV infection induces proteasomal PCM1 and CEP131 degradation and thereby disrupts the PCM granules. Supporting this hypothesis, we show that ZIKV infection increases levels of mind bomb 1 (MIB1), previously demonstrated to be an E3 ubiquitin ligase for PCM1 and CEP131 and that ZIKV fails to degrade or disperse PCM in MIB1-ko cells. Our results imply that ZIKV infection activates MIB1-mediated ubiquitination that degrades PCM1 and CEP131, leading to PCM granule dispersion.

Vaccination has had great success in combating diseases, especially infectious diseases. However, traditional vaccination strategies are ineffective for several life-threatening diseases, including acquired immunodeficiency syndrome (AIDS), tuberculosis, malaria, and cancer. Viral vaccine vectors represent a promising strategy because they can efficiently deliver foreign genes and enhance antigen presentation in vivo. However, several limitations, including pre-existing immunity and packaging capacity, block the application of viral vectors. Cytomegalovirus (CMV) has been demonstrated as a new type of viral vector with additional advantages. CMV could systematically elicit and maintain high frequencies of effector memory T cells through the “memory inflation” mechanism. Studies have shown that CMV can be genetically modified to induce distinct patterns of CD8+ T-cell responses, while some unconventional CD8+ T-cell responses are rarely induced through conventional vaccine strategies. CMV has been used as a vaccine vector to deliver many disease-specific antigens, and the efficacy of these vaccines was tested in different animal models. Promising results demonstrated that the robust and unconventional T-cell responses elicited by the CMV-based vaccine vector are essential to control these diseases. These accumulated data and evidence strongly suggest that a CMV-based vaccine vector represents a promising approach to develop novel prophylactic and therapeutic vaccines against some epidemic pathogens and tumors.

Kaposi’s sarcoma-associated herpesvirus (KSHV; also called human herpesvirus 8 [HHV-8]), upon being reactivated, causes serious diseases in immunocompromised individuals. Its reactivation, especially how the cellular regulating mechanisms play roles in KSHV gene expression and viral DNA replication, is not fully understood. In searching for the cellular factors that regulate KSHV gene expression, we found that several histone deacetylases (HDACs) and sirtuins (SIRTs), including HDACs 2, 7, 8, and 11 and SIRTs 4 and 6, repress KSHV ori-Lyt promoter activity. Interestingly, the nuclear protein SIRT6 presents the greatest inhibitory effect on ori-Lyt promoter activity. A more detailed investigation revealed that SIRT6 exerts repressive effects on multiple promoters of KSHV. As a consequence of inhibiting the KSHV promoters, SIRT6 not only represses viral protein production but also inhibits viral DNA replication, as investigated in a KSHV-containing cell line, SLK-iBAC-gfpK52. Depletion of the SIRT6 protein using small interfering RNA could not directly reactivate KSHV from SLK-iBAC-gfpK52 cells but made the reactivation of KSHV by use of a small amount of the reactivator (doxycycline) more effective and enhanced viral DNA replication in the KSHV infection system. We performed DNA chromatin immunoprecipitation (ChIP) assays for SIRT6 in the SLK-iBAC-gfpK52 cell line to determine whether SIRT6 interacts with the KSHV genome in order to exhibit regulatory effects. Our results suggest that SIRT6 interacts with KSHV ori-Lyt and ORF50 promoters. Furthermore, the SIRT6-KSHV DNA interaction is significantly negated by reactivation. Therefore, we identified a cellular regulator, SIRT6, that represses KSHV replication by interacting with KSHV DNA and inhibiting viral gene expression. IMPORTANCE Kaposi’s sarcoma-associated herpesvirus (KSHV) is a pathogen causing cancer in the immune-deficient population. The reactivation of KSHV from latency is important for it to be carcinogenic. Our finding that SIRT6 has inhibitory effects on KSHV reactivation by interacting with the viral genome and suppressing viral gene expression is important because it might lead to a strategy of interfering with KSHV reactivation. Overexpression of SIRT6 repressed the activities of several KSHV promoters, leading to reduced gene expression and DNA replication by KSHV in a KSHV bacterial artificial chromosome-containing cell line. Depletion of SIRT6 favored reactivation of KSHV from SLK-iBACV-gfpK52 cells. More importantly, we reveal that SIRT6 interacts with KSHV DNA. Whether the interaction of SIRT6 with KSHV DNA occurs at a global level will be further studied in the future.

Zika virus (ZIKV) is a mosquito-borne positive-sense single-stranded RNA virus in the family of Flaviviridae. Unlike other flaviviruses, ZIKV infection of pregnant women may result in birth defects in their newborns, such as microcephaly or vision problem. ZIKV is known to antagonize the interferon (IFN) production in infected cells. However, the exact mechanism of this interference is not fully understood. Here, we demonstrate that NS5 protein of ZIKV MR766 strain antagonizes IFN production through inhibiting the activation of TANK-binding kinase 1 (TBK1), which phosphorylates the transcription activator IFN regulatory factor 3 (IRF3). Mechanistically, NS5 interacts with the ubiquitin-like domain of TBK1 and results in less complex of TBK1 and TNF (tumor necrosis factor) receptor-associated factor 6 (TRAF6), leading to dampened TBK1 activation and IRF3 phosphorylation. Our study provides insights into the mechanism of ZIKV evasion of IFN-mediated innate immunity.

