Search

A genome-wide association study (GWAS) was performed using a high-density infinium 90K SNP array. We identified a total markers traits associations (MTAs) (p ?0.000) for the following plant traits; days taken to 50% heading(DH), days to 50% maturity (DM), plant height (Ph) cm, flag leaf area cm2 (FLA), tillers number per plant, spike length (SL) cm and grain yield per plant (GP) g. Most of the SNPs were identified in the A and B genome as compared to the D genome. The significant associated SNPs were mainly distributed on the chromosome 2B, 3B, 5A, and 5B. Nine SNPs on chromosome 5A, 2B and 2D were identified having pleiotropic effects The correlation analysis showed a significant positive association among SL, NT, GP. Which depicted that these traits are promising for breeding high yielding wheat cultivars. This study provided useful information of the valuable genetic loci for marker-assisted breeding.

Understanding genetic architecture of a crop germplasm is necessary for designing a successful breeding program. Herein, we evaluated a large collection of 500 spring wheat accessions for 2 crop seasons to dissect the genetics of 11 yield components and their direct and indirect contributions to grain yield (GY). The genetic estimates of broad sense heritability (h2), genetic advance (GA), phenotypic correlation (rp), genotypic correlation (rg), and path coefficient analysis were performed. Significant genetic variation was observed for all yield traits suggesting that GY can be improved by exploiting the studied yield traits. Phenotypic coefficient of variation (Vp) was greater than genotypic coefficient of variation (Vg) for all studied traits. Higher broad sense h2 and GA were observed for grains per plant (GpP), spikes per plant (SpP), spikelets per spike (Spt/S) and grain yield (GY). The GY exhibited significant and positive correlation with all studied traits except with spikelet density (SptD). The GpP and TGW exhibited positive direct effect on increasing grain yield. Taking together, SpP, GpS, TGW and SDW are the major contributors to improving genetic yield potential of bread wheat with spring growth habit. The negative correlation between GY and SptD was dissected in path coefficient analysis as negative indirect effect of SptD on GY through reduced GpS and TGW. Our study provides new insights on the association of GpP, TGW and SDW in bread wheat. The GpP, TGW and SDW are influenced by SpP, Gpt/S, G/Spt, SptD, AL and PH with indirect effects on GY. To improve yield potential in wheat, the traits with direct effects (GpP, TGW and SDW) and indirect effects (e.g., SptD) can be used as selection criteria.

Among different abiotic stresses, drought stress is the leading cause of impaired plant growth and low productivity worldwide. It is therefore essential to understand the process of drought tolerance in plants and thus to enhance drought resistance. Accumulating evidence indicates that phytohormones are essential signaling molecules that regulate diverse processes of plant growth and development under drought stress. Plants can often respond to drought stress through a cascade of phytohormones signaling as a means of plant growth regulation. Understanding biosynthesis pathways and regulatory crosstalk involved in these vital compounds could pave the way for improving plant drought tolerance while maintaining overall plant health. In recent years, the identification of phytohormones related key regulatory genes and their manipulation through state-of-the-art genome engineering tools have helped to improve drought tolerance plants. To date, several genes linked to phytohormones signaling networks, biosynthesis, and metabolism have been described as a promising contender for engineering drought tolerance. Recent advances in functional genomics have shown that enhanced expression of positive regulators involved in hormone biosynthesis could better equip plants against drought stress. Similarly, knocking down negative regulators of phytohormone biosynthesis can also be very effective to negate the negative effects of drought on plants. This review explained how manipulating positive and negative regulators of phytohormone signaling could be improvised to develop future crop varieties exhibiting higher drought tolerance. In addition, we also discuss the role of a promising genome editing tool, CRISPR/Cas9, on phytohormone mediated plant growth regulation for tackling drought stress.

To evaluate the genetic background of lodging traits, six populations of two wheat crosses were sown under different nitrogen levels by using split plot design. Generation mean analysis was used to estimate the gene action for lodging related traits. Results showed genetic variability and significant differences for all traits. Allelic and non-allelic gene actions were operative for different traits with different magnitude under both normal and lodging condition. Duplicate types of espistasis were observed for grain yield per plant, 1000- kernel weight, number of grains per spike and number of tillers. The stem diameter, height of basal nodes and basal inter-nodal distance depicted the additive, additive × dominance and dominance gene action. The aforementioned results showed that plant height, stem diameter, height of basal nodes and basal internodal distance were more prone traits for lodging and selection should be practiced in later generations with increasing homozygosity.

