Search

Author Manuscript 2011 April 29., Epidermal growth factor receptor (EGFR)-mediated signaling helps regulate bone development and healing through its effects on osteogenic cells. Here, we show how EGFR activity and osteogenic differentiation responses in primary human bone marrow-derived multipotent stromal cells (MSCs) are influenced by presenting covalently tethered epidermal growth factor (tEGF) on the culture substratum, a presentation mode that reduces EGFR internalization and restricts signaling to the cell surface. In both absence and presence of tEGF, MSCs increase expression levels of EGFR and its heterodimerization partner HER2 during the course of osteogenic differentiation. tEGF substrata increased levels of phosphorylated EGFR and phosphorylated extracellular regulated kinase (ERK) compared to control substrata, and these elevations were associated with a twofold enhancement of MSC alkaline phosphatase activity at day 7 and matrix mineralization at day 21. Surprisingly, addition of soluble EGF (sEGF) to cells cultured on tEGF substrata reduces osteogenic differentiation, even though EGFR signaling is more strongly activated in acute, short-term manner by sEGF treatment than by tEGF treatment. A striking concomitant result of the sEGF effects is near-complete downregulation of EGFR and HER2, demonstrating that the tEGF/EGFR interaction is dynamically reversible even though temporally sustained. Taken together, our results show that enhanced MSC osteogenic differentiation corresponds to a sustained combination of receptor expression and ligand presentation, both of which are maintained by tEGF., National Institutes of Health (U.S.) (Grant R01-GM059870-07), National Institutes of Health (U.S.) (Grant R01-DE 019523-10), National Institutes of Health (U.S.) (Grant P40RR017447), United Negro College Fund (Merck Postdoctoral Fellowship), Georgia Institute of Technology (FACES Fellowship), National Center for Research Resources (U.S.) (Grant P40RR017447)

Strategies to combine aspirated marrow cells with scaffolds to treat connective tissue defects are gaining increasing clinical attention and use. In situations such as large defects where initial survival and proliferation of transplanted connective tissue progenitors (CTPs) are limiting, therapeutic outcomes might be improved by using the scaffold to deliver growth factors that promote the early stages of cell function in the graft. Signaling by the epidermal growth factor receptor (EGFR) plays a role in cell survival and has been implicated in bone development and homeostasis. Providing epidermal growth factor (EGF) in a scaffold-tethered format may sustain local delivery and shift EGFR signaling to pro-survival modes compared to soluble ligand. We therefore examined the effect of tethered EGF on osteogenic colony formation from human bone marrow aspirates in the context of three different adhesion environments using a total of 39 donors. We found that tethered EGF, but not soluble EGF, increased the numbers of colonies formed regardless of adhesion background, and that tethered EGF did not impair early stages of osteogenic differentiation., National Institute of General Medical Sciences (U.S.) (Grant NIH RO1 AR42997), National Institute of General Medical Sciences (U.S.) (Grant NIH RO1 AG024980), National Institute of General Medical Sciences (U.S.) (Grant NIH RO1 GM59870), National Institute of General Medical Sciences (U.S.) (Grant NIH DE019523)

Profilin-1 (Pfn1), a ubiquitously expressed actin-binding protein, has been regarded as a tumor-suppressor molecule for breast cancer. Since AKT signaling impacts cell survival and proliferation, in this study we investigated whether AKT activation in breast cancer cells is sensitive to perturbation of Pfn1 expression. We found that even a moderate overexpression of Pfn1 leads to a significant reduction in phosphorylation of AKT in MDA-MB-231 breast cancer cells. We further demonstrated that Pfn1 overexpression in MDA-MB-231 cells is associated with a significant reduction in the level of the phosphoinositide regulator of AKT, PIP(3), and impaired membrane translocation of AKT that is required for AKT activation, in response to EGF stimulation. Interestingly, Pfn1-overexpressing cells showed post-transcriptional upregulation of PTEN. Furthermore, when PTEN expression was silenced, AKT phosphorylation was rescued, suggesting PTEN upregulation is responsible for Pfn1-dependent attenuation of AKT activation in MDA-MB-231 cells. Pfn1 overexpression induced PTEN upregulation and reduced AKT activation were also reproducible features of BT474 breast cancer cells. These findings may provide mechanistic insights underlying at least some of the tumor-suppressive properties of Pfn1.

Activation of the EGF receptor tyrosine kinase by ligand indirectly activates a series of other cellular enzymes, including protein kinase C. To test the hypothesis that phosphorylation of the EGF receptor by protein kinase C provides an intracellular negative feedback loop to attenuate EGF receptor signaling, we used scanning EM to follow the characteristic EGF-induced retraction of lamellipodia and concomitant cell shape changes. Wild type and mutant EGF receptors were expressed in receptor-deficient NR6 cells. The mutant receptors were prepared by truncation at C' terminal residue 973 (c'973) to provide resistance to ligand-induced down regulation that strongly attenuates receptor signaling and by replacement of threonine 654 (T654) with alanine (A654) to remove the site of phosphorylation by protein kinase C. Cells expressing WT and c'973 EGF receptors demonstrated characteristic lamellipodial retraction after exposure to EGF, with the non-down regulating c'973 EGF receptors responding more rapidly. Exposure of cells to TPA blocked this response. Replacement of T654 by alanine resulted in EGF receptors that were resistant to TPA. Cells expressing the A654 mutation underwent more rapid and more extensive morphologic changes than cells with the corresponding T654 EGF receptor. In cells expressing T654 EGF receptors, down regulation of protein kinase C resulted in more rapid and extensive EGF-induced changes similar to those seen in cells expressing A654 EGF receptors. These data indicate that activation of protein kinase C and subsequent phosphorylation of the EGF receptor at T654 lead to rapid physiological attenuation of EGF receptor signaling.

In skin wounds, the chemokine CXCR3 receptor appears to play a key role in coordinating the switch from regeneration of the ontogenically distinct mesenchymal and epithelial compartments toward maturation. However, because CXCR3 equivalently binds four different ELR-devoid CXC chemokines (ie, PF4/CXCL4, IP-10/CXCL10, MIG/CXCL9, and IP-9/CXCL11), we sought to identify the ligand that coordinates epidermal coverage with the maturation of the underlying superficial dermis. Because CXCL11 (IP-9 or I-TAC) is produced by redifferentiating keratinocytes late in the regenerative phase when re-epithelialization is completed and matrix maturation ensues, we generated mice in which an antisense construct (IP-9AS) eliminated IP-9 expression during the wound-healing process. Both full and partial thickness excisional wounds were created and analyzed histologically throughout a 2-month period. Wound healing was impaired in the IP-9AS mice, with a hypercellular and immature dermis noted even after 60 days. Re-epithelialization was delayed with a deficient delineating basement membrane persisting in mice expressing the IP-9AS construct. Provisional matrix components persisted in the dermis, and the mature basement membrane components laminin V and collagen IV were severely diminished. Interestingly, the inflammatory response was not diminished despite IP-9/I-TAC being chemotactic for such cells. We conclude that IP-9 is a key ligand in the CXCR3 signaling system for wound repair, promoting re-epithelialization and modulating the maturation of the superficial dermis.

For chemosensitivity and resistance assays to be clinically useful in predicting patient outcome, they should require small amounts of tissue and be highly reproducible and reliable.Expanded tumor cells from transcutaneous biopsies of breast lesions (n=62) were tested for chemoresponse using the cell-based ChemoFx assay. Pathologic complete response (pCR) was determined on a subset of patients (n=34). Assay score and pCR were determined independently in a blinded manner. Logistic regression models were used to select predictors for response.Tumor cells were successfully isolated from 83.9% of patients. Chemoresponse profiles were robust and reproducible with coefficient of variance of3%. In a limited initial patient outcome correlation, assay score of docetaxel/capecitabine significantly predicted pCR; the cross-validated model was 75% accurate.It is feasible to assess the chemoresponsiveness of small breast lesions using the ChemoFx assay to assist in choosing neoadjuvant chemotherapy for breast cancer patients.

Epidermal growth factor (EGF) receptor-mediated cell migration plays a vital role in invasion of many tumor types. EGF receptor ligands increase invasiveness in vivo, but it remains unclear how consequent effects on intrinsic cell motility behavior versus effects on extrinsic matrix properties integrate to result in net increase of translational speed and/or directional persistence of migration in a 3D environment. Understanding this convolution is important for therapeutic targeting of tumor invasion, as key regulatory pathways for intrinsic versus extrinsic effects may not be coincident. Accordingly, we have undertaken a quantitative single-cell imaging study of glioblastoma cell movement in 3D matrices and on 2D substrata across a range of collagen densities with systematic variation of protease-mediated matrix degradation. In 3D, EGF induced a mild increase in cell speed and a strong increase in directional persistence, the latter depending heavily on matrix density and EGF-stimulated protease activity. In contrast, in 2D, EGF induced a similarly mild increase in speed but conversely a decrease in directional persistence (both independent of protease activity). Thus, the EGF-enhanced 3D tumor cell migration results only partially from cell-intrinsic effects, with override of cell-intrinsic persistence decrease by protease-mediated cell-extrinsic reduction of matrix steric hindrance.