To countermeasure the host cellular intrinsic defense, cytomegalovirus (CMV) and herpes simplex viruses (HSV) have evolved the ability to disperse nuclear domain 10 (ND10, aka PML body). However, mechanisms underlying their action on ND10 differ. HSV infection produces ICP0, which degrades the ND10-forming protein PML. Human CMV (HCMV) infection expresses IE1 that deSUMOylates PML to result in dispersion of ND10. It has been demonstrated that HSV ICP0 degraded only the SUMOylated PML, so we hypothesized that HCMV IE1 can protect PML from degradation by ICP0. HCMV IE1-expressing cell lines (U-251 MG-IE1 and HELF-IE1) were used for infection of HSV-1 or transfection of ICP0-expressing plasmid. Multilabeling by immunocytochemistry assay and protein examination by Western blot assay were performed to determine the resultant fate of PML caused by ICP0 in the presence or absence of HCMV IE1. Here, we report that deSUMOylation of human PML (hPML) by HCMV IE1 was incomplete, as mono-SUMOylated PML remained in the IE1-expressing cells, which is consistent with the report by E. M. Schilling, M. Scherer, N. Reuter, J. Schweininger, et al. (J Virol 91:e02049-16, 2017, https://doi.org/10.1128/JVI.02049-16). As expected, we found that IE1 protected PML from degradation by ICP0 or HSV-1 infection. An in vitro study found that IE1 with mutation of L174P failed to deSUMOylate PML and did not protect PML from degradation by ICP0; hence, we conclude that the deSUMOylation of PML is important for IE1 to protect PML from degradation by ICP0. In addition, we revealed that murine CMV failed to deSUMOylate and to protect the HSV-mediated degradation of hPML, and that HCMV failed to deSUMOylate and protect the HSV-mediated degradation of mouse PML. However, IE1-expressing cells did not enhance wild-type HSV-1 replication but significantly increased ICP0-defective HSV-1 replication at a low multiplicity of infection. Therefore, our results uncovered a host-virus functional interaction at the posttranslational level. IMPORTANCE Our finding that HCMV IE1 protected hPML from degradation by HSV ICP0 is important, because the PML body (aka ND10) is believed to be the first line of host intrinsic defense against herpesviral infection. How the infected viruses overcome the nuclear defensive structure (PML body) has not been fully understood. Herpesviral proteins, ICP0 of HSV and IE1 of CMV, have been identified to interact with PML. Here, we report that HCMV IE1 incompletely deSUMOylated PML, resulting in the mono-SUMOylated PML, which is consistent with the report of Schilling et al. (J Virol 91:e02049-16, 2017, https://doi.org/10.1128/JVI.02049-16). The mono-SUMOylated PML was subjected to degradation by HSV ICP0. However, it was protected by IE1 from degradation by ICP0 or HSV-1 infection. In contrast, IE1 with L174P mutation lost the function of deSUMOylating PML and failed to protect the degradation of the mono-SUMOylated PML. Whether the mono-SUMOylated PML has any defensive function against viral infection will be further investigated.

The human liver chimeric mouse with primary human hepatocytes (PHHs) engraftment has been demonstrated to be a useful animal model to study hepatitis B virus (HBV) pathogenesis and evaluate anti-HBV drugs. However, the disadvantages of using PHHs include the inability for cellular expansion in vitro, limited donor availability, individual differences, and ethical issues, necessitating the development of alternatives. To obtain in vitro expandable hepatocytes, we optimized the hepatic differentiation procedure of the human liver progenitor cell line, HepaRG, using four functional small molecules (4SM) and enriched the precursor hepatocyte-like cells (HLCs). HepaRG cells of different hepatic differentiation states were engrafted to immunodeficient mice (FRGS) with weekly 4SM treatment. The HepaRG-engrafted mice were challenged with HBV and/or treated with several antivirals to evaluate their effects. We demonstrated that the 4SM treatment enhanced hepatic differentiation and promoted cell proliferation capacity both in vitro and in vivo. Mice engrafted with enriched HepaRG of prehepatic differentiation and treated with 4SM displayed approximately 10% liver chimerism at week 8 after engraftment and were maintained at this level for another 16 weeks. Therefore, we developed a HepaRG-based human liver chimeric mouse model: HepaRG-FRGS. Our experimental results showed that the liver chimerism of the mice was adequate to support chronic HBV infection for 24 weeks and to evaluate antivirals. We also demonstrated that HBV infection in HepaRG cells was dependent on their hepatic differentiation state and liver chimerism in vivo. Overall, HepaRG-FRGS mice provide a novel human liver chimeric mouse model to study chronic HBV infection and evaluate anti-HBV drugs.

Movement of macromolecules between the cytoplasm and the nucleus occurs through the nuclear pore complex (NPC). Karyopherins comprise a family of soluble transport factors facilitating the nucleocytoplasmic translocation of proteins through the NPC. In this study, we found that karyopherin α6 (KPNA6; also known as importin α7) was required for the optimal replication of porcine reproductive and respiratory syndrome virus (PRRSV) and Zika virus (ZIKV), which are positive-sense, single-stranded RNA viruses replicating in the cytoplasm. The KPNA6 protein level in virus-infected cells was much higher than that in mock-infected controls, whereas the KPNA6 transcript remains stable. Viral infection blocked the ubiquitin-proteasomal degradation of KPNA6, which led to an extension of the KPNA6 half-life and the elevation of the KPNA6 level in comparison to mock-infected cells. PRRSV nsp12 protein induced KPNA6 stabilization. KPNA6 silencing was detrimental to the replication of PRRSV, and KPNA6 knockout impaired ZIKV replication. Moreover, KPNA6 knockout blocked the nuclear translocation of PRRSV nsp1β but had a minimal effect on two other PRRSV proteins with nuclear localization. Exogenous restitution of KPNA6 expression in the KPNA6-knockout cells results in restoration of the nuclear translocation of PRRSV nsp1β and the replication of ZIKV. These results indicate that KPNA6 is an important cellular factor for the replication of PRRSV and ZIKV. IMPORTANCE Positive-sense, single-stranded RNA (+ssRNA) viruses replicate in the cytoplasm of infected cells. The roles of transport factors in the nucleocytoplasmic trafficking system for the replication of +ssRNA viruses are not known. In this study, we discovered that PRRSV and ZIKV viruses needed karyopherin α6 (KPNA6), one of the transport factors, to enhance the virus replication. Our data showed that viral infection induced an elevation of the KPNA6 protein level due to an extension of the KPNA6 half-life via viral interference of the ubiquitin-proteasomal degradation of KPNA6. Notably, KPNA6 silencing or knockout dramatically reduced the replication of PRRSV and ZIKV. PRRSV nsp1β depended on KPNA6 to translocate into the nucleus. In addition, exogenous restitution of KPNA6 expression in KPNA6-knockout cells led to the restoration of nsp1β nuclear translocation and ZIKV replication. These results reveal a new aspect in the virus-cell interaction and may facilitate the development of novel antiviral therapeutics.

