Search

The complete mitochondrial (mt) genome of Stereolepis doederleini was sequenced from a specimen collected in a commercial aquarium in Jeju Island. The sequence was 16,513 base pairs in length and, similar to other vertebrate mt genomes, included 37 mt genes and a noncoding control region; the gene order was identical to that of typical vertebrate mt genome. Mitochondrial genome sequences of 17 species from 12 families were used to reconstruct phylogenetic relationships within the order Pempheriformes. The phylogenetic trees were constructed with three methods (neighbor joining [NJ], maximum likelihood [ML], and Bayesian method) using 12 protein coding genes, but not ND6. In all phylogenetic trees, Pempheriformes were clustered into three strongly supported clades. Two Acropomatidae species (Synagrops japonicus in clade-Ⅰ and Doederleinia berycoides in clade-Ⅲ) were polyphyletic; S. japonicus was close to Lateolabracidae and was the sister of Glaucosomatidae + (Pempheridae/(Percophidae+Creediidae)), and D. berycoides was sister to Howellidae + Epigonidae. All phylogenetic trees supported a sister relationship between Creediidae and Percophidae in clade-Ⅰ. Glaucosomatidae formed a sister clade with Pempheridae. The relationships within clade-Ⅱ, which was composed of four families (Pentacerotidae, Polyprionidae, Banjosidae, and Bathyclupeidae), slightly differed between NJ/ML and BI tree topologies. In clade-Ⅲ, the relationships among Howellidae, Epigonidae, and Acropomatidae were strongly supported.

A sex-linked random amplified polymorphic DNA (RAPD) marker was identified from Asparagus officinalis L. and was converted into a sequence-characterized amplified regions (SCAR) marker for the large-scale screening of male and female plants. A total of 100 arbitrary decamer oligonucleotide primers were used for the RAPD analysis. Among them, the primer UBC347 amplified one female-specific 400 base pair DNA. Subsequently, the amplified RAPD fragment was cloned and sequenced. The fragment was abundant in AT and shared sequence homology with retrotransposon elements. On the basis of the sequence obtained, a pair of SCAR primer was designed. The amplification product, named F400, was the same size as the respective RAPD fragment from which it was derived. The F400 SCAR marker resulted to be female-specific in the three asparagus varieties tested in this study. This SCAR marker can be used for an early and rapid identification of female and male plants during breeding programs of asparagus.

We determined the complete mitochondrial genomes of Pseudolabrus sieboldi and P. eoethinus, and analyzed the genome organization, codon usage, and transition/transversion mutation ratio of the mitochondrial genome. The mitochondrial genomes of P. sieboldi and P. eoethinus are 16,507 and 16,508 bp in length, respectively, and consisted of 37 genes (13 protein-coding genes, two ribosomal RNAs, and 22 transfer RNAs), which is typical for vertebrate mitochondrial DNA. All protein-coding genes of two species used the initiation codon ATG except the cytochrome c oxidase subunit (CO) 1, which began with GTG as an initiation codon. However, the termination codon for the NADH dehydrogenase subunit (ND) 6 gene encoded with TAA in P. sieboldi, and TAG in P. eoethinus. The 12S and 16S rRNA genes were 949 and 1694 bp, respectively, in P sieboldi, and were 948 and 1693 bp in P. eoethinus. The A+T content of the two rRNA genes were 52.9% in P. sieboldi and 52.5% in P. eoethinus, which is slightly lower than that of othe...

