Search

Abstract Background Pontocerebellar hypoplasia is an umbrella term describing a heterogeneous group of prenatal neurodegenerative disorders mostly affecting the pons and cerebellum, with 17 types associated with 25 genes. However, some types of PCH lack sufficient information, which highlights the importance of investigating and introducing more cases to further elucidate the clinical, radiological, and biochemical features of these disorders. The aim of this study is to provide an in-depth review of PCH and to identify disease genes and their inheritance patterns in 12 distinct Iranian families with clinically confirmed PCH. Methods Cases included in this study were selected based on their phenotypic and genetic information available at the Center for Comprehensive Genetic Services. Whole-exome sequencing (WES) was used to discover the underlying genetic etiology of participants' problems, and Sanger sequencing was utilized to confirm any suspected alterations. We also conducted a comprehensive molecular literature review to outline the genetic features of the various subtypes of PCH. Results This study classified and described the underlying etiology of PCH into three categories based on the genes involved. Twelve patients also were included, eleven of whom were from consanguineous parents. Ten different variations in 8 genes were found, all of which related to different types of PCH. Six novel variations were reported, including SEPSECS, TSEN2, TSEN54, AMPD2, TOE1, and CLP1. Almost all patients presented with developmental delay, hypotonia, seizure, and microcephaly being common features. Strabismus and elevation in lactate levels in MR spectroscopy were novel phenotypes for the first time in PCH types 7 and 9. Conclusions This study merges previously documented phenotypes and genotypes with unique novel ones. Due to the diversity in PCH, we provided guidance for detecting and diagnosing these heterogeneous groups of disorders. Moreover, since certain critical conditions, such as spinal muscular atrophy, can be a differential diagnosis, providing cases with novel variations and clinical findings could further expand the genetic and clinical spectrum of these diseases and help in better diagnosis. Therefore, six novel genetic variants and novel clinical and paraclinical findings have been reported for the first time. Further studies are needed to elucidate the underlying mechanisms and potential therapeutic targets for PCH.

Abstract Background β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. Results In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Conclusion Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Abstract Background Next‐generation sequencing (NGS)‐based method is being used broadly for genetic testing especially for clinically and genetically heterogeneous disorders, such as inherited retinal degenerations (IRDs) but still not routinely used for molecular diagnostics in Bulgaria. Consequently, the purpose of this study was to evaluate the effectiveness of a molecular diagnostic approach, based on targeted NGS for the identification of the disease‐causing mutations in 16 Bulgarian patients with different IRDs. Methods We applied a customized NGS panel, including 125 genes associated with retinal and other eye diseases to the patients with hereditary retinopathies. Results Systematic filtering approach coupled with copy number variation analysis and segregation study lead to the identification of 16 pathogenic and likely pathogenic variants in 12/16 (75%) of IRD patients, 2 of which novel (12.5%): ABCA4‐c.668delA (p.K223Rfs18) and RР1‐c.2015dupA (p.K673Efs*25). Mutations in the ABCA4, PRPH2, USH2A, BEST1, RР1, CDHR1, and RHO genes were detected reaching a diagnostic yield between 42.9% for Retinitis pigmentosa cases and 100% for macular degeneration, Usher syndrome, and cone‐rod dystrophy patients. Conclusion Our results confirm the usefulness of targeted NGS approach based on frequently mutated genes as a comprehensive and successful genetic diagnostic tool for IRDs with significant impact on patients counseling.

Background: Intrahepatic cholestasis of pregnancy (ICP) is associated with a high incidence of fetal morbidity and mortality. Therefore, revealing the mechanisms involved in ICP and its association with fetal complications is very important.Methods: Here, we used a whole-exome sequencing (WES) approach to detect novel mutations of organic anion transporting polypeptide (OTAP) genes, ATP-binding cassette transporter (ABC) genes, and receptor genes associated with ICP in 249 individuals and 1,029 local control individuals. Two available tools, SIFT and PolyPhen-2, were used to predict protein damage. Protein structuremodeling and comparison between the reference and modified protein structures were conducted by SWISS-MODEL and Chimera 1.14rc software, respectively.Results: A total of 5,583 mutations were identified in 82 genes related to bile acid transporters and receptors, of which 62 were novel mutations. These novel mutations were absent in the 1,029 control individuals and three databases, including the 1,000 Genome Project (1000G_ALL), Exome Aggregation Consortium (ExAC), and Single-Nucleotide Polymorphism Database (dbSNP). We classified the 62 novel loci into two groups (damaging and probably damaging) according to the results of SIFT and PolyPhen-2. Out of the 62 novel mutations, 24 were detected in the damaging group. Of these, five novel possibly pathogenic variants were identified that were located in known functional genes, including ABCB4 (Ile377Asn), ABCB11 (Ala588Pro), ABCC2 (Ile681Lys and Met688Thr), and NR1H4 (Tyr149Ter). Moreover, compared to the wild-type protein structure, ABCC2 Ile681Lys and Met688Thr protein structures showed a slight change in the chemical bond lengths of ATP-ligand binding amino acid side chains. The combined 32 clinical data points indicate that the mutation group had a significantly (p = 0.04) lower level of Cl ions than the wild-type group. Particularly, patients with the 24 novel mutations had higher average values of alanine transaminase (ALT), aspartate transaminase (AST), alkaline phosphatase (ALP), total bile acids (TBA), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) than patients with the 38 novel mutations in the probably damaging group and the local control individuals.Conclusion: The present study provides new insights into the genetic architecture of ICP involving these novel mutations.