Stripe rust is a continuous threat to wheat crop all over the world. It causes considerable yield losses in wheat crop every year. Continuous deployment of adult plant resistance (APR) genes in newly developing wheat cultivars is the most judicious strategy to combat this disease. Herein, we dissected the genetics underpinning stripe rust resistance in Pakistani wheat germplasm. An association panel of 94 spring wheat genotypes was phenotyped for two years to score the infestation of stripe rust on each accession and was scanned with 203 polymorphic SSRs. Based on D´ measure, linkage disequilibrium (LD) exhibited between loci distant up to 45 cM. Marker-trait associations (MTAs) were determined using mixed linear model (MLM). Total 31 quantitative trait loci (QTLs) were observed on all 21 wheat chromosomes. Twelve QTLs were newly discovered as well as 19 QTLs and 35 previously reported Yr genes were validated in Pakistani wheat germplasm. The major QTLs were QYr.uaf.2AL and QYr.uaf.3BS (PVE, 11.9%). Dissection of genes from the newly observed QTLs can provide new APR genes to improve genetic resources for APR resistance in wheat crop.

In recent decades, Pakistan has suffered a decline in cotton production due to several factors, including insect pests, cotton leaf curl disease (CLCuD), and multiple abiotic stresses. CLCuD is a highly damaging plant disease that seriously limits cotton production in Pakistan. Recently, genome editing through CRISPR/Cas9 has revolutionized plant biology, especially to develop immunity in plants against viral diseases. Here we demonstrate multiplex CRISPR/Cas-mediated genome editing against CLCuD using transient transformation in N. benthamiana plants and cotton seedlings. The genomic sequences of cotton leaf curl viruses (CLCuVs) were obtained from NCBI and the guide RNA (gRNA) were designed to target three regions in the viral genome using CRISPR MultiTargeter. The gRNAs were cloned in pHSE401/pKSE401 containing Cas9 and confirmed through colony PCR, restriction analysis, and sequencing. Confirmed constructs were moved into Agrobacterium and subsequently used for transformation. Agroinfilteration in N. benthamiana revealed delayed symptoms (3–5 days) with improved resistance against CLCuD. In addition, viral titer was also low (20–40%) in infected plants co-infiltrated with Cas9-gRNA, compared to control plants (infected with virus only). Similar results were obtained in cotton seedlings. The results of transient expression in N. benthamiana and cotton seedlings demonstrate the potential of multiplex CRISPR/Cas to develop resistance against CLCuD. Five transgenic plants developed from three experiments showed resistance (60−70%) to CLCuV, out of which two were selected best during evaluation and screening. The technology will help breeding CLCuD-resistant cotton varieties for sustainable cotton production.

The COBL genes encode a plant-specific glycosylphosphatidylinositol (GPI)-anchored protein. Recently identified COBRA genes are supposed as a key regulator of the orientation of cell expansion in the root indicating that COBRA gene family members are likely to be important players at the plasma membrane-cell wall interface. Five COBL gene namely, TaCOBL 1, TaCOBL 2, TaCOBL 3, TaCOBL 4 and TaCOBL 5 were identified using database search and domain predictions. Chromosomal location of each gene was mapped on karyotype. Structure of genes, promoter analysis and phylogenetic analysis were performed using different bioinformatics tools. Set of novel SNPs were also predicted. Gene ontologies were analyzed, and the processes and pathways were identified in which COBRA genes were involved. The molecular weight all the cobra proteins was in range of 50–75 KDa with 429–461 amino acid residues. The COBL genes were mapped on homeologous groups 2, 4, 5, 6 and 7. Gene ontology analysis revealed that TaCOBL genes were involved in cellulose microfibril organization, mucilage biosynthetic process involved in seed coat development, plant-type cell wall biogenesis plant-type cell wall cellulose biosynthetic process, seed coat development and seed development. Three drought responsive cis-elements (WRKY, ABRE and DRE) were found nearby COBL genes The qRT-PCR revealed TaCOBL genes are drought responsive and can be further explored to understand their role in drought tolerance in wheat. The comprehensive annotation and expression profiling of COBL genes revealed that all five COBL genes are drought response. The promoter cis-regulatory element analysis revealed that COBL genes had stress related WRKY, ABRE and DRE cis-regulatory elements. This evidence suggest that TaCOBL genes are involved in drought stress tolerance.

