Search

The rich linguistic, ethnic and cultural diversity of Ethiopia provides an unprecedented opportunity to understand the level to which cultural factors correlate with–and shape–genetic structure in human populations. Using primarily new genetic variation data covering 1,214 Ethiopians representing 68 different ethnic groups, together with information on individuals’ birthplaces, linguistic/religious practices and 31 cultural practices, we disentangle the effects of geographic distance, elevation, and social factors on the genetic structure of Ethiopians today. We provide evidence of associations between social behaviours and genetic differences among present-day peoples. We show that genetic similarity is broadly associated with linguistic affiliation, but also identify pronounced genetic similarity among groups from disparate language classifications that may in part be attributable to recent intermixing. We also illustrate how groups reporting the same culture traits are more genetically similar on average and show evidence of recent intermixing, suggesting that shared cultural traits may promote admixture. In addition to providing insights into the genetic structure and history of Ethiopia, we identify the most important cultural and geographic predictors of genetic differentiation and provide a resource for designing sampling protocols for future genetic studies involving Ethiopians., Ethiopia is one of the most ethnically and culturally diverse countries. Here, the authors look at genetic and cultural variation in 1,214 Ethiopians to unravel the relationship between genetic admixture and cultural factors.

SummaryThe rich linguistic, ethnic and cultural diversity of Ethiopia provides an unprecedented opportunity to understand the level to which cultural factors correlate with -- and shape -- genetic structure in human populations. Using primarily novel genetic variation data covering 1,214 Ethiopians representing 68 different ethnic groups, together with information on individuals’ birthplaces, linguistic/religious practices and 31 cultural practices, we disentangle the effects of geographic distance, elevation, and social factors upon shaping the genetic structure of Ethiopians today. We provide evidence of associations between social behaviours and increased genetic differences among present-day peoples. We show that genetic similarity is broadly associated with linguistic classifications, but indicate pronounced genetic similarity among groups from disparate language classifications that may in part be attributable to recent intermixing. We also illustrate how groups reporting the same culture traits are more genetically similar on average and show evidence of recent intermixing, suggesting how shared cultural traits may promote admixture. In addition to providing insights into the genetic structure and history of Ethiopia, these results identify the most important cultural and geographic proxies for genetic differentiation and provide a resource for designing sampling protocols for future genetic studies involving Ethiopians.

The predominantly African origin of all modern human populations is well established, but the route taken out of Africa is still unclear. Two alternative routes, via Egypt and Sinai or across the Bab el Mandeb strait into Arabia, have traditionally been proposed as feasible gateways in light of geographic, paleoclimatic, archaeological, and genetic evidence. Distinguishing among these alternatives has been difficult. We generated 225 whole-genome sequences (225 at 8× depth, of which 8 were increased to 30×; Illumina HiSeq 2000) from six modern Northeast African populations (100 Egyptians and five Ethiopian populations each represented by 25 individuals). West Eurasian components were masked out, and the remaining African haplotypes were compared with a panel of sub-Saharan African and non-African genomes. We showed that masked Northeast African haplotypes overall were more similar to non-African haplotypes and more frequently present outside Africa than were any sets of haplotypes derived from a West African population. Furthermore, the masked Egyptian haplotypes showed these properties more markedly than the masked Ethiopian haplotypes, pointing to Egypt as the more likely gateway in the exodus to the rest of the world. Using five Ethiopian and three Egyptian high-coverage masked genomes and the multiple sequentially Markovian coalescent (MSMC) approach, we estimated the genetic split times of Egyptians and Ethiopians from non-African populations at 55,000 and 65,000 years ago, respectively, whereas that of West Africans was estimated to be 75,000 years ago. Both the haplotype and MSMC analyses thus suggest a predominant northern route out of Africa via Egypt.

The human FMO2 (flavin-containing monooxygenase 2) gene has been shown to be involved in innate immunity against microbial infections, including tuberculosis (TB), via the modulation of oxidative stress levels. It has also been found to possess a curious loss-of-function mutation (FMO2*1/FMO2*2) that demonstrates a distinctive differentiation in expression, function and ethno-geographic distribution. However, despite evidences of ethnic-specific genetic associations in the inflammatory profile of TB, no studies were done to investigate whether these patterns of variations correlate with evidences for the involvement of FMO2 in antimicrobial immune responses and ethnic differences in the distribution of FMO2 polymorphisms except for some pharmacogenetic data that suggest a potentially deleterious role for the functional variant (FMO2*1). This genetic epidemiological study was designed to investigate whether there is an association between FMO2 polymorphisms and TB, an ancient malady that remains a modern global health concern, in a sub-Saharan Africa setting where there is not only a relatively high co-prevalence of the disease and the ancestral FMO2*1 variant but also where both Mycobcaterium and Homo sapiens are considered to have originated and co-evolved. Blood samples and TB related clinical data were collected from ascertained TB cases and unrelated household controls (n = 292) from 3 different ethnic groups in Ethiopia. Latent Mtb infection was determined using Quantiferon to develop reliable TB progression phenotypes. We sequenced exonic regions of FMO2.We identified for the first time an association between FMO2 and TB both at the SNP and haplotype level. Two novel SNPs achieved a study-wide significance [chr1:171181877(A), p = 3.15E-07, OR = 4.644 and chr1:171165749(T), p = 3.32E-06, OR = 6.825] while multiple SNPs (22) showed nominal signals. The pattern of association suggested a protective effect of FMO2 against both active and latent TB with distinct genetic variants underlying the TB-progression pathway. The results were robust for population stratification. Haplotype-based tests confirmed the SNP-based results with a single haplotype bearing the ancestral-and-functional FMO2*1 "C" allele ("AGCTCTACAATCCCCTCGTTGCGC") explaining the overall association (haplotype-specific-p = 0.000103). Strikingly, not only was FMO2*1 nominally associated with reduced risk to "Active TB" (p = 0.0118, OR = 0.496) but it also does not co-segregate with the 5'-3' flanking top high-TB-risk alleles. The study provides an evidence for the existence of an evolutionary adaptation to an ancient disease based on an ancestral genetic variant acting in a haplotypic framework in Ethiopian populations.