Abstract Background Hereditary retinopathy is a significant cause of blindness worldwide. Despite the discovery of many mutations in various retinopathies, a large number of patients remain genetically undiagnosed. Targeted next-generation sequencing of the human genome is a suitable approach for the molecular diagnosis of retinopathy. Methods We describe a cohort of 211 families from central China with various forms of retinopathy; 95 patients were investigated using multigene panel sequencing, and the other 116 with suspected Leber hereditary optic neuropathy (LHON) were tested by Sanger sequencing. The detected variation of targeted sequencing was verified by PCR-based Sanger sequencing. We performed a comprehensive analysis of the cases using sequencing data and ophthalmologic examination information. Results Potential causal mutations were identified in the majority of families with retinopathy (57.9% of 95 families) and suspected LHON (21.6% of 116 families). There were 68 variants of a certain significance distributed in 31 known disease-causing genes in the 95 families; 37 of the variants are novel and have not been reported to be related to hereditary retinopathy. The NGS panel solution provided a 45.3% potential diagnostic rate for retinopathy families, with candidate gene mutations of undefined pathogenicity revealed in another 12.6%of the families. Conclusion Our study uncovered novel mutations and phenotypic aspects of retinopathy and demonstrated the genetic and clinical heterogeneity of related conditions. The findings show the detection rate of pathogenic variants in patients with hereditary retinopathy in central China as well as the diversity and gene distribution of these variants. The significance of molecular genetic testing for patients with hereditary retinopathy is also highlighted.

Mitochondrial deficiencies with unknown causes have been observed in schizophrenia (SZ) and bipolar disorder (BD) in imaging and postmortem studies. Polymorphisms and somatic mutations in mitochondrial DNA (mtDNA) were investigated as potential causes with next generation sequencing of mtDNA (mtDNA-Seq) and genotyping arrays in subjects with SZ, BD, major depressive disorder (MDD), and controls. The common deletion of 4,977 bp in mtDNA was compared between SZ and controls in 11 different vulnerable brain regions and in blood samples, and in dorsolateral prefrontal cortex (DLPFC) of BD, SZ, and controls. In a separate analysis, association of mitochondria SNPs (mtSNPs) with SZ and BD in European ancestry individuals (n = 6,040) was tested using Genetic Association Information Network (GAIN) and Wellcome Trust Case Control Consortium 2 (WTCCC2) datasets. The common deletion levels were highly variable across brain regions, with a 40-fold increase in some regions (nucleus accumbens, caudate nucleus and amygdala), increased with age, and showed little change in blood samples from the same subjects. The common deletion levels were increased in the DLPFC for BD compared to controls, but not in SZ. Full mtDNA genome resequencing of 23 subjects, showed seven novel homoplasmic mutations, five were novel synonymous coding mutations. By logistic regression analysis there were no significant mtSNPs associated with BD or SZ after genome wide correction. However, nominal association of mtSNPs (p