Purpose: Mortality from head and neck squamous cell carcinoma (HNSCC) is usually associated with locoregional invasion of the tumor into vital organs, including the airway. Understanding the signaling mechanisms that abrogate HNSCC invasion may reveal novel therapeutic targets for intervention. The purpose of this study was to investigate the efficacy of combined inhibition of c-Src and PLCγ-1 in the abrogation of HNSCC invasion. Experimental Design: PLCγ-1 and c-Src inhibition was achieved by a combination of small molecule inhibitors and dominant negative approaches. The effect of inhibition of PLCγ-1 and c-Src on invasion of HNSCC cells was assessed in an in vitro Matrigel-coated transwell invasion assay. In addition, the immunoprecipitation reactions and in silico database mining was used to examine the interactions between PLCγ-1 and c-Src. Results: Here, we show that inhibition of PLCγ-1 or c-Src with the PLC inhibitor U73122 or the Src family inhibitor AZD0530 or using dominant-negative constructs attenuated epidermal growth factor (EGF)–stimulated HNSCC invasion. Furthermore, EGF stimulation increased the association between PLCγ-1 and c-Src in HNSCC cells. Combined inhibition of PLCγ-1 and c-Src resulted in further attenuation of HNSCC cell invasion in vitro. Conclusions: These cumulative results suggest that PLCγ-1 and c-Src activation contribute to HNSCC invasion downstream of EGF receptor and that targeting these pathways may be a novel strategy to prevent tumor invasion in HNSCC.

The fibroplasia noted during wound repair is resolved by fibroblast cell death. How fibroblasts undergo death and how this is prevented by trophic growth factors present during the regenerative phase are unknown at the molecular level. We examined a model of staurosporine-induced apoptosis in fibroblasts. We demonstrated that epidermal growth factor (EGF) stimulation of fibroblast NR6WT expressing human EGF receptors blocks staurosporine-induced apoptosis by inhibiting the activation of caspase-3. The survival effect of EGF on rescuing apoptotic NR6WT involves signaling pathways that derive from PI3K and Rac; the blockade of apoptosis is abolished when PI3K and Rac signals are inhibited simultaneously. Furthermore, by using KP372-1, a specific Akt inhibitor, we found that downstream of Akt signaling pathways is absolutely required for the EGF rescue from staurosporine-induced apoptosis in NR6WT. Interestingly, EGF prevention of apoptosis induced by tumor necrosis factor-alpha in the face of cycloheximide blockade of protein translation occurs via a different set of pathways as the simultaneous inhibition of extracellular signal-regulated kinase, Rac, and PI3K signaling did not eliminate EGF from rescuing fibroblasts in the face of this cytokine. These findings indicate that EGF receptor activation provides survival response against staurosporine-induced apoptosis through signal pathways of PI3K and Rac, which then may prevent the activation of caspase-3.

Training of residents in the discipline of laboratory medicine is confounded by the diversity of the subdisciplines of clinical pathology each with specific knowledge sets, and the career goals of the residents who are focused on different aspects of clinical pathology. What guides this training is not the detailed knowledge sets or the specific technologies per se, but a focus on the principles that undergird all of laboratory medicine. Thus, the goal of clinical pathology training is to develop a clinical consultant who can apply laboratory-derived, population-based clinical data and laboratory-based therapeutics, along with a firm knowledge of the underlying biotechnology from which these are derived, to the benefit of individual patients. Furthermore, this pathologist must be steeped in the skills required for lifelong learning and adaptation.

Metastatic seeding leads to most of the morbidity from carcinomas. However, little is known of this key event as current methods to study the cellular behaviors utilize nonrepresentative in vitro models or follow indirect subsequent developments in vivo. Therefore, we developed a system to visualize over a multiday to multiweek period the interactions between tumor cells and target organ parenchyma. We employ an ex vivo microscale perfusion culture system that provides a tissue-relevant environment to assess metastatic seeding behavior. The bioreactor recreates many features of the fluid flow, scale, and biological functionality of a hepatic parenchyma, a common site of metastatic spread for a wide range of carcinomas. As a test of this model, prostate and breast carcinoma cells were introduced. Tumor cell invasion and expansion could be observed by two-photon microscopy of red fluorescent protein (RFP)- and CellTracker-labeled carcinoma cells against a green fluorescent protein (GFP)-labeled hepatic tissue bed over a 14-day period. Tumors visible to the naked eye could be formed by day 25, without evident necrosis in the0.3-mm tumor mass. These tumor cells failed to grow in the absence of the supporting three-dimensional (3D) hepatic microtissue, suggesting paracrine or stromal support function for the liver structure in tumor progression. Initial ultrastructural studies suggest that early during the tumor-parenchyma interactions, there are extensive interactions between and accommodations of the cancer and host cells, suggesting that the tumor-related epithelial-mesenchymal transition (EMT) reverts, at least transiently, to promote metastatic seeding. In sum, our 3D ex vivo organotypic liver tissue system presents a critical vehicle to examine tumor-host interactions during cancer metastasis and/or invasion. It also circumvents current limitations in assays to assess early events in metastasis, and provides new approaches to study molecular events during tumor progression.

Background: Computational models of cell signaling networks typically are aimed at capturing dynamics of molecular components to derive quantitative insights from prior experimental data, and to make predictions concerning altered dynamics under different conditions. However, signaling network models have rarely been used to predict how cell phenotypic behaviors result from the integrated operation of these networks. We recently developed a decision tree model for how EGF-induced fibroblast cell motility across two-dimensional fibronectin-coated surfaces depends on the integrated activation status of five key signaling nodes, including a proximal regulator of transcellular contractile force generation, MLC (myosin light chain) [Hautaniemi et al, Bioinformatics 21: 2027 {2005}], but we have not previously attempted predictions of new experimental effects from this model. Results: In this new work, we construct an improved decision tree model for the combined influence of EGF and fibronectin on fibroblast cell migration based on a wider spectrum of experimental protein signaling and cell motility measurements, and directly test a significant and non-intuitive a priori prediction for the outcome of a targeted molecular intervention into the signaling network: that partially reducing activation of MLC would increase cell motility on moderately adhesive surfaces. This prediction was indeed confirmed experimentally: partial inhibition of the activating MLC kinase (MLCK) upstream using the pharmacologic agent ML-7 resulted in increased motility of NR6 fibroblasts. We further extended this exciting finding by showing that partial reduction of MLC activation similarly enhanced the transmigration of the human breast carcinoma cell line MDA-213 through a Matrigel barrier. Conclusion: These findings specifically highlight a central regulatory role for transcellular contractility in governing cell motility, while at the same time demonstrating the value of a decision tree approach to a systems "signal-response" model in discerning non-intuitive behavior arising from integrated operation a cell signaling network., National Institute of General Medical Sciences (U.S.) (Cell Migration Consortium grant U54-GM64346), National Institute of General Medical Sciences (U.S.) (grant R01-GM69668), United States. National Cancer Institute.Integrative Cancer Biology Program (grant U54-CA112967), Biocentrum Helsinki

MSC can act as a pluripotent source of reparative cells during injury and therefore have great potential in regenerative medicine and tissue engineering. However, the response of MSC to many growth factors and cytokines is unknown. Many envisioned applications of MSC, such as treating large defects in bone, involve in vivo implantation of MSC attached to a scaffold, a process that creates an acute inflammatory environment that may be hostile to MSC survival. Here, we investigated cellular responses of MSC on a biomaterial surface covalently modified with epidermal growth factor (EGF). We found that surface-tethered EGF promotes both cell spreading and survival more strongly than saturating concentrations of soluble EGF. By sustaining mitogen-activated protein kinase kinase-extracellular-regulated kinase signaling, tethered EGF increases the contact of MSC with an otherwise moderately adhesive synthetic polymer and confers resistance to cell death induced by the proinflammatory cytokine, Fas ligand. We concluded that tethered EGF may offer a protective advantage to MSC in vivo during acute inflammatory reactions to tissue engineering scaffolds. The tethered EGF-modified polymers described here could be used together with structural materials to construct MSC scaffolds for the treatment of hard-tissue lesions, such as large bony defects.Disclosure of potential conflicts of interest is found at the end of this article.