WD repeat-containing protein 5 (WDR5) is essential for assembling the VISA-associated complex to induce a type I interferon antiviral response to Sendai virus infection. However, the roles of WDR5 in DNA virus infections are not well described. Here, we report that human cytomegalovirus exploits WDR5 to facilitate capsid nuclear egress. Overexpression of WDR5 in fibroblasts slightly enhanced the infectious virus yield. However, WDR5 knockdown dramatically reduced infectious virus titers with only a small decrease in viral genome replication or gene expression. Further investigation of late steps of viral replication found that WDR5 knockdown significantly impaired formation of the viral nuclear egress complex and induced substantially fewer infoldings of the inner nuclear membrane. In addition, fewer capsids were associated with these infoldings, and there were fewer capsids in the cytoplasm. Restoration of WDR5 partially reversed these effects. These results suggest that WDR5 knockdown impairs the nuclear egress of capsids, which in turn decreases virus titers. These findings reveal an important role for a host factor whose function(s) is usurped by a viral pathogen to promote efficient replication. Thus, WDR5 represents an interesting regulatory mechanism and a potential antiviral target. IMPORTANCE Human cytomegalovirus (HCMV) has a large (∼235-kb) genome with over 170 open reading frames and exploits numerous cellular factors to facilitate its replication. HCMV infection increases protein levels of WD repeat-containing protein 5 (WDR5) during infection, overexpression of WDR5 enhances viral replication, and knockdown of WDR5 dramatically attenuates viral replication. Our results indicate that WDR5 promotes the nuclear egress of viral capsids, the depletion of WDR5 resulting in a significant decrease in production of infectious virions. This is the first report that WDR5 favors HCMV, a DNA virus, replication and highlights a novel target for antiviral therapy.

Human enteroviruses (EVs) are the most common causative agents infecting human, causing many harmful diseases, such as hand, foot, and mouth disease (HFMD), herpangina (HA), myocarditis, encephalitis, and aseptic meningitis. EV-related diseases pose a serious worldwide threat to public health. To gain comprehensive insight into the seroepidemiology of major prevalent EVs in humans, we firstly performed a serological survey for neutralizing antibodies (nAbs) against Enterovirus A71 (EV-A71), Coxsackie virus A16 (CV-A16), Coxsackie virus A6 (CV-A6), Coxsackie virus A10 (CV-A10), Coxsackie virus B3 (CV-B3), Coxsackie virus B5 (CV-B5), Echovirus 25 (ECHO25), and Echovirus 30 (ECHO30) among the healthy population in Xiamen City in 2016, using micro-neutralization assay. A total of 515 subjects aged 5 months to 83 years were recruited by stratified random sampling. Most major human EVs are widely circulated in Xiamen City and usually infect infants and children. The overall seroprevalence of these eight EVs were ranged from 14.4% to 42.7%, and most of them increased with age and subsequently reached a plateau. The co-existence of nAbs against various EVs are common among people ≥ 7 years of age, due to the alternate infections or co-infections with different serotypes of EVs, while most children were negative for nAb against EVs, especially those

Congenital human cytomegalovirus (HCMV) infection is a leading cause of birth defects, primarily manifesting as neurological disorders. HCMV infection alters expression of cellular microRNAs (miRs) and induces cell cycle arrest, which in turn modifies the cellular environment to favor virus replication. Previous observations found that HCMV infection reduces miR-21 expression in neural progenitor/stem cells (NPCs). Here, we show that infection of NPCs and U-251MG cells represses miR-21 while increasing the levels of Cdc25a, a cell cycle regulator and known target of miR-21. These opposing responses to infection prompted an investigation of the relationship between miR-21, Cdc25a, and viral replication. Overexpression of miR-21 in NPCs and U-251MG cells inhibited viral gene expression, genome replication, and production of infectious progeny, while shRNA-knockdown of miR-21 in U-251MG cells increased viral gene expression. In contrast, overexpression of Cdc25a in U-251MG cells increased viral gene expression and production of infectious progeny and overcame the inhibitory effects of miR-21 overexpression. Three viral gene products—IE1, pp71, and UL26—were shown to inhibit miR-21 expression at the transcriptional level. These results suggest that Cdc25a promotes HCMV replication and elevation of Cdc25a levels after HCMV infection are due in part to HCMV-mediated repression of miR-21. Thus, miR-21 is an intrinsic antiviral factor that is modulated by HCMV infection. This suggests a role for miR-21 downregulation in the neuropathogenesis of HCMV infection of the developing CNS.IMPORTANCEHuman cytomegalovirus (HCMV) is a ubiquitous pathogen and has very high prevalence among population, especially in China, and congenital HCMV infection is a major cause for birth defects. Elucidating virus-host interactions that govern HCMV replication in neuronal cells is critical to understanding the neuropathogenesis of birth defects resulting from congenital infection. In this study, we confirm that HCMV infection downregulates miR-21 but upregulates Cdc25a. Further determined the negative effects of cellular miRNA miR-21 on HCMV replication in neural progenitor/stem cells and U-251MG glioblastoma/astrocytoma cells. More importantly, our results provide the first evidence that miR-21 negatively regulates HCMV replication by targeting Cdc25a, a vital cell cycle regulator. We further found that viral gene products of IE1, pp71, and UL26 play roles in inhibiting miR-21 expression, which in turn causes increases in Cdc25a and benefits HCMV replication. Thus, miR-21 appears to be an intrinsic antiviral factor that represents a potential target for therapeutic intervention.