Abstract Background Familial hypomagnesemia with hypercalciuria and nephrocalcinosis (FHHNC) is an autosomal recessive tubulopathy characterized by excessive urinary wasting of magnesium and calcium, bilateral nephrocalcinosis, and progressive chronic renal failure in childhood or adolescence. FHHNC is caused by mutations in CLDN16 and CLDN19, which encode the tight‐junction proteins claudin‐16 and claudin‐19, respectively. Most of these mutations are missense mutations and large deletions are rare. Methods We examined the clinical and biochemical features of a Spanish boy with early onset of FHHNC symptoms. Exons and flanking intronic segments of CLDN16 and CLDN19 were analyzed by direct sequencing. We developed a new assay based on Quantitative Multiplex PCR of Short Fluorescent Fragments (QMPSF) to investigate large CLDN16 deletions. Results Genetic analysis revealed two novel compound heterozygous mutations of CLDN16, comprising a missense mutation, c.277G>A; p.(Ala93Thr), in one allele, and a gross deletion that lacked exons 4 and 5,c.(840+25_?)del, in the other allele. The patient inherited these variants from his mother and father, respectively. Conclusions Using direct sequencing and our QMPSF assay, we identified the genetic cause of FHHNC in our patient. This QMPSF assay should facilitate the genetic diagnosis of FHHNC. Our study provided additional data on the genotypic spectrum of the CLDN16 gene.

Abstract Background No formal diagnostic criteria for progressive pseudo‐rheumatoid dysplasia (PPD) are available because of insufficient clinical data, which results in that PPD is often misdiagnosed with other diseases. Whole exome sequencing (WES) and Sanger sequencing were employed to reveal the novel mutations on CCN6 of five patients with PPD from China in order to increase the clinical data of PPD. Methods Four suspected PPD pedigrees containing five patients in total were collected from 1998 to 2018 in our medical center. The phenotypes of each suspected PPD case were recorded in detail, and peripheral blood samples were collected for subsequent sequencing. Genomic DNA was extracted from peripheral blood samples, and Agilent liquid phase chip capture system was utilized for efficient enrichment of whole exome region DNA. After acquiring raw sequenced reads of whole exome region, bioinformatics analysis was completed in conjunction with reference or genome sequence (GRCh37/hg19). Sanger sequencing was performed to identify the results of WES. Results In total, four novel PPD‐related mutation sites in CCN6 gene were identified including (CCN6):c.643 + 2T>C, (CCN6):c.1064_1065dupGT(p.Gln356ValfsTer33), (CCN6):c.1064G > A), and exon4:c.670dupA:p.W223fs. Conclusion Our findings increase the clinical data of PPD including the CCN6 mutation spectrum, the clinical symptoms and signs. Moreover, the study highlights the utility of WES in reaching definitive diagnoses for PPD.

Abstract Background Congenital hypothyroidism (CH) has an incidence of approximately 1:3000, but only 15% have mutations in the thyroid hormone synthesis pathways. Genetic analysis allows for the precise diagnosis. Case presentation A 3-week old girl presented with a large goiter, serum TSH > 100 mIU/L (reference range: 0.7–5.9 mIU/L); free T4 A, p.Gly2322Ser, which was subsequently confirmed by Sanger sequencing and present in one allele of both parents. DNA samples from 354 alleles in four Sudanese ethnic groups (Nilotes, Darfurians, Nuba, and Halfawien) failed to demonstrate the presence of the mutant allele. Haplotyping showed a 1.71 centiMorgans stretch of homozygosity in the TG locus suggesting that this mutation occurred identical by descent and the possibility of common ancestry of the parents. The mutation is located in the cholinesterase-like (ChEL) domain of TG. Conclusions A novel rare missense mutation in the TG gene was identified. The ChEL domain is critical for protein folding and patients with CH due to misfolded TG may present without low serum TG despite the TG gene mutations.

Abstract Background Dysferlinopathies are a group of autosomal recessive limb‐girdle muscular dystrophies (LGMDs) caused by mutations in DYSF (#603,009). This gene encodes a transmembrane protein called dysferlin. Since there are few reports on Iranian dysferlinopathy patients, we tried to identify the DYSF mutations in affected individuals of Iran. Methods Eight unrelated Iranian families have been selected for this study. Sanger sequencing followed by haplotype analysis was performed to identify individual variations in DYSF sequence. Identified variants were analyzed, and their pathogenicity was interpreted according to the recommendations of the American College of Medical Genetics and Genomics. Results We identified two new mutations in DYSF, the first one is a nonsense mutation c.2419C > T (p.Gln807*), which eliminates downstream part of the protein. Another novel mutation is c. (1,053 + 1_1,054‐1)_(1,397 + 1_1,398‐1)del, which causes deletion of the DNA segment from exon 12 to exon 15. Conclusion Two of the other six families are from the same ethnicity and share the same mutation and haplotype patterns, suggesting a founder mutation. Genetic analysis of dysferlinopathy can prevent a wrong diagnosis of myositis for these patients.