Cotton is considered as a major cash crop of the world. It earns huge foreign exchange by its valuable products; fiber, lint, cotton seed oil, hull and a lot more. Being an important fiber crop, it earns huge foreign exchange by contributing to textile and seed oil industry. This review summarizes cotton biology, its diversity and domestication, genome assembly, constraints in its production and methods to improve cotton plant to fulfill the need of textile and oil industry. But cotton is facing enormous biotic and abiotic stresses with insect pests being most prominent. Massive destruction caused by insects needs to be controlled for maintaining fruitful cotton crop production. Conventional breeding approaches are limited to improving single trait and integrate stable genes within plant genome in approximately 7 - 8 years. Improved biotechnological procedures have paved new pathways to target genes specifically and improve cotton germplasm in lesser time than conventional breeding.

Genetic diversity is the base of any genetic improvement breeding program aimed at stress breeding. The variability among breeding materials is of primary importance in the achievements of a good crop production. Herein, 105 wheat genotypes were screened against drought stress using factorial completely randomized design at seedling stage to determine the genetic diversity and traits association conferring drought tolerance. Analysis of variances revealed that all the studied parameters differed significantly among all genotypes, indicating the significance genetic variability existed among all genotypes for studied indices. The 10 best performance genotypes G1, G6, G11, G16, G21, G26, G39, G44, G51, and G61 were screened as drought tolerant, while five lowest performance genotypes G3, G77, G91, G98, and G105 were screened as drought susceptible. Root length, chlorophyll a, chlorophyll b, and carotenoid contents were significantly correlated among themselves which exhibited the importance of these indices for rainfed areas in future wheat breeding scheme. Shoot length exhibited non-significant and negative association with other studied traits, and its selection seems not to be a promising criteria for this germplasm for drought stress. Best performance genotypes under drought stress conditions will be useful in future wheat breeding program and early selection will be effective for developing high yielding and drought tolerant wheat varieties.

Precise assessment of diversity in available breeding germplasm helps to preempt epidemics and abrupt environmental changes. Spring wheat germplasm consisting of 84 accessions including cultivars, breeding lines and landraces from various origins was scanned with 44 SSRs. For allele frequencies, allelic patterns, heterozygosity and polymorphism the selected population was divided in three subpopulations: (i) pre-green revolution (pre-1965), (ii) post-green revolution (post-1965), (iii) post-veery (post-2000). Alleles produced in pre-1965, post-1965 and post-2000 subpopulations were 115, 144 and 131, respectively. Mean PIC values for pre-1965, post-1965 and post-2000 subpopulations were 0.48, 0.52 and 051, respectively. Allelic patterns showed no locally common alleles in any of the subpopulation. The pre-1965 subpopulation had also no private allele, however, average number of private alleles decreased from post-1965 to post-2000 subpopulation. In case of effective alleles and Shannon’s information index trend was increasing from pre-1965 to post-1965 and then decreasing from post-1965 to post-2000. The decreasing trend alarms the reduced genetic diversity in wheat varieties developed after 2000. PCA and cluster analysis didn’t clearly differentiated subpopulations, though pre-1965 genotypes showed higher genetic distance from post-1965 and post-2000 subpopulations. The decreasing measures of genetic diversity in post-2000 wheat genotypes should be a concern for wheat breeders, therefore, all sources of broadening genetic diversity should be exploited.