Congenital human cytomegalovirus (HCMV) infection is the leading cause of neurological disabilities in children worldwide, but the mechanisms underlying these disorders are far from well-defined. HCMV infection has been shown to dysregulate the Notch signaling pathway in human neural progenitor cells (NPCs). As an important downstream effector of Notch signaling, the transcriptional regulator Hairy and Enhancer of Split 1 (Hes1) is essential for governing NPC fate and fetal brain development. In the present study, we report that HCMV infection downregulates Hes1 protein levels in infected NPCs. The HCMV 72-kDa immediate-early 1 protein (IE1) is involved in Hes1 degradation by assembling a ubiquitination complex and promoting Hes1 ubiquitination as a potential E3 ubiquitin ligase, followed by proteasomal degradation of Hes1. Sp100A, an important component of PML nuclear bodies, is identified to be another target of IE1-mediated ubiquitination. A C-terminal acidic region in IE1, spanning amino acids 451 to 475, is required for IE1/Hes1 physical interaction and IE1-mediated Hes1 ubiquitination, but is dispensable for IE1/Sp100A interaction and ubiquitination. Our study suggests a novel mechanism linking downregulation of Hes1 protein to neurodevelopmental disorders caused by HCMV infection. Our findings also complement the current knowledge of herpesviruses by identifying IE1 as the first potential HCMV-encoded E3 ubiquitin ligase., Author summary Congenital human cytomegalovirus (HCMV) infection is the leading cause of neurological disabilities in children, but the underlying pathogenesis of this infection remains unclear. Hes1, an important effector of Notch signaling, governs the fate of neural progenitor cells (NPCs) and fetal brain development. Here we demonstrate that: (1) HCMV infection results in loss of Hes1 protein in NPCs; (2) the HCMV immediate-early 1 protein (IE1) mediates Hes1 protein downregulation through direct interaction, which requires amino acids 451–475; (3) IE1 assembles a Hes1 ubiquitination complex and mediates Hes1 ubiquitination; and (4) IE1 also assembles an Sp100A ubiquitination complex and mediates Sp100A ubiquitination, but does not require amino acids 451–475. These results suggest that HCMV IE1 is a potential E3 ubiquitin ligase. Downregulation of Hes1 by HCMV infection and IE1 implies a novel mechanism linking Hes1 depletion to virus-induced neuropathogenesis.

Background Two lineages of Zika virus (ZIKV) have been classified according to the phylogenetic analysis: African and Asian lineages. It is unclear whether differences exist between the two strains in host cell permissiveness, this information is important for understanding viral pathogenesis and designing anti-viral strategies. Methods In the present study, we comparatively studied the permissive spectrum of human cells for both the African (MR766) and Asian strains (PRVABC59) using an RNA in situ hybridization (RISH) to visualize RNA replication, an immunofluorescence technology, and a western blot assay to determine viral protein production, and a real-time RT-PCR to examine viral RNA multiplication level. The experiments were undertaken in the condition of cell culture. Results We identified several human cell lines, including fibroblast, epithelial cells, brain cells, stem cells, and blood cells that are susceptible for the infection of both Asian and African strains. We did not find any differences between the MR766 and the PRVABC59 in the permissiveness, infection rate, and replication modes. Inconsistent to a previous report (Hamel et al. JVI 89:8880–8896, 2015), using RISH or real-time RT-PCR, we found that human foreskin fibroblast cells were not permissive for ZIKV infection. Instead, human lung fibroblast cells (MRC-5) were fully permissive for ZIKV infection. Surprisingly, a direct interaction of ZIKV RNA with envelop (E) protein (a structure protein) was demonstrated by an RNA chromatin immunoprecipitation (ChIP) assay. Three binding sites were identified in the ZIKV RNA genome for the interaction with the E protein. Conclusion Our results imply that the E protein may be important for viral RNA replication, and provide not only the information of ZIKV permissiveness that guides the usage of human cells for the ZIKV studies, but also the insight into the viral RNA-E protein interaction that may be targeted for intervention by designing small molecule drugs. Electronic supplementary material The online version of this article (doi:10.1186/s12879-017-2338-4) contains supplementary material, which is available to authorized users.

Three crucial hurdles hinder studies on human cytomegalovirus (HCMV): strict species specificity, differences between in vivo and in vitro infection, and the complexity of gene regulation. Ever since the sequencing of the whole genome was first accomplished, functional studies on individual genes have been the mainstream in the CMV field. Gene regulation has therefore been elucidated in a more detailed fashion. However, viral gene regulation is largely controlled by both cellular and viral components. In other words, viral gene expression is determined by the virus-host interaction. Generally, cells respond to viral infection in a defensive pattern; at the same time, viruses try to counteract the cellular defense or else hide in the host (latency). Viruses evolve effective strategies against cellular defense in order to achieve replicative success. Whether or not they are successful, cellular defenses remain in the whole viral replication cycle: entry, immediate-early (IE) gene expression, early gene expression, DNA replication, late gene expression, and viral egress. Many viral strategies against cellular defense, and which occur in the immediate-early time of viral infection, have been documented. In this review, we will summarize the documented biological functions of IE1 and pp71 proteins, especially with regard to how they counteract cellular intrinsic defenses.