Abstract Background Alport syndrome (AS) is an inherited progressive renal disease caused by mutations in COL4A3, COL4A4, and COL4A5 genes. The large sizes of these genes and the absence of mutation hot spots have complicated mutational analysis by routine PCR‐based approaches. In recent years, the development of next‐generation sequencing (NGS) has made possible the time‐ and cost‐effective and accurate analysis of the three genes in a single step. Methods Here, we analyze COL4A3, COL4A4, and COL4A5 simultaneously in 29 AS patients using NGS. Candidate mutations were validated by classic Sanger sequencing and Real‐time PCR. Results Twenty two new mutations and 10 known mutations were detected. Of those novel mutations, 18, 3, and 1 mutations were detected in COL4A5, COL4A4, and COL4A3, respectively. Twenty six patients showed X‐linked inheritance, one showed autosomal recessive inheritance and two showed digenic inheritance (DI). Conclusion A comparison of the clinical manifestations caused by different types of mutations in COL4A5 suggested that large fragment mutations are relatively more severe than the other missense mutations and AS by some mutations may show inter‐ and intra‐familial phenotypic variability. It is important to consider these transmission patterns in the clinical evaluation according to the results of genetic testing, especially for DI. Twenty two new mutations can expand the genotypic spectrum of AS.

Background/Aims: Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common inherited cystic kidney diseases caused by mutations in two large multi-exon genes, PKD1 and PKD2. High allelic heterogeneity and duplication of PKD1 exons 1–32 as six pseudo genes on chromosome 16 complicate molecular analysis of this disease. Methods: We applied targeted next-generation sequencing (NGS) in 9 non-consanguineous unrelated Iranian families with ADPKD to identify the genes hosting disease-causing mutations. This approach was confirmed by Sanger sequencing. Results: Here, we determined three different novel frameshift mutations and four previously reported nonsense mutations in the PKD1 gene encoding polycystin1 in heterozygotes. Conclusion: This study demonstrates the effectiveness of NGS in significantly reducing the cost and time for simultaneous sequence analysis of PKD1 and PKD2, simplifying the genetic diagnostics of ADPKD. Although a probable correlation between the mutation types and phenotypic outcome is possible, however for more extensive studies in future, the consideration of renal hypouricemia (RHUC) and PKD1 coexistence may be helpful. The novel frameshift mutations reported by this study are p. Q1997X, P. D73X and p. V336X. [ABSTRACT FROM AUTHOR]

Congenital dyserythropoietic anaemias (CDAs) are a group of rare haematological disorders characterized by ineffective erythropoiesis and dyserythropoiesis and reduced numbers of red cells, often with an abnormal morphology. Pathogenic defects in CDAN1 , C15ORF41 , SEC23B , KIF23 , KLF1 and GATA1 genes have been identified in CDAs patients. In this study, we described 13 unrelated Chinese CDAs patients and identified 21 mutations, including 5 novel mutations in CDAN1 gene, and 5 novel mutations in SEC23B gene. Additionally, we predicted the molecular consequence of these missense mutations with Polymorphism Phenotyping v2 (Polyphen), Sorting Intolerant From Tolerant (SIFT), MutPred ( http://mutpred1.mutdb.org /) and Protein Variation Effect Analyzer (Provean, http://provean.jcvi.org/seq_submit.php ) and analyzed the conservation of the mutated amino acid among proteins from several mammalian species. [ABSTRACT FROM AUTHOR]

Introduction West syndrome is a rare epileptic encephalopathy of early infancy, characterized by epileptic spasms, hypsarrhythmia, and psychomotor retardation beginning in the first year of life. Methods The present study reports the clinical, molecular and bioinformatic investigation in the three studied West patients. Results The results revealed a complex genotype with more than one mutation in each patient including the known mutations c.1910C > G (P2, P3); c.2372A > C in P3 and c.2395C > G in P1 and novel variants including c.616 G > A, shared by the three patients P1, P2 and P3; c.1403G > C shared by P2 and P3 and c.2288A > G in patient P1. Conclusions All the mutations were at somatic mosaic state and were de novo in the patients except ones (c.2372A > C). To our knowledge; the somatic mosaic state is described for the first time in patients with West syndrome. Five identified mutations were located in the C-terminal domain of the protein, while the novel mutation (c.616 G > A) was in the catalytic domain. Bioinformatic tools predicted that this latter is the most pathogenic substitution affecting 3D protein structure and the secondary mRNA structure. Complex genotype composed of different combinations of mutations in each patient seems to be related to the phenotype variability. [ABSTRACT FROM AUTHOR]