Keloid scars after skin trauma are a significant clinical problem, especially in black populations, in which the incidence of keloids has been estimated at 4-16%. Keloids are abnormal dermal proliferative scars secondary to dysregulated wound healing. Despite several biochemical studies on the role of extracellular matrix proteins and growth factors during keloid formation, we still do not know what molecules and signals induce this change. Fibroblasts are thought to be the major inductive cell for keloid scar formation. The aim of this study was to identify gene expression patterns that characterize keloid fibroblasts; identifying such genetic disequilibrium may shed light on the molecular signaling events responsible for keloid formation. In this study, we performed gene expression analysis of fibroblasts isolated from keloid lesions from three individuals in comparison with the fibroblasts isolated from normal skin using the Affymetrix U133a chip (22,284 genes and expression sequence tags). We found through J5 test score expression analysis that among 22,284 genes, there were 43 genes that were overexpressed and five genes were underexpressed in keloid fibroblasts when compared with dermal fibroblasts from persons without keloids. The overexpression of three genes not previously reported as being up-regulated in keloids (annexin A2, Transgelin, and RPS18) was confirmed by real-time polymerase chain reaction. Certain overexpressed genes were similar to previous biochemical observations on the protein levels of these overexpressed genes during keloid formation. We also report for the first time that a few tumor-related genes are overexpressed in keloid fibroblasts.

Growth factor-induced migration is a rate-limiting step in tumour invasiveness. The molecules that regulate this cellular behaviour would represent novel targets for limiting tumour cell progression. Epidermal growth factor (EGF) receptor (EGFR)-mediated motility, present in both autocrine and paracrine modes in prostate carcinomas, requires de novo transcription to persist over times greater than a few hours. Therefore, we sought to define specific signalling pathways that directly alter cellular transcription. Signal transducer and activator of transcription 3 (STAT3) is activated, as determined by electrophoretic motility shift assays, by EGFR in DU145 and PC3 human prostate carcinoma cells in addition to the motility model NR6 fibroblast cell line. Inhibition of STAT3 activity by antisense or siRNA downregulation or expression of a dominant-negative construct limited cell motility as determined by an in vitro wound healing assay and invasiveness through a extracellular matrix barrier. The expression of constitutively activated STAT3 did not increase the migration, which indicates that STAT3 is necessary but not sufficient for EGFR-mediated migration. These findings suggest that STAT3 signalling may be a new target for limiting prostate tumour cell invasion. In a microarray gene analysis of what transcription units are altered by EGF in a STAT3-dependent manner we found that the expression of motility-limiting VASP protein and the apoptosis nexus caspase 3 were both downregulated upon EGF exposure. These findings suggest a molecular basis for the STAT3 dependence of EGFR-mediated prostate tumour progression.

Tumor progression to the invasive phenotype occurs secondary to upregulated signaling from growth factor receptors that drive key cellular responses like proliferation, migration, and invasion. We hypothesized that Protein kinase Cdelta (PKCdelta)-mediated transcellular contractility is required for migration and invasion of prostate tumor cells. Two invasive human prostate cancer cell lines, DU145 cells overexpressing wildtype human EGFR (DU145WT) and PC3 cells, were studied. PKCdelta is overexpressed in these cells relative to normal prostate epithelial cells, and is activated downstream of EGFR leading to cell motility via modulation of myosin light chain activity. Abrogation of PKCdelta using Rottlerin and specific siRNA significantly decreased migration and invasion of both cell lines in vitro. Both PKCdelta and phosphorylated PKCdelta protein levels were higher in human prostate cancer tissue relative to normal donor prostate as assessed by Western blotting and immunohistochemistry. Thus, we conclude that PKCdelta inhibition can limit migration and invasion of prostate cancer cells.

Angiogenesis plays a critical role in wound repair. Endothelial cells present CXC receptor 3 (CXCR3) for chemokines expressed late in wound regeneration. To understand the physiological role CXCR3 plays in regulating endothelial function, we analyzed the ability of a CXCR3 ligand, IP-10 (CXCL10), to influence endothelial cell tube formation. Treatment of endothelial cells with IP-10 in the presence of vascular endothelial growth factor (VEGF) inhibited tube formation on growth factor-reduced Matrigel and in a subcutaneous Matrigel plug. Furthermore, IP-10 significantly inhibited VEGF-induced endothelial motility, a response critical for angiogenesis. Previous work showed that CXCR3 ligandation initiates protein kinase A (PKA) phosphorylation-dependent inhibition of m-calpain, required for induced cell motility, in fibroblasts but not epithelial cells. Here we show that CXCR3 activation in endothelial cells induces an increase in cAMP and PKA activation. Treatment of endothelial cells with Rp-8-Br-cAMP, an inhibitor of PKA, or small interference RNA to PKA was able to reverse the inhibitory effects of IP-10 on VEGF-mediated tube formation and motility. Importantly, treatment of endothelial cells with VEGF induced the activation of m-calpain, but costimulation with IP-10 significantly decreased this activity. Using Rp-8-Br-cAMP, we show blocking PKA reversed the IP-10 inhibition of VEGF-induced m-calpain activity. These data indicate that the activation of CXCR3 inhibits endothelial tube formation through a PKA mediated inhibition of m-calpain. This provides a means by which late wound repair signals limit the angiogenesis driven early in the wound response process.

Ten years have passed since the Graylyn Conference Report on Laboratory Medicine Clinical Pathology training was issued. Over that period, the Accreditation Council for Graduate Medical Education substantially revised the requirements for training programs; the American Board of Pathology amended both the requirements and the periods needed for certification; and the discipline itself, along with the broader discipline of pathology, evolved significantly. Recently, a curriculum proposal in anatomical pathology was published as a potential template to be used by training programs to help meet these new and evolving needs. Toward the same end, the Academy of Clinical Laboratory Physicians and Scientists has now developed a template for a curriculum in clinical pathology (laboratory medicine), taking into account newly designated and revised areas of residency core competency, the alterations in training requirements promulgated by the Accreditation Council for Graduate Medical Education and American Board of Pathology, and the rapidly developing nature of the discipline itself. The proposed clinical pathology curriculum defines goals and objectives for training, provides guidelines for instructional methods, and gives examples of how outcomes can be assessed. This curriculum is presented as a potentially helpful outline for use by pathology residency training programs.

Bone marrow mesenchymal stem cells (BMMSCs) are pluripotent cells capable of differentiating into several cell types and are thus an attractive cell source for connective tissue engineering. A challenge in such a use is expansion and directed seeding in vitro, requiring proliferation and survival, and directed migration, respectively, prior to functional differentiation. The epidermal growth factor (EGF) receptor (EGFR) is the prototypal growth factor receptor and elicits these responses from a wide variety of stromal, epithelial, and endothelial cells. Ligands for this receptor are appealing for use in tissue engineering because they are relatively resistant to biological extremes and amenable to high-volume production. Therefore, we determined whether an EGFR ligand, EGF, could be used for ex vivo expansion of BMMSCs. EGF stimulated motility in rat and immortalized human BMMSCs. EGF-induced proliferation was observed in immortalized human BMMSCs but was not apparent in rat BMMSCs under our experimental conditions. EGF did not, however, rescue either type of BMMSC from apoptosis due to lack of serum. During our examination of key signaling intermediaries, EGF caused robust phosphorylation of extracellular signal-regulated protein kinase (ERK) and protein kinase B/akt (AKT) but only minimal phosphorylation of EGFR and phospholipase C-γ in rat BMMSCs, whereas in the human BMMSCs these intermediaries were all strongly activated. EGF also induced robust ERK activation in primary porcine mesenchymal stem cells. EGF pretreatment or cotreatment did not interfere with secondarily induced differentiation of either type of BMMSC into adipogenic or osteogenic lineages. Platelet-derived growth factor (PDGF) effects were similar to but not additive with those elicited by EGF, with some quantitative differences; however, PDGF did interfere with the differentiation of these BMMSCs. These findings suggest that EGFR ligands could be used for ex vivo expansion and direction of BMMSCs.

Cell adhesion and its role during cell spreading and motility are central to normal development and homeostasis, including its effects on immune response and wound repair and tissue regeneration. Disruption of cell adhesion impacts not only the healing process but promotes tumor invasion and metastasis. A family of intracellular, limited proteases, the calpains, has recently been shown to be a key molecular control point in attachment of cells to the surrounding matrix. Herein, the two main and ubiquitously expressed calpain isoforms will be introduced as to their modes of regulation and the current status of research will be discussed as to how these calpains might function in the biophysical process of adhesion and biological cellular responses of spreading and motility.