Human cytomegalovirus (HCMV) gene expression during infection is characterized as a sequential process including immediate-early (IE), early (E), and late (L)-stage gene expression. The most abundantly expressed gene at the IE stage of infection is the major IE (MIE) gene that produces IE1 and IE2. IE1 has been the focus of study because it is an important protein, not only for viral gene expression but also for viral replication. It is believed that IE1 plays important roles in viral gene regulation by interacting with cellular proteins. In the current study, we performed protein array assays and identified 83 cellular proteins that interact with IE1. Among them, seven are RNA-binding proteins that are important in RNA processing, more than half are nuclear proteins that are involved in gene regulations. Tumorigenesis-related proteins are also found to interact with IE1, implying that the role of IE1 in tumorigenesis might need to be reevaluated. Unexpectedly, cytoplasmic proteins, such as Golgi autoantigen and GGA1 (both related to the Golgi trafficking protein), are also found to be associated with IE1. We also employed a coimmunoprecipitation assay to test the interactions of IE1 and some of the proteins identified in the protein array assays and confirmed that the results from the protein array assays are reliable. Many of the proteins identified by the protein array assay have not been previously reported. Therefore, the functions of the IE1-protein interactions need to be further explored in the future.

The human cytomegalovirus (HCMV) major immediate early (MIE) gene is essential for viral replication. The most abundant products encoded by the MIE gene include IE1 and IE2. Genes of IE1 and IE2 share the MIE promoter (MIEP), the first 3 exons, and the first 2 introns. IE1 is expressed earlier than IE2 after CMV infection or MIE gene transfection. In this study, we identified 2 polypyrimidine (Py) tracts in intron 4 (between exons 4 and 5) that are responsible for transcriptional switching from IE1 to IE2. The first Py is important and the second one is essential for the splicing and expression of IE2. In searching for the mechanisms of MIE gene switching from IE1 to IE2, we found that the second Py was required for the IE2's fourth intron to bind to a splicing factor such as U2AF65, as determined by an RNA electrophoretic mobility shift assay and a chromatin immunoprecipitation (ChIP) assay, while the first Py enhanced the binding of U2AF65 with the intron. An HCMV BACmid with the second Py mutated failed to produce any virus, while the HCMV with the first Py mutated replicated with a defective phenotype. Furthermore, we designed a small RNA (scRNAPy) that is complementary to the intron RNA covering the two Pys. The scRNAPy interfered with the interaction of U2AF65 with the intron and repressed the IE2 expression. Therefore, our studies implied that IE2 gene splicing might be an anti-CMV target. IMPORTANCE CMV is a ubiquitous herpesvirus and a significant cause of disease and death in the immunocompromised and elderly. Insights into its gene regulation will provide clues in designing anti-CMV strategies. The MIE gene is one of the earliest genes of CMV and is essential for CMV replication. It is known that the MIE gene needs to be spliced to produce more than two proteins; however, how MIE gene splicing is regulated remains elusive. In the present studies, we identified two Pys in intron 4 and found that the first Py is important and the second is required for the splicing and expression of IE2. We further investigated the mechanisms of gene switching from IE1 to IE2 and found that the two Pys are responsible for U2AF65's binding with intron 4. Therefore, the Pys in intron 4 are the cis elements that determine the fate of IE2 splicing. Furthermore, we found that a small RNA that is complementary to intron 4 repressed IE2 expression. Hence, we provide the first piece of evidence for a unique mechanism of MIE gene regulation at the splicing level.

Varicella-zoster virus (VZV) is the causative agent of chickenpox and herpes zoster (shingles). After the primary infection, the virus remains latent in sensory ganglia and reactivates upon weakening of the cellular immune system due to various conditions, erupting from sensory neurons and infecting the corresponding skin tissue. The current varicella vaccine is highly attenuated in the skin and yet retains its neurovirulence and may reactivate and damage sensory neurons. The factors involved in neuronal invasion and establishment of latency are still elusive. Previously, we constructed a library of whole-gene deletion mutants carrying a bacterial artificial chromosome sequence and a luciferase marker in order to perform a comprehensive VZV genome functional analysis. Here, screening of dispensable gene deletion mutants in differentiated neuronal cells led to the identification of ORF7 as the first known, likely a main, VZV neurotropic factor. ORF7 is a virion component localized to the Golgi compartment in infected cells, whose deletion causes loss of polykaryon formation in epithelial cell culture. Interestingly, ORF7 deletion completely abolishes viral spread in human nervous tissue ex vivo and in an in vivo mouse model. This finding adds to our previous report that ORF7 is also a skin-tropic factor. The results of our investigation will not only lead to a better understanding of VZV neurotropism but could also contribute to the development of a neuroattenuated vaccine candidate against shingles or a vector for delivery of other antigens.

The Kaposi sarcoma-associated herpesvirus (KSHV; or human herpesvirus-8)-encoded protein called K-bZIP (also named K8) was found to be multifunctional. In this study, we discovered that K-bZIP interacts with histone deacetylase (HDAC) 1/2 in 12-O-tetradecanoylphorbol-13-acetate-stimulated BCBL-1 lymphocyte cells. K-bZIP appears to repress HDAC activity through this interaction, which we determined to be independent of K-bZIP SUMOylation. We dissected the domains of K-bZIP and found that the leucine zipper (LZ) domain is essential for the interaction of K-bZIP and HDAC. In addition, we constructed a KSHV bacterial artificial chromosome (BAC) with LZ domain-deleted K-bZIP (KSHVdLZ) and transfected this mutated KSHV BAC DNA into HEK 293T cells. As a result, it was consistently found that K-bZIP without its LZ domain failed to interact with HDAC2. We also showed that the interaction between K-bZIP and HDAC is necessary for the inhibition of the lytic gene promoters (ORF50 and OriLyt) of KSHV by K-bZIP. Furthermore, we found that the LZ domain is also important for the interaction of K-bZIP with the promoters of ORF50 and OriLyt. Most interestingly, although it was found to have suppressive effects on the promoters of ORF50 and OriLyt, KSHVdLZ replicates at a significantly lower level than its BAC-derived revertant (KSHVdLZRev) or KSHVWT (BAC36) in HEK 293T cells. The defectiveness of KSHVdLZ replication can be partially rescued by siRNA against HDAC2. Our results suggest that the function of K-bZIP interaction with HDAC is two-layered. 1) K-bZIP inhibits HDAC activity generally so that KSHVdLZ replicates at a lower level than does KSHVWT. 2) K-bZIP can recruit HDAC to the promoters of OriLyt and ORF50 through interaction with HDAC for K-bZIP to have a temporary repressive effect on the two promoters.