The risk of patients with Hirschsprung's disease later developing multiple endocrine neoplasia remains a matter of concern. The multiple endocrine neoplasia 2-Hirschsprung's disease association has been shown to cosegregate in Hirschsprung's disease patients with both short- and long-segment aganglionosis, although patients with long-segment aganglionosis a to carry the greatest risk. The Hirschsprung's disease-medullary thyroid carcinoma relationship also appears to be bi-directional, and activation or suppression of the rearranged during transfection gene appeared to vary over succeeding generations within the same family. Rearranged during transfection gene variations are associated with both conditions. The cosegregation of Hirschsprung's disease and multiple endocrine neoplasia 2 is particularly interesting as it involves both "switch off" and "switch on" of the rearranged during transfection proto-oncogene in the same patient. This cosegregation mostly relates to the cysteine-rich area on RET620 (the "Janus gene"). The mechanism whereby rearranged during transfection influences gene activation in multiple endocrine neoplasia 2 is complex, but genetic variations impair the rearranged during transfection tyrosine kinase response to tyrosine kinase activation, thus appearing to dictate downstream signaling cascade responses. Better understanding of the RET-620 relationship allows for a more cost-effective method of identifying those at risk by focusing rearranged during transfection gene testing to this specific area as a "hot spot". The clinical awareness of possible medullary thyroid carcinoma has led to timely intervention and early treatment of this chemo- and radioresistant tumor with poor prognosis. Establishment of "risk" by genetic testing has become a classic model of molecular medicine being integrated into patient care and offering rearranged during transfection directed prophylactic surgical management. In addition, novel approaches to treatment based on this genetic knowledge have already shown early promise in randomized clinical trials.

Purpose: X-linked agammagobulinemia (XLA) is a primary immunodeficiency caused by Bruton's tyrosine kinase ( BTK) gene defect. XLA patients have absent or reduced number of peripheral B cells and a profound deficiency in all immunoglobulin isotypes. This multicenter study reports the clinical, immunological and molecular features of Bruton's disease in 40 North African male patients. Methods: Fifty male out of 63 (male and female) patients diagnosed with serum agammaglobulinemia and non detectable to less than 2 % peripheral B cells were enrolled. The search for BTK gene mutations was performed for all of them by genomic DNA amplification and Sanger sequencing. Results: We identified 33 different mutations in the BTK gene in 40 patients including 12 missense mutations, 6 nonsense mutations, 6 splice-site mutations, 5 frameshift, 2 large deletions, one complex mutation and one in-frame deletion. Seventeen of these mutations are novel. This large series shows a lower frequency of XLA among male patients from North Africa with agammaglobulinemia and absent to low B cells compared with other international studies (63.5 % vs 85 %). No strong evidence for genotype-phenotype correlation was observed. Conclusions: This study adds to other reports from highly consanguineous North African populations, showing lower frequency of X-linked forms as compared to AR forms of the same primary immunodeficiency. Furthermore, a large number of novel BTK mutations were identified and could further help identify carriers for genetic counseling. [ABSTRACT FROM AUTHOR]

Isolated complex III (cIII) deficiency is a rare biochemical finding in mitochondrial disorders, mainly associated with mutations in mitochondrial DNA MTCYB gene, encoding cytochrome b, or in assembly factor genes (BCS1L, TTC19, UQCC2 and LYRM7), whereas mutations in nuclear genes encoding cIII structural subunits are extremely infrequent. We report here a patient, a 9 year old female born from first cousin related parents, with normal development till 18 months when she showed unsteady gait with frequent falling down, cognitive and speech worsening. Her course deteriorated progressively. Brain MRI showed cerebellar vermis hypoplasia and bilateral lentiform nucleus high signal lesions. Now she is bed ridden with tetraparesis and severely impaired cognitive and language functions. Biochemical analysis revealed isolated cIII deficiency in muscle, and impaired respiration in fibroblasts. We identified a novel homozygous rearrangement in TTC19 (c.213_229dup), resulting in frameshift with creation of a premature termination codon (p.Gln77Argfs*30). Western blot analysis demonstrated the absence of TTC19 protein in patient’s fibroblasts, while Blue-Native Gel Electrophoresis analysis revealed the presence of cIII-specific assembly intermediates. Mutations in TTC19 have been rarely associated with mitochondrial disease to date, being described in about ten patients with heterogeneous clinical presentations, ranging from early onset encephalomyopathy to adult forms with cerebellar ataxia. Contrariwise, the biochemical defect was a common hallmark in TTC19 mutant patients, confirming the importance of TTC19 in cIII assembly/stability. Therefore, we suggest extending the TTC19 mutational screening to all patients with cIII deficiency, independently from their phenotypes.