Chemokine receptor 7 (CCR7) upregulation, which mediates immune cell survival and migration to lymph nodes, has recently been associated with nodal metastasis of squamous cell carcinoma of the head and neck (SCCHN). However, the mechanism of CCR7 in tumor progression, its downstream signaling mediators, and interactions with other pathways contributing to metastasis of SCCHN have not been determined. We hypothesized that inflammatory chemokine-mediated signals could also promote tumor proliferation and mitogenic effects. Functional assays showed that chemotaxis and invasion of metastatic SCCHN cells were dependent on phosphoinositide-3 kinase (PI3K) and its substrate, activated phospholipase Cgamma-1. In addition, treatment of CCR7(+) metastatic SCCHN cells with CCL19 (MIP-3beta) showed rapid activation of the prosurvival, PI3K/Akt pathway. Transactivation of EGFR-mediated and mitogen-activated protein kinase signaling pathways, which can promote migration and survival in parallel, did not appear to contribute to the functional or biochemical effects of CCR7 stimulation. Thus, proinflammatory chemokine signals that mediate activation, trafficking and survival of tumor-infiltrating immune cells in the tumor microenvironment actually appear to induce signals for progression of cancer cells. The CCR7-mediated pathway in metastatic SCCHN cells functions independently of EGFR signal transduction and therefore may represent an additional target for therapeutic intervention to prevent tumor progression and metastasis.

Originally characterized as a growth factor for erythrocytes, erythropoietin (EPO) is used to treat anemia and fatigue in cancer patients receiving radiation therapy and chemotherapy. EPO and the EPO receptor (EPOR) are expressed in nonhematopoietic cells and cancers. However, the role of EPO and EPOR within nonhematopoietic cancer cells remains incompletely understood. Although a recent clinical trial demonstrated worse tumor control and survival in head and neck cancer patients treated with EPO, the role of EPO and EPOR in head and neck squamous cell carcinoma (HNSCC) has not been examined. In the present study, we demonstrate the previously unrecognized EPO-mediated invasion by HNSCC cells through the Janus kinase (JAK)-signal transducer and activator of transcription (STAT) signaling pathway. Furthermore, we confirmed the expression of EPO and EPOR in a panel of human HNSCC cell lines and tissue specimens. Pharmacological doses of EPO also had a limited proliferation effect in these cell lines. These results define a novel role for EPO in mediating tumor cell invasion. Increased levels of EPO and EPOR in lymph node metastases as compared to primary tumors from HNSCC patients further support the role of EPO/EPOR in HNSCC disease progression and metastasis.

Regulated cell motility is critical to wound healing (25, 35). During repair, tissue deposition and remodeling by the immigrant fibroblasts and keratinocytes result in the regeneration of an intact skin barrier and functional organ. The cells from the remaining epidermal and dermal layers must proliferate and migrate to repopulate the nascent wound. The basal keratinocytes undergo a transition that enables such repopulation while the provisional matrix is invaded by fibroblasts as the first step in regenerating the future dermal layer. The numerous growth factors present throughout repair, including high levels of epidermal growth factor (EGF) receptor (EGFR) ligands such as HB-EGF and transforming growth factor alpha, are thought to promote these mitogenic and motogenic responses (26, 35, 45, 50, 60). However, the process of cell repopulation is limited late in the process of healing to prevent fibroplasia and excess matrix deposition. Late in the repair process, members of the Alu-Leu-Arg (ELR)-negative family of CXC chemokines appear (13, 42). It has been proposed that the migration of fibroblasts and keratinocytes is controlled by the waves of these growth factors and chemokines produced throughout wound repair (9, 35, 42, 44, 60). This would include signals to promote as well as inhibit cell migration. Active cell locomotion requires the coordination of a number of cellular processes that should be common among cell types (18, 28). Thus, as numerous external signals can modulate cell motility, two key questions are which biochemical pathway is actuated to promote migration during regeneration and whether these differ between cell types. Any such signaling pathway needs to affect key biophysical processes. During cell migration, tail de-adhesion may be rate-limiting; in experimental models, failure to detach limits cell motility (23, 44). Activation of calpain (EC 3.4.22.17), an intracellular limited protease, is required for integrin-mediated tail de-adhesion on moderately and highly adhesive substrata (30, 37) and for growth factor-induced motility (17, 43). This intracellular protease is a key switch, as calpain inhibitors convert EGFR-mediated signals from cell motility to matrix contractility (1). Thus, calpain activators appear to shift a wide range of cells to motility-permissive adhesion regimens, while inhibitory signals for calpain block productive locomotion. As such, we proposed that keratinocyte motility was dependent on calpain activity. This requirement for calpain activity provides a target for regulating cell motility (18). Confounding any analysis, two calpain isoforms with seemingly identical target specificities are present in practically all cells (48). In vitro, calpain 1 (μ-calpain) is activated at nearly micromolar concentrations of calcium; calpain 2 (M-calpain) requires millimolar calcium levels. While calcium fluxes have been postulated to regulate μ-calpain, this has yet to be demonstrated conclusively in living cells (5), and the signaling cascade that triggers this isoform during cell locomotion remain undefined (30). Furthermore, the physiologically relevant activators of M-calpain are unknown since intracellular calcium levels fail to reach the nearly millimolar concentrations required in vitro (22). Still, we know that plasma membrane-localized M-calpain is activated subsequent to growth factor signaling by direct extracellular signal-regulated kinase (ERK) mitogen-activated protein kinase (MAP kinase) phosphorylation (12, 16, 17, 44). However, what signals and respective intracellular signaling pathways operate during reepithelialization by keratinocytes remains an open question (42). In an initial exploration (43, 44), we reported that ELR-negative CXC chemokines, present during the process of wound repair (13, 42), can block fibroblast motility by preventing activation of M-calpain and subsequent de-adhesion, demonstrating that this might be a physiologically operative pathway. Of this family of chemokines, interferon-inducible protein 10 (IP-10) appears to be produced by the neovasculature deep in the dermis (13). A related ELR-negative CXC chemokine, IP-9, also called beta-R1 (40), H174 (24), and I-TAC (10), is produced by basal keratinocytes in response to immune-mediated injuries (52). Previously, we demonstrated that IP-9 is a wound response factor (42). These ELR-negative CXC chemokines were originally found as modulators of cells of the hematopoietic lineage, but chemokine receptors have been found on endothelial and epithelial cells (36, 38, 44, 47, 63). The ELR-negative members of the CXC family of chemokines, all of which bind to a common CXCR3 receptor (2, 14, 27), inhibit endothelial cell proliferation, migration (21, 31, 51), and fibroblast migration (44). These appear to act dominantly over promitogenic and promotility chemokines and growth factors (43, 44). IP-9 is a wound response factor situated in the right place to limit fibroblast repopulation and promote the remodeling phase (42). However, with IP-9 being produced by keratinocytes in or near the wound bed, the situation for the reepithelializing keratinocytes is of great interest; would this chemokine, which serves to “mature” the dermis, also have the collateral effect of slowing reepithelialization? Here we report that keratinocyte motility is promoted by both EGF and IP-9 through their activation of calpains. Furthermore, IP-9 does not block EGF-induced motility in keratinocytes, opposite to its effects on fibroblasts. Keratinocyte motility induced by EGF requires the pathway previously described in fibroblasts, which culminates in activation of the calpain 2 isoform, M-calpain (17). In undifferentiated keratinocytes, IP-9 also activated calpain, though it was the μ-calpain isoform and not the M-calpain isoform that was both triggered and required. This chemokine activation occurred through a phospholipase Cβ (PLCβ)-mediated calcium flux in distinction to the ERK MAP kinase signaling cascade that growth factors utilize to activate M-calpain (17). These two pathways converge at cell-diminished cell adhesion to substratum as mirrored in vinculin aggregate disassembly and cleavage of the focal adhesion kinase (FAK). This is the first demonstration, to our knowledge, of different isoforms of calpain being activated by distinct signals in the same cell to accomplish the same phenotypic end point, cell migration. We also show for the first time that IP-9 increased the intracellular calcium flux and resulted in triggering of the μ-calpain isoform, in turn resulting in productive cell motility.

HER2, a member of the epidermal growth factor receptor (EGFR) tyrosine kinase family, functions as an accessory EGFR signaling component and alters EGFR trafficking by heterodimerization. HER2 overexpression leads to aberrant cell behavior including enhanced proliferation and motility. Here we applied a combination of computational modeling and quantitative experimental studies of the dynamic interactions between EGFR and HER2 and their downstream activation of ERK to understand this complex signaling system. Using cells expressing different levels of HER2 relative to the EGFR, we could separate relative contributions of EGFR and HER2 to signaling amplitude and duration. Based on our model calculations, we demonstrated that, in contrast with previous suggestions in the literature, the intrinsic capabilities of EGFR and HER2 to activate ERK were quantitatively equivalent. We found that HER2-mediated effects on EGFR dimerization and trafficking were sufficient to explain the observed HER2-mediated amplification of epidermal growth factor-induced ERK signaling. Our model suggests that transient amplification of ERK activity by HER2 arises predominantly from the 2-to-1 stoichiometry of receptor kinase to bound ligand in EGFR/HER2 heterodimers compared with the 1-to-1 stoichiometry of the EGFR homodimer, but alterations in receptor trafficking yielding increased EGFR sparing cause the sustained HER2-mediated enhancement of ERK signaling.