Whitefly-transmitted geminiviruses (begomoviruses) cause heavy losses to many food and fiber crops in Pakistan. Many weeds also show symptoms typical of begomoviruses. Ageratum (Ageratum conyzoides) is a common perennial weed in Pakistan, growing along irrigation canals, that often shows symptoms, such as yellow vein and mosaic, suggesting infection by a begomovirus. To confirm this, symptomatic and asymptomatic ageratum plants were collected from three locations in the Punjab Province of Pakistan, and total DNA was isolated, subjected to agarose gel electrophoresis, transferred to a nylon membrane, and Southern blotted. Total DNA isolated from cotton infected with Cotton leaf curl virus (CLCuV), tomato infected with Tomato leaf curl virus from Pakistan (TLCV-Pak), tobacco infected with African cassava mosaic virus (ACMV) from Nigeria, and healthy tobacco were included as controls. A full-length clone of CLCuV DNA A was labeled with [32P]dCTP by oligo-labeling and hybridized at medium stringency. The probe detected characteristic geminivirus DNA forms in symptomatic ageratum and plants infected with CLCuV, TLCV-Pak, and ACMV, while no signal was detected in asymptomatic ageratum from the field or healthy tobacco. To confirm infection by a begomovirus, degenerate primers WTGF (5′-GATTGTACGCGTCCDCCTTTAATTT GAAYBGG-3′), designed in the rep gene of begomoviruses, and WTGR (5′-TANACGCGTGGC TTCKRTACATGGCCTDT-3′), designed in the coat protein gene of DNA A of begomoviruses, were used in polymerase chain reaction (PCR). Degenerate primers (PBLv2040 and PCRc1) also were used in PCR (2). A product of expected size (≈1.4 kb) was obtained with DNA A primers from symptomatic ageratum, while no product was obtained with DNA B primers in the same sample. Previously we were unable to detect a DNA component equivalent to begomovirus DNA B in cotton showing symptoms of cotton leaf curl disease (1). We recently reported a novel circular DNA molecule that was approximately half as long as the full-length DNA A (CLCuV DNA-1) associated with CLCuV that share homology to plant nanoviruses (1). The supercoiled replicative form of viral DNA isolated from infected ageratum plants indicated the presence of smaller molecules, as was found in cotton leaf curl disease, suggesting that a nanovirus-like molecule might be associated with ageratum yellow vein disease. A duplicate blot of samples used in Southern hybridization with the DNA A probe was prepared, and a probe of the full-length clone of the nanovirus-like molecule (CLCuV DNA-1) was prepared as described for DNA A. The probe detected characteristic nanovirus DNA forms in ageratum with yellow vein symptoms and cotton infected with CLCuV, while no signal was detected in plants infected with TLCV-Pak or ACMV, healthy tobacco, or asymptomatic ageratum. Abutting primers PB2-F and PB2R (1), designed based on the CLCuV DNA-1 sequence, were unable to amplify a PCR product from ageratum with yellow vein symptoms, suggesting the nanovirus-like molecule associated with ageratum yellow vein disease is distinct from CLCuV DNA-1. Our results show that yellow vein disease of ageratum in Pakistan is associated with a begomovirus infection and single-stranded circular DNA molecule with similarity to CLCuV DNA-1. References: (1) S. Mansoor et al. Virology 259:190, 1999. (2) M. R. Rojas et al., Plant Dis. 77:340, 1993.