Primary Autosomal Recessive Microcephaly ( MCPH) is characterized by congenital microcephaly usually without additional clinical findings. The most common gene implicated in MCPH is ASPM and a large percentage of mutations described have been homozygous and in consanguineous families primarily of East Asian and Middle Eastern origin. ASPM sequencing was performed on 400 patients between the years 2009 and 2012. Seventy of the patient samples were also analyzed for copy number changes in the ASPM gene. Forty protein truncating mutations, including 29 novel mutations, were identified in 39 patients with MCPH. Approximately one third of patients were compound heterozygotes, indicative of non-consanguinity in these patients. In addition, 46 non-synonymous variants were identified and interpreted as variants of uncertain significance. No deletion/duplication in ASPM was identified in the patients analyzed. A wide ethnic distribution was observed, including the first reported patients with ASPM-related MCPH of Hispanic descent. Clinical information was collected for 26 of the ASPM-positive patients and 41 of the ASPM-negative patients. As more individuals are identified with MCPH, we anticipate that we will continue to identify ASPM mutation-positive patients from all ethnic origins supporting the occurrence of this genetic condition beyond that of consanguineous families of certain ethnic populations. [ABSTRACT FROM AUTHOR]

Abstract: Gaucher disease is an autosomal recessive lysosomal storage disorder resulting from deficient glucocerebrosidase activity. There have been nearly 300 mutations described to date. Novel mutations can potentially provide insight into the biochemical basis of the disease. Two novel mutations are described in two Type 1 Gaucher patients with N370S compound heterozygosity; a point mutation that causes an amino acid substitution at cysteine residue 23 for tryptophan, and a second point mutation within the splicing element at the 3′ end of intron 7. Both mutations were identified by PCR amplification and sequence analysis of patient glucocerebrosidase genomic DNA. Restriction fragment length polymorphism analysis was established for both novel mutations for efficient identification in future patients. Past literature suggests that mutations affecting cysteine residues involved in disulfide bridges, as well as mutations affecting splicing patterns of the glucocerebrosidase transcript, are detrimental to enzyme activity. However, compound heterozygosity with N370S, a mild mutation, will lead to a mild phenotype. The cases reported here support these past findings. [Copyright &y& Elsevier]

Mitochondrial deficiencies with unknown causes have been observed in schizophrenia (SZ) and bipolar disorder (BD) in imaging and postmortem studies. Polymorphisms and somatic mutations in mitochondrial DNA (mtDNA) were investigated as potential causes with next generation sequencing of mtDNA (mtDNA-Seq) and genotyping arrays in subjects with SZ, BD, majordepressive disorder (MDD) and controls. The common deletion of 4,977 bp inb mtDNA was compared between SZ and controls in eleven different vulnerable brain regions and in blood samples, and in dorsolateral prefrontal cortex (DLPFC) of BD, SZ, and controls. In a separate analysis, association of mitochondria SNPs (mtSNPs) with SZ and BD in European ancestry individuals(n = 6,040) was tested using Genetic Association Information Network (GAIN) and Wellcome Trust Case Control Consortium 2 (WTCCC2) datasets. The common deletion levels were highly variable across brain regions, with a 40-fold increase in some regions (nucleus accumbens, caudate nucleus and amygdala), increased with age, and showed little change in blood samples from the same subjects. The common deletion levels were increased in the DLPFC for BD compared to controls, but not in SZ. Full mtDNA genome resequencing of 23 subjects, showed 7 novel homoplasmic mutations, 5 were novel synonymous coding mutations. By logistic regression analysis there were no significant mtSNPs associated with BD or SZ after genome wide correction. However, nominal association of mtSNPs (p < 0.05) to SZ and BD were found in the hypervariable region of mtDNA to T195C and T16519C. The results confirm prior reports that certain brain regions accumulate somatic mutations at higher levels than blood. The study in mtDNA of common polymorphisms, somatic mutations, and rare mutations in larger populations may lead to a better understanding of the pathophysiology of psychiatric disorders.