IFN regulatory factor 7 (IRF7) is a potent transcription factor of type I IFNs and IFN-stimulated genes and is known as the master regulator of type I IFN-dependent immune responses. Because excessive responses could harm the host, IRF7 itself is delicately regulated at the transcriptional, translational, and posttranslational levels. Modification of IRF7 by small ubiquitin-related modifiers (SUMOs) has been shown to regulate IFN expression and antiviral responses negatively, but the specific E3 ligase needed for IRF7 SUMOylation has remained unknown. As reported in this article, we have identified the tripartite motif-containing protein 28 (TRIM28) as a binding partner of IRF7. We have demonstrated that TRIM28 also interacts with the SUMO E2 enzyme and increases SUMOylation of IRF7 both in vivo and in vitro, suggesting it acts as a SUMO E3 ligase of IRF7. Unlike the common SUMO E3 ligase, protein inhibitor of activated STAT1, the E3 activity of TRIM28 is specific to IRF7, because it has little effect on IRF7’s close relative IRF3. TRIM28 is therefore, so far as we know, the first IRF7-specific SUMO E3 reported. TRIM28-mediated SUMOylation of IRF7 is increased during viral infection, and SUMOylation of transcription factors usually results in transcriptional repression. Overexpression of TRIM28 therefore inhibits IRF7 transactivation activity, whereas knockdown of TRIM28 has the opposite effect and potentiates IFN production and antiviral responses. Collectively, our results suggest that TRIM28 is a specific SUMO E3 ligase and negative regulator of IRF7.

Murine cytomegalovirus (MCMV) immediate-early protein 3 (IE3) is essential for successful viral infection. This study developed MCMVs with an EGFP-fused IE3 gene in order to study IE3 gene expression, subnuclear distribution and biological function, as well as to examine the interaction of IE3 with cellular and viral proteins. The generated viruses included MCMVIE3gfp, in which IE1 was completely removed by the in-frame fusion of exons 3 and 5 and the C terminus of IE3 was tagged with EGFP, and MCMVIE1/3gfp, in which IE1 was kept intact and EGFP was also fused to the C terminus of IE3. Unlike human CMV (HCMV), whose growth was significantly reduced when IE2 (the HCMV homologue of IE3 in MCMV) was tagged with EGFP, MCMVs with IE3-EGFP presented an unchanged replication profile. Using these new constructs, the distribution of IE3 was revealed as well as its interaction with viral and cellular proteins, especially proteins pertaining to DNA replication (M44 and E1) and cellular intrinsic defence [promyelocytic leukemia protein and histone deacetylases (HDACs)]. It was also shown that IE3 domains co-localize with DNA replication domains, and IE3 attracted other required proteins into IE3 domains via protein-protein interactions. In addition, IE3 was shown to interact with HDAC2 and to eliminate the inhibitory effect of HDAC2 on early viral gene production. Together, these results suggest that IE3 acts as a key protein for viral DNA replication by establishing pre-replication domains via recruitment of the required viral and cellular proteins, and by reducing host defences.

Herpesvirus lytic DNA replication requires both the cis -acting element, the origin, and trans -acting factors, including virally encoded origin-binding protein, DNA replication enzymes, and auxiliary factors. Two lytic DNA replication origins ( ori - Lyt ) of Kaposi's sarcoma-associated herpesvirus (KSHV) have been identified, and two virally encoded proteins, namely, RTA and K8, have been shown to bind to the origins. In this study, we sought to identify cellular factors that associate with ori - Lyt by using DNA affinity purification and mass spectrometry. This approach led to identification of several cellular proteins that bind to KSHV ori - Lyt . They include topoisomerases (Topo) I and II, MSH2/6, RecQL, poly(ADP-ribose) polymerase I (PARP-1), DNA-PK, Ku86/70 autoantigens, and scaffold attachment factor A (SAF-A). RecQL appears to associate with prereplication complexes and be recruited to ori - Lyt through RTA and K8. Topoisomerases, MSH2, PARP-1, DNA-PK, and Ku86 were not detected in prereplication complexes but were present in replication initiation complexes on ori - Lyt . All these cellular proteins accumulate in viral replication compartments in the nucleus, indicating that these proteins may have a role in viral replication. Topo I and II appear to be essential for viral DNA replication as inhibition of their activities with specific inhibitors (camptothecin and ellipticine) blocked ori - Lyt -dependent DNA replication. Furthermore, inhibition of PARP-1 with chemical inhibitors (3-aminobenzamide and niacinamide) resulted in decreased ori - Lyt -dependent DNA replication, whereas hydroxyurea, which raises PARP-1 activity, caused an increase in the DNA replication, suggesting a positive role for PARP-1 in KSHV lytic DNA replication.

The extracellular signal-regulated kinase (ERK) mitogen-activated protein kinase (MAPK) pathway is essential for infection by a variety of viruses. The p90 ribosomal S6 kinases (RSKs) are direct substrates of ERK and functional mediators of ERK MAPK signaling, but their roles in viral infection have never been examined. We demonstrate that ORF45 of Kaposi's sarcoma-associated herpesvirus (KSHV) interacts with RSK1 and RSK2 and strongly stimulates their kinase activities. The activation of RSK by ORF45 is correlated with ERK activation but does not require MEK. We further demonstrate that RSK1/RSK2 is activated during KSHV primary infection and reactivation from latency; a subset of RSK1/RSK2 is present in the viral replication compartment in the nucleus. Depletion of RSK1/RSK2 by small interfering RNA or the specific inhibitor BI-D1870 suppresses KSHV lytic gene expression and progeny virion production, suggesting an essential role of RSK1/RSK2 in KSHV lytic replication.