Cell migration along the correct paths is critical to normal organogenesis and tissue repair, and goes awry in tumor dissemination. Understanding the molecular cues that control such migration would provide opportunities to control these events. Recent findings in Drosophila highlight the role of the epidermal growth factor receptor (EGFR) in chemotaxis and pathfinding during development. These studies, and others performed in vertebrates, support a central role for EGFR-mediated chemotaxis. However, the signal or signals that then enable cells to further migrate independently of this chemotactic effect are not known. Three possible scenarios are discussed: that EGFR signaling sensitizes cells to new cues, that EGFR signaling is altered so that the cell responds predominantly to other motility signals that are now "unblinded," and that EGFR signaling still provides the motile signal but in a chemokinetic manner with matrix components providing the directionality. There are precedents for all three scenarios, but which one proves true will define the window of opportunity for regulating cell migration.

How m-calpain is activated in cells has challenged investigators because in vitro activation requires near-millimolar calcium. Previously, we demonstrated that m-calpain activation by growth factors requires extracellular signal-regulated kinase (ERK); this enables tail deadhesion and allows productive motility. We now show that ERK directly phosphorylates and activates m-calpain both in vitro and in vivo. We identified serine 50 as required for epidermal growth factor (EGF)-induced calpain activation in vitro and in vivo. Replacing the serine with alanine limits activation by EGF and subsequent cell deadhesion and motility. A construct with the serine converted to glutamic acid displays constitutive activity in vivo; expression of an estrogen receptor fusion construct produces a tamoxifen-sensitive enzyme. Interestingly, EGF-induced m-calpain activation occurs in the absence of increased intracellular calcium levels; EGF triggers calpain even in the presence of intracellular calcium chelators and in calcium-free media. These data provide evidence that m-calpain can be activated through the ERK cascade via direct phosphorylation and that this activation may occur in the absence of cytosolic calcium fluxes.

Myopodin was previously reported as a gene that was frequently deleted in prostate cancer. This gene shares significant homology with a cell shape-regulating gene, synaptopodin. Myopodin was shown to bind actin and to induce actin bundling when cells were stimulated. To clarify the functional role of myopodin in prostate cancer, several assays were performed to evaluate the tumor suppression activity of myopodin. Our results indicate that myopodin inhibits tumor growth and invasion both in vitro and in vivo. The activity of tumor suppression of myopodin is located at the C-terminus region. To further evaluate the role of myopodin in suppressing the invasiveness of prostate cancer, an expression analysis of myopodin protein was performed in prostate tissues. The results indicate that down-regulation of myopodin expression occurs mostly in invasive stages of prostate cancer, implying a potential invasion suppression role for myopodin in prostate cancer. In addition, hemizygous deletion and down-regulation of myopodin expression occur in three aggressive prostate cancer cell lines. All these results support the hypothesis that myopodin functions as a tumor suppressor gene to limit the growth and to inhibit the metastasis of cancer cells.

Tumor cell motility and invasion have been linked to upregulated signaling from both the epidermal growth factor receptor (EGFR) and that for urokinase-type plasminogen activator (uPAR). However, we do not know whether these events are interdependent or unrelated, despite the obvious diagnostic and therapeutic implications. Gene microarray analyses have suggested that EGFR signaling via phospholipase C-gamma (PLCgamma) induces uPAR transcription. We utilized two sublines of the DU145 human prostate carcinoma cell line that are genetically engineered to differentially activate the EGFR/PLCgamma cascade and are variously invasive in vitro and in vivo. uPAR protein levels in these cells were found to be dependent on PLC signaling, pharmacologic inhibition of PLC signaling reduced uPAR expression. To determine whether uPAR was a required element in EGFR-mediated invasion, we stably expressed uPAR cDNA in either sense or antisense orientation in the two DU145 sublines. Interestingly, uPA production was modulated in parallel, although to a lesser degree, with uPAR in these sublines. Antisense to uPAR significantly restricted invasion of the highly invasive DU145 WT cells through Matrigel and reduced aggressiveness of tumors in nude mice. Up-regulation of uPAR significantly increased the invasiveness of the moderately invasive DU145 parental (DU145 P) cells through Matrigel, but this increased invasiveness was not seen in mice. uPA activity appears to contribute to invasiveness at least through Matrigel, as antibody to uPA or amiloride limited the transmigration. These results support a model of tumor invasion promoted by autocrine EGFR signaling involving reinforcing altered gene expression, of uPAR at least, that further induces cell motility. Herein, a number of key molecules whose expression levels are interrelated, including both EGFR and uPAR, are required but none are sufficient in the absence of other keys molecules in promoting tumor progression.

Lymph node metastasis and local invasion of head and neck squamous cell carcinoma (HNSCC) is associated with a poor prognosis. However, little is known about the factors governing tumor cell invasion in HNSCC. Phospholipase Cgamma-1 (PLCgamma-1) contributes to tumor cell invasion in experimental systems when activated by the epidermal growth factor receptor (EGFR). We hypothesized that EGFR overexpression in HNSCC mediates invasion via PLCgamma-1. On EGFR ligand stimulation, phosphorylation of PLCgamma-1 increased in all of the HNSCC cell lines tested (4 of 4). In the presence of EGFR-specific tyrosine kinase inhibitor (PD153035) or an anti-EGFR antibody (C225), PLCgamma-1 activation was abrogated indicating that PLCgamma-1 was downstream of EGFR. Blocking cellular PLC with an inhibitor (U73122) reduced inositol phosphate turnover in all of the HNSCC cell lines examined, and treatment with the PLC inhibitor or antisense oligonucleotides targeting PLCgamma-1 significantly reduced in vitro invasiveness of HNSCC cell lines through Matrigel. To determine the clinical relevance of these findings, we compared levels of PLCgamma-1 in tumor and paired normal tissue from 33 patients with HNSCC. PLCgamma-1 levels were significantly higher (P0.0001) in the tumors compared with the normal mucosa of HNSCC patients. Levels of activated PLCgamma-1 were analyzed in 20 patients. Tumors expressed higher levels of phosphorylated PLCgamma-1 compared with normal adjacent mucosa (P = 0.05). Thus, PLCgamma-1 may mediate invasion and metastasis downstream of EGFR in HNSCC.

As fibroblasts near senescence, their responsiveness to external signals diminishes. This well-documented phenomenon likely underlies physiological deterioration and limited tissue regeneration in aging individuals. Understanding the underlying molecular mechanisms would provide opportunities to ameliorate these situations. A key stimulus for human dermal fibroblasts are ligands for the epidermal growth factor receptor (EGFR). We have shown earlier that EGFR expression decreases by about half in near senescent fibroblasts (Shiraha et al., 2000, J. Biol. Chem. 275 (25), 19343-19351). However, as the cell responses are nearly absent near senescence, other aging-related signal attenuation changes must also occur. Herein, we show that EGFR signaling as determined by receptor autophosphorylation is diminished over 80%, with a corresponding decrease in the phosphorylation of the immediate postreceptor adaptor Shc. Interestingly, we found that this was due at least in part to increased dephosphorylation of EGFR. The global cell phosphotyrosine phosphatase activity increased some threefold in near senescent cells. An initial survey of EGFR-associated protein tyrosine phosphatases (PTPases) showed that SHP-1 (PTPIC, HCP, SHPTP-1) and PTPIB levels are increased in parallel in these cells. Concomitantly, we also discovered an increase in expression of receptor protein tyrosine phosphatase alpha (RPTPalpha). Last, inhibition of protein tyrosine phosphatases by sodium orthovanadate in near senescent cells resulted in increased EGFR phosphorylation. These data support a model in which, near senescence, dermal fibroblasts become resistant to EGFR-mediated stimuli by a combination of receptor downregulation and increased signal attenuation.

The biological efficacy of, and spectrum of action of, agents used in treatment of breast cancer are important issues in therapy planning.Techniques used involve monolayer culture and a quantitative microtiter plate-based chemo-response assay. Precision Therapeutics' overall assessability rate is 90% for tumors of all types. In this study, 148 specimens derived from breast cancer were studied. Of these, 111 were additionally studied histopathologically. Ninety-two percent of the 111 specimens were confirmed to be epithelioid in nature and, thus, compatible with cells of breast cancer origin.In vitro chemo-response profiles indicated that individual agents stratified into groups, with cyclophosphamide and fluorouracil demonstrating responses of 69% and 57% respectively; doxorubicin, 45%; and docetaxel, paclitaxel and gemcitabine, 39, 27 and 36%, respectively.The spectrum of responsiveness of the individual agents was variable and not completely overlapping, as shown by the Venn diagrams.