We determined the complete nucleotide sequence of the mitochondrial genome for the rabbitfish Siganus fuscescens (Perciformes, Siganidae). This mitochondrial genome, consisting of 16,491 base pairs (bp), included 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs, and a noncoding control region similar those found in other vertebrates; the gene order was identical to that of typical vertebrates. Most of the genes of S. fuscescens were encoded on the H-strand, while the ND6 and eight tRNA (Gln, Ala, Asn, Cys, Tyr, Ser [UCN], Glu, and Pro) genes were encoded on the L-strand. The reading frames of ATPase 8 and 6 and those of ND4L and ND4 overlapped by ten and seven nucleotides, respectively. All mitochondrial protein-coding genes began with an ATG start codon, except for CO1, which started with GTG. Open reading frames of S. fuscescens ended with TAA (ND1, CO1, ATPase 8, ND4L, ND5 and ND6), and the remainder had incomplete stop codons, either TA (ATPase 6 and CO3) or T (ND2, CO2, ND3, ND4, and Cytb). The origin of L-strand replication in S. fuscescens was located in a cluster of five tRNA genes (WANCY) and was 34 nucleotides in length. A major noncoding region between the tRNA-Pro and tRNA-Phe genes (828 bp) was considered to be the control region (D-loop). Within this sequence, we identified a conserved sequence block characteristic of this region. The rabbitfish was grouped with Siganus canaliculatus in most parsimony analyses, which showed 100% bootstrap support for their divergence. These findings are useful for inferring phylogenetic relationships and identification within the suborder Acanthuroidei.

To develop a SCAR primer related to the hairy-fruit trait in the genusActinidia, we took a PCR-RAPD approach using arbitrary 10-mer primers. PCR with the UBC 376 primer generated specific fragments from three species with hairy fruit skin. Those fragments were then cloned to determine their nucleotide sequences. Two SCAR primers were designed from the UBC 376 primer and nucleotide sequences were obtained from the PCR fragments. A SCAR primer, OKC385, specifically amplified a 385-bp fragment from one clone ofActinidia eriantha, four ofActinidia chinensis, and four ofActinidia deliciosa. Deduced amino acid sequences of this fragment showed high sequence homology with plant cellulose synthases, which are involved in the biosynthesis of cellulose, a major cell wall component. The 385-bp fragment was specifically detected only in the seriesPerfectae C.F. Liang of sectionStellatae Li. This type has many hairs on the leaves, fruits, and stems, suggesting that the gene containing the PCR fragment is involved in hair formation in this phylogenetic group. Taken together, our results suggest that the SCAR primer, OKC385, can be used as a specific primer for early selection of the non-hair trait in breeding of the genusActinidia.

The phylogeny of 10 taxa belonging to three sections of Arisaema (Pistillata, Tortuosa, and Arisaema) distributed in Korea and an outgroup taxon (Pinellia ternate) was analyzed by comparing the trnL(UAA)-trnF(GAA) intergenic spacer sequences of the chloroplast DNA (cpDNA). The trnL-trnF regions ranged from 336 to 396 base pairs (bp) in length. Sequence alignment required 18 base substitutions and 4 independent indels in the region. The longest length mutation was a 35-bp deletion in A. thunbergii, A. heterophyllum, A. urashima, and A. candidissimum. Two different restriction fragment patterns were seen with MspI digestions. Section Tortuosa (A. thunbergii and A. heterophyllum) plus A. urashima and A. candidissium were distinguished from the others. In addition, 16-bp deletions were found in A. thunbergii, A. heterophyllum, and A. candidissimum. Four species possessed a 24-bp insertion mutation with a duplication motif, TTTTGTTAGGTTATCCTTACACTT:A. amurense f. serratum, A. robustum f. purpureum, A. peninsulae, and A. sikokianum. A maximum parsimony analysis of 11 accessions produced 12 equally most-parsimonious (MP) trees. The MP trees also contained three independent groups. Group I contained one taxon:A. ringens f. praecox. Group II contained the section Tortuosa accessions including A. urashima and A. candidissimum. Group III contained the section Arisaema and A. sikokianum. These results show that analyses of the cpDNA trnL-trnF intergenic spacer are a useful approach for inferring phylogenetic relationships and identification within the genus Arisaema, distributed in Korea.

We obtained the complete mitochondrial genome of the Ussuri white-toothed shrew Crocidura lasiura (Insectivora, Soricidae) at 17 362 base pairs (bp) containing 13 protein-coding genes, two ribosomal RNAs, 22 transfer RNAs, and a non-coding control region. Its gene order is identical to that of other vertebrates. Several repeat elements were identified in the non-coding control region (D-loop). Phylogenetic tree using mt protein-coding gene sequences showed that C. lasiura was closely related to C. attenuata. The reports of mt genome sequences of Crocidura were not enough to study phylogenetic relationships in genome levels. However, this report may help us to understand the phylogenetic relationships and evolutionary history of Crocidura.