Whitefly-transmitted geminiviruses (begomoviruses) have emerged as major constraints on food and fiber crops worldwide, and there are several examples of begomovirus mobilization in previously unknown host plants. Here we report on evidence that leaf curl disease of watermelon in Pakistan is caused by Tomato leaf curl virus-India (TLCV-India). Leaf curl disease of watermelon, characterized by leaf curling and mottling and stunted plant growth, was observed at several locations in the Punjab Province of Pakistan. Symptomatic and asymptomatic leaf samples were collected from three locations, and total DNA was isolated by the cetyltrimethylammoniumbromide method and resolved in agarose gel. A full-length clone of Cotton leaf curl virus DNA A was labeled with [32P]dCTP and used as a general probe in Southern hybridization. The probe detected characteristic geminivirus DNA forms in infected watermelon plants, whereas no signal was detected in asymptomatic plants. The association of a begomovirus was confirmed further by polymerase chain reaction (PCR) amplification with degenerate primers PAL1V and pAR1c (2). Samples were screened for infection by TLCV-India, because of symptom similarity. A full-length clone of DNA B of TLCV-India (1) was labeled with [32P]dCTP by random priming and was used as a specific probe in Southern hybridization. The probe detected geminivirus DNA forms, showing that the disease is associated with TLCV-India. Primers TLCV1 (GAGGTACCAAAACTTGTCGTTTTGATTCGG), in the virion-sense, and TLCV2 (GCCCATGGTTCTTTGCTCGGAGAACAAGAA), in the complementary-sense, were designed based on the sequence of DNA A of TLCV-India. These primers were used in PCR and amplified a product of the expected size from infected plants. Similarly, primers TLCVBC1 (GCGGATCCTTATTCCGTAATTATATCTGCA), in the virion-sense, and TLCV BC2 (CACCATGGCAATAGGAAATGATGGTATGGG), in the complementary-sense, were designed based on the sequence of DNA B of TLCV-India (1). These primers amplified a product of expected size when used in PCR. The results show that watermelon leaf curl disease in Pakistan is associated with TLCV-India. This the first report of detection of a begomovirus in watermelon in Pakistan and the first report of detection of TLCV-India on a plant other than tomato from Southeast Asia. References: (1) M. Padidam et al. J. Gen. Virol. 76:25, 1995. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Engineered nucleases have emerged as a powerful tool for site specific gene manipulation in plants. Based on Clustered Regularly Interspersed Short Palindromic Repeats/CRISPR associated (CRISPR/Cas) system, engineered Cas9:gRNA complex can be used to cleave specific DNA sequences in the genome. In the present study, Nicotiana benthamiana Phytoene Desaturase (NbPDS) gene was targeted by CRISPR/Cas9 system. The plant codon optimized (pcoCas9) along with guided RNA (gRNA) was cloned in plant expression vector pGreen0029, to target NbPDS gene. The NbPDS gene was disrupted transiently by agroinfiltration of pcoCas9-gRNA complex. Visible albino spots were observed on agro-infiltrated leaves of N. benthamiana plants after 7 days of infiltration. The observed albino spots were analyzed through PCR amplification of gRNAtarget, fluorescent microscopy and chlorophyll contents measurements. Our results support the notion that CRISPR/Cas9 system is a swift, robust and useful tool for targeted gene disruption, deletion and editing. © 2016 Friends Science Publishers

Genome editing with engineered nucleases has become a powerful tool of targeted genome modifications providing unprecedented control over animal and plant genetic material for precise, robust and highly specific genome engineering. Precise genome editing has been a long standing goal in the field of biology which has been achieved with the help of engineered nucleases like zinc finger nucleases, transcription activator-like effector nucleases (TALENs), and the Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated system. These engineered nucleases consist of a binding and a nuclease domain which are generally used in the form of a pair. The binding domain binds specifically to a DNA sequence whilst the nuclease domain creates double-strand breaks (DSBs) which are further used for non-homologous end joining or homologous recombination repair. Creation of DSBs is the principle of this technology which can be further used for gene addition, deletion and modification in the targeted DNA. Besides nuclease activity, TALE (transcription activator-like effector) proteins have also been used along with other effector domains for different purposes like gene activation, gene repression, epigenetic modifications, etc. The use of TALEs and TALENs for precise genome modifications of plants is now a common practice. So far, tens of crop plants have been modified using engineered nucleases like rice, wheat, tomato, potato, tobacco, maize, barley, cotton, etc. The TALE and TALEN technology is being used for development of biotic and abiotic stress-resistant plants as well as yield and quality improvement. In this article, we will briefly review and discuss TALEs and TALENs, their discovery, binding specificity, designing, functional domains, delivery and use for genome editing specifically in plants.

The present study was designed considering the importance of grain quality traits, genetic diversity and marker-trait association analysis in wheat. A significant amount of genetic diversity was found for various seed traits though the genotypes included in the study were found structured. The extent of polymorphism was high with a range of 2–13 alleles and average of 6.5 alleles per locus. Population structure was detected with 30 unlinked SSRs that divided the population of 92 genotypes in three sub-populations. Extensive LD extent was found on chromosome 1B with 42 SSRs specific for 1B chromosome. Marker-trait associations were determined using mixed linear model, where population structure and kinship calculated on the basis of unlinked markers were covariated with 1B specific markers and traits data. Eight QTLs for five traits including protein, gluten contents, test weight bread and chapati making quality. Protein content, test weight, bread quality and Glu-B1 were found significantly associated with primers WMC419 (32 cM); WMC128 (30 cM), WMC419 (32 cM); WMC818 (17 cM) and WMC416 (44 cM), respectively.