Human herpesviruses cause different infectious diseases, resulting in world-wide health problems. Sexual transmission is a major route for the spread of both herpes simplex virus-1 (HSV-1) and -2. Semen plays an important role in carrying the viral particle that invades the vaginal or rectal mucosa and, thereby, initiates viral replication. Previously, we demonstrated that the amyloid fibrils semenogelin (SEM) and semen-derived enhancer of viral infection (SEVI), and seminal plasma (SP) augment cytomegalovirus infection (Tang et al., J. Virol 2013). Whether SEM or SEVI amyloids or SP could also enhance other herpesvirus infections has not been examined. In this study, we found that the two amyloids as well as SP strongly enhance both HSV-1 and -2 infections in cell culture. Along with SP, SEM and SEVI amyloids enhanced viral entry and increased infection rates by more than 10-fold, as assessed by flow cytometry assay and fluorescence microscopy. Viral replication was increased by about 50- to 100-fold. Moreover, viral growth curve assays showed that SEM and SEVI amyloids, as well as SP, sped up the kinetics of HSV replication such that the virus reached its replicative peak more quickly. The interactions of SEM, SEVI, and SP with HSVs are direct. Furthermore, we discovered that the enhancing effects of SP, SEM, and SEVI can be significantly reduced by heparin, a sulfated polysaccharide with an anionic charge. It is probable that heparin abrogates said enhancing effects by interfering with the interaction of the viral particle and the amyloids, which interaction results in the binding of the viral particles and both SEM and SEVI.

Human cytomegalovirus (HCMV) infection of the developing fetus frequently results in major neural developmental damage. In previous studies, HCMV was shown to downregulate neural progenitor/stem cell (NPC) markers and induce abnormal differentiation. As Notch signaling plays a vital role in the maintenance of stem cell status and is a switch that governs NPC differentiation, the effect of HCMV infection on the Notch signaling pathway in NPCs was investigated. HCMV downregulated mRNA levels of Notch1 and its ligand, Jag1, and reduced protein levels and altered the intracellular localization of Jag1 and the intracellular effector form of Notch1, NICD1. These effects required HCMV gene expression and appeared to be mediated through enhanced proteasomal degradation. Transient expression of the viral tegument proteins of pp71 and UL26 reduced NICD1 and Jag1 protein levels endogenously and exogenously. Given the critical role of Notch signaling in NPC growth and differentiation, these findings reveal important mechanisms by which HCMV disturbs neural cell developmentin vitro. Similar eventsin vivomay be associated with HCMV-mediated neuropathogenesis during congenital infection in the fetal brain.IMPORTANCECongenital human cytomegalovirus (HCMV) infection is the leading cause of birth defects that primarily manifest as neurological disabilities. Neural progenitor cells (NPCs), key players in fetal brain development, are the most susceptible cell type for HCMV infection in the fetal brain. Studies have shown that NPCs are fully permissive for HCMV infection, which causes neural cell loss and premature differentiation, thereby perturbing NPC fate. Elucidation of virus-host interactions that govern NPC proliferation and differentiation is critical to understanding neuropathogenesis. The Notch signaling pathway is critical for maintaining stem cell status and functions as a switch for differentiation of NPCs. Our investigation into the impact of HCMV infection on this pathway revealed that HCMV dysregulates Notch signaling by altering expression of the Notch ligand Jag1, Notch1, and its active effector in NPCs. These results suggest a mechanism for the neuropathogenesis induced by HCMV infection that includes altered NPC differentiation and proliferation.

Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin-organizing factor, CTCF, has been found to facilitate human CMV gene expression, which affects viral replication. We also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV (MCMV) that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression.

Among the modes of transmission available to the cytomegalovirus (CMV) is sexual transmission, primarily via semen. Both male-to-female (M-F) and male-to-male (M-M) sexual transmission significantly contribute toward the spread of CMV infections in the global population. Semen plays an important role in carrying the viral particle that invades the vaginal or rectal mucosa, thereby initiating viral replication. Both semen and seminal plasma (SP) can enhance HIV-1 infection in cell culture, and two amyloid fibrils, semen-derived enhancer of viral infection (SEVI) and amyloids derived from the semenogelins (SEM amyloids), have been identified as seminal factors sufficient to enhance HIV-1 infection (J. Munch et al., Cell 131: 1059–1071, 2007; N. R. Roan et al., Cell Host Microbe 10: 541–550, 2011; F. Arnold et al., J. Virol. 86:1244–1249, 2012). Whether SP, SEVI, or SEM amyloids can enhance other viral infections has not been extensively examined. In this study, we found that SP, SEVI, and SEM amyloids strongly enhance both human CMV (HCMV) and murine CMV infection in cell culture. SEVI and SEM amyloids increased infection rates by >10-fold, as determined by both flow cytometry and fluorescence microscopy. Viral replication was increased by 50- to 100-fold. Moreover, viral growth curve assays showed that SP, SEVI, and SEM amyloids sped up the kinetics of CMV replication such that the virus reached its replicative peak more quickly. Finally, we discovered that SEM amyloids and SEVI counteracted the effect of anti-gH in protecting against CMV infection. Collectively, the data suggest that semen enhances CMV infection through interactions between semen amyloid fibrils and viral particles, and these interactions may prevent HCMV from being neutralized by anti-gH antibody.