Mortality and morbidity of prostate cancer result from extracapsular invasion and metastasis. This tumor progression depends on active cell motility. Previous studies have shown that calpain-regulated rear detachment enabling forward locomotion is required for cell migration initiated by growth factor and adhesion receptors. Therefore, we asked whether calpain would be a target for limiting tumor progression, using as our model the PA DU-145 human prostate carcinoma cell line and a highly invasive subline, wild-type DU-145, derived from it. In vitro, the calpain-specific inhibitor CI-I (ALLN) and the preferential-but-less-specific inhibitor leupeptin decreased transmigration of both cell lines across a Matrigel barrier. These calpain inhibitors limited epidermal growth factor-induced motility but did not alter the growth rate of the tumor cells, as expected. Antisense down-regulation of the growth factor-activated calpain-2 (m-calpain) isoform also reduced transmigration and cell motility. These in vitro findings were then buttressed by in vivo studies, in which i.p. DU-145 tumor xenografts were treated with leupeptin. Tumor invasion into the diaphragm was reduced by leupeptin treatment for both the PA and wild-type DU-145 cells (from 1.7 to 0.78 for the parental line and 2.3 to 1.2 for the invasive derivative, respectively). Tumor cells of both types engineered to express calpain-2 antisense constructs also demonstrated a similar 50% reduced invasiveness in vivo. Finally, we found by gene expression survey of 53 human prostate tumors and 23 normal prostates that calpain was not up-regulated in relationship to invasiveness or metastatic activity, consistent with expectation from the biological role of this effector. Taken together, these results strongly suggest that epigenetic activation of calpain plays an important role in the invasion of human prostate cancer and that it can be targeted to reduce tumor progression.

Isolation and growth of malignant cells from solid tumors have often met with disappointing results. Consequently, we have developed a cell culture methodology based on ex vivo explantation of tumor tissue, with subsequent monolayer cell outgrowth. In an attempt to assess methods for detection of malignant cells in these cultures, we analyzed and compared the results of cytopathology, growth in soft agar, and detection of telomerase activity with those of standard immunohistochemistry (IHC) techniques for the detection of cytokeratins, tumor marker p53, and proliferation marker Ki-67. The sensitivity of detection of malignant cells was 85% (22/26) for cytopathological examination, 30% (3/10) for soft agar growth, and 100% (12/12) for detection of telomerase activity. From these data, we concluded that both cytopathological examination and assessment of telomerase activity contribute to the detection of malignant cells in primary cultures of human solid tumors, whereas growth in soft agar was not a good indicator of malignant cells. Although not specific for malignant cells per se, IHC detection for epithelial cell cytokeratins showed a high degree of sensitivity (100%, 23/23), whereas the sensitivity for detection of tumor marker p53 and proliferation marker Ki-67 was 30% (7/23) and 70% (16/23), respectively. These data also provide proof that malignant tumor cells, derived from a diverse number of human solid tumors, can be isolated and grown in primary cell culture.

The vast majority of cancer morbidity and mortality arises from tumor progression beyond the primary tumor site. Unfortunately, most therapies are not effective for advanced stage disease with regional extension or distant metastases. Thus, new treatments are needed to target rate limiting steps in tumor progression. The ability of cancers to invade and metastasize requires the acquisition of specific cell behaviors that enable the cell to escape from the localized site, breach the defined boundaries, reach a hospitable ectopic site and grow in this new locale. Recently, dysregulation of cell motility as stimulated by various extracellular factors has gained credence as a rate-limiting alteration in tumor progression in carcinomas and some other solid tumors. This has focused attention on initiators of signaling cascades that regulate tumor migration. In this effort, one molecule, phospholipase C-gamma 1 (PLCgamma), has been shown to function as a key molecular switch.

Wound healing is a complex process ofcell colonization, matrix deposition,and remodeling, requiring multiple cellfunctions to act in coordinated manner.Focusing on dermal tissue regenerationas a prominent example, a relativelysimplifiedviewcanbeproffered:properhealing requires fibroblast migrationinto the wound, synthesis and secretionof extracellular matrix components,and active contraction-based reorgan-ization of the matrix around the occu-pying cells. These actions occur in anoverlapping but sequenced order inthe face of a multitude of external cuesfrom a changing environment. Furthercomplicating this situation is the factthat these stages of wound repair occurasynchronously across a larger, healingwound. The ways by which thesediverse cell behaviors—locomotion,matrix production, and tissue remod-eling—interact to ultimately yield ei-therpropertissuephysiologyorvariouskinds of pathology remain poorly un-derstood,even to the issueof the natureof the cells involved in any or all ofthese functions (Tomasek et al., 2002).For investigators in the biophysicscommunity, an especially germanefacet of this complicated phenomenonis the relationship between cell loco-motion and matrix reorganization,particularly since the matrix reorgani-zation requires matrix contraction. Attheir core both the cellular immigrationand the matrix contraction arise fromintracellular cytoskeletal force genera-tion transmitted to the extracellularmatrix via highly regulated cell/matrixadhesion sites (Tamariz and Grinnell,2002). Controversy has existed in thewound healing and tissue morphogen-esis field about whether compaction ofextracellular matrix derives, on the onehand, from migratingcells asthey exerttraction during locomotion, or, on theother hand, by nonmigrating cells con-verting their intracellular contractileforce into traction. In fact, fibroblastmotility can be converted into matrixcompaction by inhibiting molecularmechanisms involved in regulated re-leaseofcell/matrixadhesionsoperatingin migration (Allen et al., 2002). Thus,it is exceedingly difficult to parsecontributions of underlying molecularmechanisms to overall wound healingand tissue morphogenesis in terms ofactive cell migration versus cell motil-ity-derivedmatrix deformations.It maysimply be that they are part-and-parcelaspects of the same underlying motilitymachinery modulated by external sig-nals that abrogate key events. It is,therefore, crucial to gain this capabilityfor analyzing the ‘‘multitasking’’ cellscan accomplish with their force gen-eration and transmission regulation inorder to test hypotheses that can lead toimproved molecular therapeutics forwound regeneration and particularlywound strengthening.A major advance toward this impor-tant goal is provided by the new workby Shreiber et al. in this issue of theBiophysical Journal (Shreiber et al.,2003), by simultaneous quantitativemeasurement of cell migration andmatrixdeformationforfibroblastswith-in three-dimensional collagen gels asfunctionsoftimeoveraperiodofhours.These gels are cylindrical andanchoredat their axial ends, so that matrix de-formationoccurs in the radial direction.The automated microscopy and imageanalysis technology needed for thiscapability had been demonstrated pre-viously by the Tranquillo laboratoryat Minnesota in recent years, but thecrucial extension here determination oftime-varying characteristics of thesecellbehavioralfunctionsconcomitantlyenabling analysis of dynamic changesin locomotion and remodeling reflect-ing progressions of the extracellularcontext (e.g., matrix composition andcompliance) as well as cellular pheno-typic properties (due to gene expres-sion modulation, for instance).In this new study, the Tranquillogroup compared dynamic cell migra-tion and matrix compaction propertiesof human foreskin fibroblasts (HFFs)and rat dermal fibroblasts (RDFs) inresponse to serum. Both cell typesgenerally showed increasing values ofthe random migration coefficient,l (analogous to a molecular diffusioncoefficient), as time progressed, whilethevaluesofthecelltractioncoefficent,s

We describe the in vitro patterns of response of explanted primary and recurrent ovarian cancers to platinum- and taxane-based chemotherapeutics. The chemoresponse assay utilizes cells that grow out from tumor fragments and are then challenged with varied concentrations of chemotherapeutic agents, coupled with a highly quantitative cell counting analysis system. The in vitro response rates for 268 primary cancer explants were 24% and 54% for carboplatin and cisplatin, respectively, and 31% and 25% for docetaxel and paclitaxel, respectively. Recurrent tumors presented lower rates of responsiveness, as expected. Furthermore, the chemotherapies worked on overlapping but distinct populations, even within the same class of drug, with 14% of the carboplatin-sensitive tumors being cisplatin-resistant and 59% of the cisplatin-sensitive tumors being carboplatin-resistant. These in vitro responses compare favorably to published in vivo clinical response rates. The current study serves to demonstrate how an in vitro predictive assay can be used as a surrogate for clinical therapeutic challenge.