Anorectal malformations (ARMs) represent a complex group of congenital anomalies resulting from abnormal development of the hindgut, allantois and Mullerian duct resulting in complete or partial urorectal septal malformations. There is a wide variety of phenotypic expression, ranging from mild anorectal to very complex severe ARM with >75 % having other associated malformations. 50 % of cases are syndromic although many may have other associated anomalies. This suggests a genetic link but the genetics of ARM are highly complex with a number of candidate genes being identified. Many can be classified as 'field defects' as a result of a complex set of genetic interactions. Patients with associated malformations can be classified into those with multiple congenital anomalies (non-syndromic), those with chromosomal abnormalities and those with non-chromosomal syndromic associations, also, those with non-chromosomal syndromes and the influence of environmental factors (e.g. drugs in pregnancy). Although much is not known about the aetiology of ARM, the weight of evidence points to genetic factors as major causes for the condition. In this review, we look at the chromosomal and genetic associations and their underlying signalling pathways, to obtain a better understanding of the pathogenetic mechanisms involved in developing ARM. The spectrum of ARM phenotypic expression probably results from involvement and crosstalk between a number of critical signalling systems involved in development of this region. As a result, it may be expressed as a 'field developmental defect' with many associated abnormalities. The role of environmental factors in the development of ARM is probably less. [ABSTRACT FROM AUTHOR]

Abstract: The disorder trimethylaminuria (TMAu) often manifests itself in a body odor for individuals affected. TMAu is due to decreased metabolism of dietary-derived trimethylamine (TMA). In a healthy individual, 95% or more of TMA is converted by the flavin-containing monooxygenase 3 (FMO3, EC 1.14.13.8) to non-odorous trimethylamine N-oxide (TMA N-oxide). Several single nucleotide polymorphisms (SNPs) of the FMO3 gene have been described and result in an enzyme with decreased or abolished functional activity for TMA N-oxygenation thus leading to TMAu. Herein, we report two novel mutations observed from phenotyping and genotyping two self-reporting individuals. Sequence analysis of the exon regions of the FMO3 gene of a young woman with severe TMAu revealed heterozygous mutations at positions 187 (V187A), 158 (E158K), 308 (E308G), and 305 (E305X). Familial genetic analysis showed that the E158K/V187A/E308G derived from the same allele from the mother, and the E305X was derived from the father. FMO3 variants V187A and V187A/E158K were characterized for oxygenation of several common FMO3 substrates (i.e., 5- and 8-DPT, mercaptoimidazole (MMI), TMA, and sulindac sulfide) and for its thermal stability. Our findings show that with the combination of V187A/E158K mutations in FMO3, the enzyme activity is severely affected and possibly contributes to the TMAu observed. In another study, genotyping analysis of a 17year old female revealed a mutation that caused a frame shift after K415 and resulted in a protein variant with only 486 amino acid residues that was associated with severe TMAu. [Copyright &y& Elsevier]

Abstract: Familial hypercholesterolemia (FH) is an autosomal dominant disease caused by mutations in the low-density lipoprotein receptor (LDLR), apolipoprotein B (APOB), and proprotein convertase subtilisin/kexin type 9 (PCSK9) genes. In previous studies, we have identified novel mutations in Tunisian FH families. In this study, we have extended our investigation to additional families. Five unrelated probands were screened for mutations in the LDLR and APOB genes, using direct sequencing and enzymatic restriction. We identified two novel LDLR mutations: a missense mutation in exon 7: p.Gly343Cys (c.1027G>T), and a nonsense mutation in exon 17: p.Lys816X (c.2446A>T). Using the PolyPhen and SIFT prediction computer programs the p.Gly343Cys is predicted to have a deleterious effect on LDL receptor activity. The missense mutation we found in exon 3, p.Cys89Trp (c.267C>G), has previously been identified in patients from United Kingdom and Spain, and is reported here for the first time in the Tunisian population. Finally, the framshift mutation in exon 10, p.Ser493ArgfsX44, is reported here for the fourth and fifth time in Tunisian families. The latter is the most frequent FH-causing mutation in Tunisia. These LDLR gene mutations enrich the spectrum of mutations causing FH in the Tunisian population. The framshift mutation, p.Ser493ArgfsX44, seems to be a founder mutation in this population. [Copyright &y& Elsevier]

Autosomal recessive limb-girdle muscular dystrophies (LGMD2s) are a clinically and genetically heterogeneous group of disorders, characterized by progressive involvement of the proximal limb girdle muscles; the group includes at least 10 different genetic entities. The calpainopathies (LGMD2A), a subgroup of LGMD2s, are estimated to be the most common forms of LGMD2 in all populations so far investigated. LGMD2A is usually characterized by symmetrical and selective atrophy of pelvic, scapular and trunk muscles and a moderate to gross elevation of serum CK. However, the course is highly variable. It is caused by mutations in the CAPN3 gene, which encodes for the calpain-3 protein. Until now, 161 pathogenic mutations have been found in the CAPN3 gene. In the present study, through screening of 93 unrelated LGMD2 families, we identified 29 families with LGMD2A, 21 (22.6%) of which were identified as having CAPN3 gene mutations. We detected six novel (p.K211N, p.D230G, p.Y322H, p.R698S, p.Q738X, c.2257delGinsAA) and nine previously reported mutations (c.550delA, c.19_23del, c.1746-20C>G, p.R49H, p.R490Q, p.Y336N, p.A702V, p.Y537X, p.R541Q) in the CAPN3 gene. There may be a wide variety of mutations, but clustering of specific mutations (c.550delA: 40%, p.R490Q: 10%) could be used in the diagnostic scheme in Turkey. [ABSTRACT FROM AUTHOR]