We cloned and sequenced the complete mitochondrial DNA (mtDNA) of three tilefishes (Branchiostegus albus, Branchiostegus argentatus, and Branchiostegus japonicus) to characterize and compare their mitochondrial genomes (mitogenomes). The mitogenomes of B. albus, B. argentatus, and B. japonicus were 16,532, 16,550, and 16,541 bp long, respectively, and all consisted of 37 genes (13 protein-coding genes, 2 ribosomal RNA, and 22 transfer RNA (tRNAs)), which are typical for vertebrate mtDNA. As in other bony fishes, most genes were encoded on the H-strand, except for the nad6 and eight tRNA genes that were encoded on the L-strand. Among the 13 protein-coding genes of all three tilefishes, 2 reading-frame overlaps were found on the same strand: atp8 and atp6 overlapped by 10 nucleotides, and nad4L and nad4 overlapped by 7 nucleotides. The identity of the nad4 gene between B. albus and B. argentatus was the lowest at 87%. Conversely, the identity of the nad6 gene between B. albus and B. japonicus was the highest at 99%. Most tRNA genes were similar in length among the three species, while the tRNA-Ser((AGY)) of B. japonicus was 9 bp longer than those of B. albus and B. argentatus. The control region of the mitogenome spanned 853, 862, and 856 bp in B. albus, B. argentatus, and B. japonicus, respectively. A maximum likelihood tree constructed using 11,035 sites contained five independent groups with bootstrap values of 100% in support of their divergence. All three tilefishes examined were clustered with the Pomacanthidae species in Group II.

We determined the complete nucleotide sequence of the mitochondrial genome for the rock bream, Oplegnathus fasciatus (Perciformes, Oplegnathidae). This mitochondrial genome, consisting of 16,511 base pairs (bp), encoded genes for 13 protein-coding genes, two ribosomal RNAs, 22 transfer RNAs, and a noncoding control region like those found in other vertebrates, with the gene order identical to that of typical vertebrates. Most of the genes of O. fasciatus were encoded on the H-strand, while the ND6 and eight tRNA (Gln, Ala, Asn, Cys, Tyr, Ser (UCN), Glu and Pro) genes were encoded on the L-strand. The reading frames of two pairs of genes overlapped: ATPase 8 and 6 and ND4L and ND4 by ten and seven nucleotides, respectively. The origin of L-strand replication in O. fasciatus was in a cluster of five tRNA genes (WANCY) and was 41 nucleotides in length. The conserved motif (5′-GCGGG-3′) was found at the base of the stem within the tRNA-Cys gene. A major noncoding region between the tRNA-Pro and tRNA-Phe genes (835 bp) was considered to be the control region (D-loop). Within this sequence, we identified a termination-associated sequence and a conserved sequence block characteristic to this region. In most parsimony analyses, the O. fasciatus was positioned in the clade including Emmelichthyidae, Lutjanidae, Percidae, Centrarchidae, and Sparidae, with 100% bootstrap support for their divergence.

The complete mitochondrial (mt) genome of the Chinese many-toothed snake, Sibynophis chinensis, was sequenced and found to be 17,163 bp in length. The arrangement of 13 protein-coding genes, tRNAs and rRNAs was identical to that of other common snake mt genomes. The mt protein-coding genes of S. chinensis utilized ATA, ATG, ATA and GTG as initiation codons and AGA, AGG, TAA, TAG and T as termination codons. Among three tRNA clusters (LQM, WANCY and HSL), LQM was found instead of IQM, which is common in other vertebrates. We also identified two control regions that contained several conserved elements known as conserved sequence blocks and termination-associated sequences related to mt replication and transcription.

We determined the complete nucleotide sequence of the mitochondrial (mt) genome for the longtooth grouper, Epinephelus bruneus (Perciformes, Serranidae). This mt genome, consisting of 16,686 base pairs (bp), encoded genes for 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs, and a noncoding control region as those found in other vertebrates, with the gene order identical to that of typical vertebrates. A major noncoding region between the trnP and trnF genes (991 bp) was considered to be the control region (D-loop). Within this sequence, 22 copies of a 17-bp tandem repeat element, 5'-TGATATTACATATATGC-3', were identified in the control region unlike previous reported Epinephelus species.