Tumor invasion marks a critical point in cancer progression; it is a harbinger of morbidity and mortality. Thus, the cellular events that enable the invasive phenotype are under intense investigation. Epstein-Barr virus (EBV) is associated with a number of cancers, including Burkitt lymphoma (BL) and nasopharyngeal carcinoma (NPC) and is suspected to contribute to their tumorigenesis. On average, 8% of gastric carcinomas have been shown to carry this virus. To explore whether the presence of EBV in gastric carcinoma contributes to tumor progression in this predominantly invasive carcinoma, we examined a panel of 2 in vitro EBV-infected human gastric cancer cell line sublines and their mock-infected AGS parental control line. We found EBV infection caused a marked increase in transmigration of a Matrigel barrier (415% and 303%, p < 0.05, for the 2 infected lines). This correlated with increased motility of these sublines (233% and 140%, p < 0.05). As this pattern of increased motility leading to a more pronounced enhancement of invasion has been noted in other tumor cells, we explored the roles of autocrine signaling pathways previously implicated in carcinoma motility and invasion. Inhibitors to the epidermal growth factor receptor (EGFR) (PD153035), phospholipase C (PLC) (U73122), extracellular-signal regulated kinase (ERK)/mitogen-activated protein kinase (MAPK) (PD089035) and PI-3 kinase (Wortmannin) were not informative. These data suggest that EBV increases migration of AGS cells by a mechanism independent of these autocrine growth factor-induced pathways. Instead, we found that the EBV-infected cells presented increased focal adhesion kinase (FAK) phosphorylation. These findings suggest a role for integrin-mediated signaling in promoting EBV-associated invasiveness.

Induced migration of tumor cells is generally considered to be one critical step in cancer progression to the invasive and metastatic stage. The implicit caveat of studies that show this is that other, unknown, signaling pathways and biophysical events are actually the operative rate-limiting steps, and not motility per se. Thus, to examine the hypothesis that motility is a single, but overall rate-limiting function required for invasion, disparate motility processes need be blocked with concordant effects on tumor invasion. Recently, we and others have described two signaling pathways that are critical to growth factor-induced motility but not mitogenesis. The key molecular switches are phospholipase C-gamma (PLCgamma) and calpain for cytoskeletal reorganization and rear detachment, respectively. We examined this hypothesis in a highly invasive tumor, bladder carcinoma. Three different human tumor cell lines, 253J-B-V, UMUC and T-24, were tested for invasiveness in vitro by transmigration of a Matrigel barrier. Inhibiting PLCgamma with the pharmacologic agent U73122 or the molecular dominant-negative PLCz construct reduced both invasiveness and motility. The same was noted when calpain was blocked using calpain inhibitor I (ALLN). These results demonstrate that one interventional target for limiting invasion is not necessarily an individual motility pathway but rather cell migration per se.

Advanced prostate cancer is treated initially by central suppression of androgen production by luteinizing hormone-releasing hormone (LHRH) agonists. Intriguingly, even hormone-independent cancers often show some, if only slight, growth retardation when these agonists are delivered in pharmacological doses. Previous studies have shown in cell lines and animal xenograft models that activation of peripheral LHRH receptors on prostate carcinoma cells lead to growth suppression. In parallel, there is a decrease of epidermal growth factor receptors (EGFRs) and activity. Because autocrine EGFR stimulation exists in most, if not all, prostate carcinomas and is required for cell proliferation, we asked whether LHRH signaling cross-attenuated EGFR to limit tumor growth. One possible mechanism was suggested by LHRH receptors triggering phospholipase-C (PLC) to activate protein kinase C (PKC) because PKC activation limits EGFR tyrosine kinase activity by phosphorylating EGFR at threonine 654.To determine the role of this cross-attenuation mechanism, we mutated the threonine 654 amino acid to an alanine (A654) to abrogate this inhibition. DU-145 cells stably expressing wild-type and A654 EGFR were grown as xenografts in the s.c. space of athymic mice.DU-145 cells, overexpressing wild-type EGFR, formed tumors in athymic mice that were inhibitable by goserelin acetate (Zoladex). Tumors expressing the A654 EGFR were resistant to this growth inhibition. These results paralleled in vitro studies in which goserelin acetate blocked proliferation of the WT DU-145 but not A654 DU-145 cells.These data support the model of LHRH agonists preventing EGFR-mediated tumor growth through a PKC pathway. This suggests new targets of modulatory intervention to limit the growth of androgen-independent prostate carcinomas.

We have shown previously that the ELR-negative CXC chemokines interferon-inducible protein 10, monokine induced by gamma interferon, and platelet factor 4 inhibit epidermal growth factor (EGF)-induced m-calpain activation and thereby EGF-induced fibroblast cell motility (H. Shiraha, A. Glading, K. Gupta, and A. Wells, J. Cell Biol. 146:243-253, 1999). However, how this cross attenuation could be accomplished remained unknown since the molecular basis of physiological m-calpain regulation is unknown. As the initial operative attenuation signal from the CXCR3 receptor was cyclic AMP (cAMP), we verified that this second messenger blocked EGF-induced motility of fibroblasts (55% +/- 4.5% inhibition) by preventing rear release during active locomotion. EGF-induced calpain activation was inhibited by cAMP activation of protein kinase A (PKA), as the PKA inhibitors H-89 and Rp-8Br-cAMPS abrogated cAMP inhibition of both motility and calpain activation. We hypothesized that PKA might negatively modulate m-calpain in an unexpected manner by directly phosphorylating m-calpain. A mutant human large subunit of m-calpain was genetically engineered to negate a putative PKA consensus sequence in the regulatory domain III (ST369/370AA) and was expressed in NR6WT mouse fibroblasts to represent about 30% of total m-calpain in these cells. This construct was not phosphorylated by PKA in vitro while a wild-type construct was, providing proof of the principle that m-calpain can be directly phosphorylated by PKA at this site. cAMP suppressed EGF-induced calpain activity of cells overexpressing a control wild-type human m-calpain (83% +/- 3.7% inhibition) but only marginally suppressed that of cells expressing the PKA-resistant mutant human m-calpain (25% +/- 5.5% inhibition). The EGF-induced motility of the cells expressing the PKA-resistant mutant also was not inhibited by cAMP. Structural modeling revealed that new constraints resulting from phosphorylation at serine 369 would restrict domain movement and help "freeze" m-calpain in an inactive state. These data point to a novel mechanism of negative control of calpain activation, direct phosphorylation by PKA.

Wound healing requires the vasculature to re-establish itself from the severed ends; endothelial cells within capillaries must detach from neighboring cells before they can migrate into the nascent wound bed to initiate angiogenesis. The dissociation of these endothelial capillaries is driven partially by platelets' release of growth factors and cytokines, particularly the chemokine CXCL4/platelet factor-4 (PF4) that increases cell-cell de-adherence. As this retraction is partly mediated by increased transcellular contractility, the protein kinase c-δ/myosin light chain-2 (PKCδ/MLC-2) signaling axis becomes a candidate mechanism to drive endothelial dissociation. We hypothesize that PKCδ activation induces contractility through MLC-2 to promote dissociation of endothelial cords after exposure to platelet-released CXCL4 and VEGF. To investigate this mechanism of contractility, endothelial cells were allowed to form cords following CXCL4 addition to perpetuate cord dissociation. In this study, CXCL4-induced dissociation was reduced by a VEGFR inhibitor (sunitinib malate) and/or PKCδ inhibition. During combined CXCL4+VEGF treatment, increased contractility mediated by MLC-2 that is dependent on PKCδ regulation. As cellular force is transmitted to focal adhesions, zyxin, a focal adhesion protein that is mechano-responsive, was upregulated after PKCδ inhibition. This study suggests that growth factor regulation of PKCδ may be involved in CXCL4-mediated dissociation of endothelial cords.

Investigations across a range of disciplines over the past decade have brought the study of cell motility and its role in invasion to an exciting threshold. The biophysical forces proximally involved in generating cell locomotion, as well as the underlying signaling and genomic regulatory processes, are gradually becoming elucidated. We now appreciate the intricacies of the many cellular and extracellular events that modulate cell migration. This has enabled the demonstration of a causal role of cell motility in tumor progression, with various points of 'dysregulation' of motility being responsible for promoting invasion. In this paper, we describe key fundamental principles governing cell motility and branch out to describe the essence of the data that describe these principles. It has become evident that many proposed models may indeed be converging into a tightly-woven tapestry of coordinated events which employ various growth factors and their receptors, adhesion receptors (integrins), downstream molecules, cytoskeletal components, and altered genomic regulation to accomplish cell motility. Tumor invasion occurs in response to dysregulation of many of these modulatory points; specific examples include increased signaling from the EGF receptor and through PLC gamma, altered localization and expression of integrins, changes in actin modifying proteins and increased transcription from specific promoter sites. This diversity of alterations all leading to tumor invasion point to the difficulty of correcting causal events leading to tumor invasion and rather suggest that the underlying common processes required for motility be targeted for therapeutic intervention.