The development of neutralising antibodies to factor VIII (FVIII) is a major complication of haemophilia A (HA) therapy. We aimed to construct an individual risk profile for the development of inhibitors in HA and started by screening for the causative mutation in our HA patient population. A total of 109 patients and 28 carriers were screened. The analysis revealed 38 different mutations in the FVIII gene, of which 13 have not been described on the Haemophilia A Mutation, Search, Test and Resource Site (HAMSTeRS). Twenty-five mutations have been reported previously and all except two had a similar phenotype to what has been described. Three novel mutations were associated with severe HA: one non-missense mutation, a small insertion in the A2 domain, and two missense mutations, a H256R mutation in the A1 domain and a L2025P substitution in the C1 domain. One novel mutation, Y156C, was associated with moderate HA. Nine novel mutations caused mild HA. The P130R, D167E and V278M mutations are located in the A1 domain. R439C, Y511H, A544G and Q645H in the A2 domain, L1758F in the A3 domain and a S2157R mutation in the C1 domain. In conclusion, the genotypic profile of our HA population was not different from others described and is suitable to study inhibitor formation. [ABSTRACT FROM AUTHOR]

Autosomal recessive limb-girdle muscular dystrophy linked to 19q13.3 (LGMD2I) was recently related to mutations in the fukutin-related protein gene (FKRP) gene. Pathogenic changes in the same gene were detected in congenital muscular dystrophy patients (MDC1C), a severe disorder. We have screened 86 LGMD genealogies to assess the frequency and distribution of mutations in the FKRP gene in Brazilian LGMD patients. We found 13 Brazilian genealogies, including 20 individuals with mutations in the FKRP gene, and identified nine novel pathogenic changes. The commonest C826A European mutation was found in 30% (9/26) of the mutated LGMD2I alleles. One affected patient homozygous for the FKRP (C826A) mutation also carries a missense R125H change in one allele of the caveolin-3 gene (responsible for LGMD1C muscular dystrophy). Two of her normal sibs were found to be double heterozygotes. In two unrelated LGMD2I families, homozygous for novel missense mutations, we identified four asymptomatic carriers, all older than 20 years. Genotype-phenotype correlation studies in the present study as well as in patients from different populations suggests that the spectrum of variability associated with mutations in the FKRP gene seems to be wider than in other forms of LGMD. It also reinforces the observations that pathogenic mutations are not always determinant of an abnormal phenotype, suggesting the possibility of other mechanisms modulating the severity of the phenotype that opens new avenues for therapeutic approaches.European Journal of Human Genetics (2003) 11, 923-930. doi:10.1038/sj.ejhg.5201066 [ABSTRACT FROM AUTHOR]

DNA screening for mutations in the α-l-iduronidase (IDUA) gene was performed in a Chinese mucopolysaccharidosis type IH/S patient. The patient had two different mutations: the maternal allele has L346R (t–g transversion in codon 346) and the paternal allele has 388-3c–g (c–g transversion at position -3 of the 3′ splice site of intron 2). In transfected COS-7 cells, L346R showed no appreciable IDUA activity (0.4% of normal activity), although it did not cause an apparent reduction in IDUA mRNA or protein level. The 388-3c–g mutation profoundly affects normal splicing leading to a very unstable mRNA. Expression of the IDUA cDNA containing the mutated acceptor splice site showed trace amounts of enzyme activity (1.6% of normal activity). The results provide further support for the importance of cytosine at the -3 position in RNA processing. [ABSTRACT FROM AUTHOR]

Abstract: Cystinosis is an autosomal recessive disorder characterized by defective transport of cystine across the lysosomal membrane and resulting in renal, ophthalmic, and other organ abnormalities. Mutations in the CTNS gene cause a deficiency of the transport protein, cystinosin. We performed mutation analysis of CTNS in six cystinosis patients from four families in Thailand. Using PCR sequencing of the entire coding regions, we identified all eight mutant alleles, including two mutations, p.G309D and p.Q284X, that have not been previously reported. This study expands the mutational and population spectrum of nephropathic cystinosis. [Copyright &y& Elsevier]