Background DNA viruses, such as herpes simplex virus type 1 (HSV-1), Simian virus 40 (SV40), and Cytomegaloviruses (CMV), start their replicative processes and transcription at specific nuclear domains known as ND10 (nuclear domain 10, also called PML bodies). It has been previously determined that for HSV-1 and SV40, a short DNA sequence and its binding protein are required and sufficient for cell localization of viral DNA replication and gene transcription. Results Our recent observations provide evidence that a foreign (not endogenous) DNA/protein complex in the nucleus recruits ND10 proteins. First, the complexes formed from the bacterial lac operator DNA and its binding protein (lac repressor), or from HPV11 (human papillomavirus 11) origin DNA and its binding protein (E2), co-localized with different ND10 proteins. Second, the HSV-1 amplicon without inserted lac operator DNA repeats distributed in the nucleus randomly, whereas the amplicon with lac operator DNA repeats associated with ND10, suggesting that DNA-binding proteins are required to localize at ND10. The cellular intrinsic DNA/protein complex (as detected for U2 DNA) showed no association with ND10. Furthermore, our examination of PML−/−, Daxx−/−, and Sp100-negative cells led to our discovering that DNA/protein complexes recruit ND10 protein independently. Using the GFP-LacI/Operator system, we were able to direct the transfected DNA to ND10 and found that gene expression was significantly repressed when the transfected DNA was directed to ND10. Conclusion Taken together, the results suggest that cells recognize DNA/protein complexes through a mechanism that involves interaction with the ND10-associated proteins.

Species-specificity is one of the major characteristics of cytomegaloviruses (CMVs) and is the primary reason for the lack of a mouse model for the direct infection of human CMV (HCMV). It has been determined that CMV cross-species infections are blocked at the post-entry level by intrinsic cellular defense mechanisms, but few details are known. It is important to explore how CMVs interact with the subnuclear structure of the cross-species host cell. In our present study, we discovered that nuclear domain 10 (ND10) of human cells was not disrupted by murine CMV (MCMV) and that the ND10 of mouse cells was not disrupted by HCMV, although the ND10-disrupting protein, immediate-early protein 1 (IE1), also colocalized with ND10 in cross-species infections. In addition, we found that the UL131-repaired HCMV strain AD169 (vDW215-BADrUL131) can infect mouse cells to produce immediate-early (IE) and early (E) proteins but that neither DNA replication nor viral particles were detectable in mouse cells. Unrepaired AD169 can express IE1 only in mouse cells. In both HCMV-infected mouse cells and MCMV-infected human cells, the knocking-down of ND10 components (PML, Daxx, and SP100) resulted in significantly increased viral-protein production. Our observations provide evidence to support our hypothesis that ND10 and ND10 components might be important defensive factors against the CMV cross-species infection.

Background Kaposi's sarcoma-associated herpesvirus (KSHV; also known as human herpesvirus 8 (HHV-8)) has been determined to be the most frequent cause of malignancies in AIDS patients. It is associated primarily with Kaposi's sarcoma (KS) and primary effusion lymphoma (PEL), as well as with multicentric Castleman's disease (MCD). 2 The switch from the latent to the lytic stage is important in the maintenance of malignancy and viral infection. So far, the mechanism of its reactivation has not been fully understood. Objectives Human cytomegalovirus (HCMV) and KSHV might infect the same cells, and it was found by other groups that several viruses could reactivate KSHV from latency. We investigate whether HCMV infection could reactivate KSHV from latency in body cavity-based lymphocyte (BCBL-1) cells. Study design and results Laboratory strains of HCMV cannot infect B cells. In this article, we demonstrate that the UL131-repaired HCMV (vDW215-BADrUL131) derived from AD169 strain is able to infect B lymphocytes. We directly infected KSHV latent cells including BCBL-1 with vDW215-BADrUL131 to evaluate the ability of HCMV to reactivate KSHV. Inconsistent with previous reports in human fibroblast cells, our results provide direct evidence that HCMV is unable to reactivate KSHV from latency-to-lytic infection in BCBL-1 cell lines. As a control, herpes simplex virus type 1 (HSV-1) was shown to be able to reactivate KSHV. Conclusions Our observations, different from others, suggest that reactivation mechanisms for KSHV might vary in different cells.

Murine cytomegalovirus (MCMV) and human CMV (HCMV) share many features making the mouse system a potential small-animal model for HCMV. Although the genomic DNA sequence and the predicted open reading frames (ORFs) of MCMV have been determined, experimental evidence that the ORFs are actually transcribed has been lacking. We developed an MCMV global-DNA microarray that includes all previously predicted ORFs and 14 potential ones. A total of 172 ORFs were confirmed to be transcribed, including 7 newly discovered ORFs not previously predicted. No gene products from 10 previously predicted ORFs were detected by either DNA microarray analysis or reverse transcriptase PCR in MCMV-infected mouse fibroblasts, although 2 of those were expressed in a macrophage cell line, suggesting that potential gene products from these open reading fames are silenced in fibroblasts and required in macrophages. Immunohistochemical localization of the six newly described ORF products and three recently identified ones in cells transfected with the respective construct revealed four of the products in the nucleus and five in mitochondria. Analysis of two ORFs using site-directed mutagenesis showed that deletion of one of the mitochondrion-localized gene products led to significantly decreased replication in fibroblasts.

DNA viruses such as herpes simplex virus type 1 (HSV-1) appear to start their replicative processes at specific nuclear domains known as ND10. In analyses to determine the minimum viral components needed for transcript accumulation at ND10, we find that a specific viral DNA sequence, OriS, and the viral immediate-early proteins ICP4 and ICP27 are sufficient for a reporter gene placed in cis to the OriS sequence to transcribe at ND10. A chromatin immunoprecipitation assay demonstrated expected critical intermediates in retaining the minimal genome at ND10 for the HSV-1 replication origin through direct or indirect binding to the host protein Daxx. Coimmunoprecipitation assays with antibodies to Daxx and ICP4, ICP27, and ICP8 showed that the respective proteins interact, possibly forming a complex. A potential complex between the origin, early viral DNA-binding protein ICP8 and Daxx did not result in transcription at ND10. Thus, the deposition of transcriptionally active HSV-1 genomes at ND10 is most likely a consequence of retention at ND10 through the interaction of viral genome-bound ICP4 and ICP27 with Daxx. Such a complex might be more likely immobilized at the outside of ND10 by the PML-interacting Daxx than at other nuclear sites.