Wound healing is compromised in aging adults in part due to decreased responsiveness of fibroblasts to extracellular signals. However, the cellular mechanisms underlying this phenomenon are not known. Aged dermal fibroblasts with reduced remaining replicative capacities demonstrated decreased epidermal growth factor (EGF)-induced cell migrative and cell proliferative capacities, as reported previously. Thus, as cells approach senescence, programmed in vivo or in vitro, EGF responsiveness is preferentially lost. To define the rate-limiting signaling event, we found that the activity of two different EGF receptor (EGFR)-signaling pathways to cell migration (phospholipase-C gamma) and/or mitogenesis (extracellular signal/regulated-mitogen-activated kinases) were decreased in near senescent cells despite unchanged levels of effector molecules. Aged cells presented decreased levels of EGFR, although insulin receptor and transferrin receptor levels were relatively unchanged. EGFR mRNA levels and production of new transcripts decreased during aging, suggesting that this preferential loss of EGFR was due to diminished production, which more than counteracts the reduced ligand-induced receptor loss. Since these data suggested that the decrement in EGF was rate-limiting, higher levels of EGFR were established in near senescent cells by electroporation of EGFR cDNA. These cells presented higher levels of EGFR and recovered their EGF-induced migration and proliferation responsiveness. Thus, the defect in EGF responsiveness of aged dermal fibroblasts is secondary to reduced EGFR message transcription. Our experimental model suggests that EGFR gene delivery might be an effective future therapy for compromised wound healing.

Transforming growth factor alpha (TGF alpha) has been reported to be a more potent agonist when compared to epidermal growth factor (EGF) in several systems while acting via their common receptor, the epidermal growth factor receptor (EGFR). It has been postulated that this increased potency is mediated by the increased recycling of EGFR upon activation by TGF alpha as against receptor activation by EGF. The authors test this hypothesis by simultaneously measuring mitogenesis and the dynamics of surface receptor number in response to these ligands in NR6 mouse fibroblasts expressing the EGFR. The data demonstrates that increased receptor recycling due to endosomal dissociation of TGF alpha can indeed realise an increased mitogenic potency relative to EGF under appropriate cellular and experimental conditions (i.e. situations in which the increase in the number of occupied receptors due to receptor sparing by TGF alpha represents additional mitogenic signalling capacity). However, this difference in receptor trafficking does not uniquely determine the relative potencies of these ligands since TGF alpha is a less potent mitogen compared to EGF when experimental conditions are dominated by the effects of ligand trafficking on growth factor availability. Thus, the relative potencies of these growth factors are determined in a given context by the relative importance of ligand and receptor trafficking effects which determine the availability of these signalling components. These results are consistent with a suggested model of hormone responsiveness which favours dissociative ligands (such as TGF alpha) in receptor-limited situations and non-dissociative ligands (such as EGF) in the case of ligand limitation.

Twenty-four years after apparently successful treatment for nodular lymphocyte predominant Hodgkin's disease (nLPHD), a 41-year old male developed "B" symptoms and extensive adenopathy. A right axillary lymph node biopsy showed two distinct regions including (1) histiocyte-rich B-cell lymphoma and (2) diffuse small T-cell lymphoma. A clonal rearrangement of the gene for the T-cell receptor beta chain confirmed the presence of a T-cell neoplasm, and this was further confirmed by selective polymerase chain reaction (PCR) on this morphologic zone. PCR on the morphologic B-cell lymphoma confirmed the presence of an immunoglobulin gene rearrangement. These two regions were separated by a less-defined zone containing a mixture of small CD57 positive T lymphocytes, small B lymphocytes, and rare lymphocytic and histiocytic (L&H) cells, highly suggestive of recurrent LPHD. The development of composite B-cell and T-cell lymphoma in this patient raises the speculation that nLPHD may be a neoplasm of lymphoid cells, which can differentiate in both B- and T-cell directions, with the "L&H" cells constituting their B-cell progeny.

Growth factors coordinately regulate a variety of genes associated with pathological states including tumor invasion and metastasis. Overexpressed epidermal growth factor receptor (EGFR) on tumor cell surfaces is associated with enhanced cell attachment and migration into extracellular matrices, which promotes tumor aggressiveness. We have demonstrated that epidermal growth factor (EGF) up-regulates the cell surface adhesion molecule CD44 at both the mRNA and protein levels on mouse fibroblasts expressing full-length wild-type EGFR (NR6-WT) but not on EGFR-deficient cells (NR6-P). This increases cell attachment to hyaluronic acid. In this investigation, transcriptional regulation of CD44 by EGF was confirmed by defining an EGF-regulatory element. By employing human CD44 gene promoter-chloramphenicol acetyltransferase (CAT) constructs transfected into NR6-WT cells, EGF inducibility was observed within a 120-base pair (bp) DNA fragment located 450 bp upstream of the RNA initiation site. Differential EGF inducibility was found among different cell lines chosen, indicating a 3.2- and 1.8-fold enhancement in DU145 cells carrying exogenous wild-type EGFR and in MCF-7 cells, respectively, while minimal EGF induction was found in cervical cancer HeLa cells. Utilizing gel shift assays, a time-dependent increase of DNA-protein complex formation was found upon EGF stimulation in NR6-WT cells but not in NR6-P cells. Based upon these observations, a novel 22-bp EGF regulatory element (ERE) (5′-−604CCCTCTCTCCAGCTCCTCTCCC−583-3′) was isolated from the CD44 gene promoter. This ERE conferred DNA-protein binding ability in vitro, as well as the full functional recovery of EGF inducibility of CAT activity when linked to a homologous CD44 promoter or a SV40 promoter driving a CAT reporter gene. A two-base mutation of the ERE completely eliminated its binding activity as well as its EGF inducibility of CAT expression. Our studies indicate that EGF induces CD44 gene expression through an interaction between a specific ERE and putative novel transcriptional factor so as to regulate cell attachment to extracellular matrix.

Carcinomas of the prostate and other lineages often present an autocrine stimulatory loop acting via the EGF receptor (EGFR). We have recently shown that EGFR-mediated signals enhance DU-145 prostate carcinoma cell transmigration of an extracellular matrix in vitro, and that this increased invasiveness was independent of proteolytic degradation of the matrix (Xie et al., 1995, Clin Exp Metastasis, 13, 407). To determine whether up-regulated EGFR signaling promotes tumor progression in vivo and to define the EGFR-induced cell property responsible, we inoculated athymic mice with genetically-engineered DU-145 cells. Parental DU-145 cells and those transduced to overexpress a full-length wild type (WT) EGFR formed tumors and metastasized to the lung when inoculated in the prostate and peritoneal cavity. The WT DU-145 tumors were more invasive. DU-145 cells expressing a mitogenically-active, but motility-deficient (c'973) EGFR formed small, non-invasive tumors without evidence of metastasis. All three sublines demonstrated identical, EGFR-dependent rates of cell growth in vitro, suggesting that the differential invasiveness was not due to altered growth rates. To determine whether cell motility may be, in part, responsible for tumor invasiveness, we treated WT DU-145 intraperitoneal tumors with a pharmacologic agent (U73122) which blocks EGFR-mediated cell motility but not mitogenesis. Under this treatment regimen, the WT DU-145 cells formed tumors of similar numbers and size to those formed without treatment; however, these tumors were much less invasive. These data suggest that EGFR-mediated cell motility is an important mechanism involved in tumor progression, and that this cell property may represent a novel target to limit the spread of tumors.

Insulin-stimulated glucose transport in adipocytes is mediated by the insulin receptor. To ascertain whether a related receptor could also trigger this response, the epidermal growth factor (EGF) receptor (EGFR) was introduced into adipocytes. 3T3-L1 fibroblasts were infected by a retroviral construct encoding either the full-length (WT) or a carboxy-terminal truncated (c'973) human EGFR; truncation of the amino acids distal to 973 removes all autophosphorylation motifs. After selection and conversion to adipocytes, the level of EGFR expression was retained in infectant adipocytes (150,000 and 250,000/cell, respectively), but not in the parental 3T3-L1 adipocytes (< 5000/cell). WT and c'973 EGFR exhibited ligand-dependent tyrosine kinase activity and stimulated mitogen-activated protein kinase activity equivalently; neither phosphorylated insulin receptor substrate-1. WT EGFR, but not c'973 EGFR, underwent ligand-induced autophosphorylation. EGF did not stimulate tyrosine phosphorylation of the insulin receptor or insulin receptor substrate-1. EGF had a minimal effect on glucose transport by parental 3T3-L1 adipocytes. Glucose transport in the WT EGFR adipocytes was stimulated equivalently by insulin and EGF; exposure to insulin and EGF in combination did not result in augmented transport. Glucose transport in the c'973 EGFR adipocytes was stimulated by insulin, but not by EGF. GLUT4 was translocated to the plasma membrane to a similar extent in response to insulin or EGF in the WT EGFR adipocytes; only insulin caused a significant GLUT4 translocation in the parental or c'973 EGFR adipocytes. These data suggest that the insulin and EGF signaling pathways that lead to glucose transport converge in these adipocytes down-stream of the insulin receptor, and that activation of this pathway requires signaling motifs in the carboxy-terminus of the EGFR. This model system represents a novel approach with which to dissect signal transduction pathways in terminally differentiated adipocytes.