Whitefly (Bemisia tabaci)-transmitted Geminiviruses cause serious diseases of crop plants in tropical and sub-tropical regions. Plants, animals, and their microbial symbionts have evolved complex ways to interact with each other that impact their life cycles. Blocking virus transmission by altering the biology of vector species, such as the whitefly, can be a potential approach to manage these devastating diseases. Virus transmission by insect vectors to plant hosts often involves bacterial endosymbionts. Molecular chaperonins of bacterial endosymbionts bind with virus particles and have a key role in the transmission of Geminiviruses. Hence, devising new approaches to obstruct virus transmission by manipulating bacterial endosymbionts before infection opens new avenues for viral disease control. The exploitation of bacterial endosymbiont within the insect vector would disrupt interactions among viruses, insects, and their bacterial endosymbionts. The study of this cooperating web could potentially decrease virus transmission and possibly represent an effective solution to control viral diseases in crop plants.

The international recognition of the importance of genetic diversity demands continuous estimation of genetic diversity of in hand population as test of its buffering capacity against all putative threats. Randomly selected Pakistani wheat varieties developed during 1965-1999 and 2000-2011 were evaluated on the basis of pedigree and SSR data. At 2nd and 3rd levels of pedigree, average occurrence of a parent per variety was 2.1 times. The dominating parents included BLUEBIRD, KALYANSONA and SIETE-CERROS-66, which were present in the pedigrees of 71.42%, 64.28%, and 58.57% varieties, respectively. The varieties INQLAB-91 and KIRAN-95 had the same pedigree and were genetically identical as revealed by SSR data. Similarly, varieties PAVON-76 and SOGHAT-90 also had the same parents in their pedigrees. This genetic similarity was also confirmed by SSR based cluster. The SSR based PC1 and PC2 showed narrow genetic diversity confirming the presence of few dominating parents. The results emphasize the inclusion of novel and genetically diverse parents in Pakistani wheat breeding programs to maintain broader genetic base of varieties/cultivars for buffering the effects of ever changing virulent pathogens and crop growth environments.

Background The Flo2 gene is a member of a conserved gene family in plants. This gene has been found to be related to thousand grain weight (TGW) in rice. Its orthologs in hexaploid wheat were cloned, and the haplotype variation in TaFlo2-A1 was tested for association with TGW. Results The cloned sequences of TaFlo2-A1, TaFlo2-B1 and TaFlo2-D1 contained 23, 23 and 24 exons, respectively. The deduced proteins of TaFlo2-A1 (1734 aa), TaFlo2-B1 (1698 aa) and TaFlo2-D1 (1682 aa) were highly similar (>94%) and exhibited >77% similarity with the rice FLO2 protein. Like the rice FLO2 protein, four tetratricopeptide repeat (TPR) motifs were observed in the deduced TaFLO2 protein. An 8-bp InDel (−10 to −17 bp) in the promoter region and five SNPs in first intron of TaFlo2-A1 together formed two haplotypes, TaFlo2-A1a and TaFlo2-A1b, in bread wheat. TaFlo2 was located on homeologous group 2 chromosomes. TaFlo2-A1 was inferred to be located on deletion bin ‘2AL1–0.85-1.00’. The TaFlo2-A1 haplotypes were characterized in the Chinese Micro Core Collection (MCC) and Pakistani wheat collection using the molecular marker TaFlo2-Indel8. TaFlo2-A1 was found to be associated with TGW but not with grain number per spike (GpS) in both the MCC and Pakistani wheat collections. The frequency of TaFlo2-A1b (positive haplotype) was low in commercial wheat cultivars; thus this haplotype can be selected to improve grain weight without negatively affecting GpS. The expression level of TaFlo2-A1 in developing grains at 5 DAF (days after flowering) was positively correlated with TGW in cultivars carrying the positive haplotype. Conclusion This study will likely lead to additional investigations to understand the regulatory mechanism of the Flo2 gene in hexaploid wheat. Furthermore, the newly developed molecular marker ‘TaFlo2-InDel8’ could be incorporated into the kit of wheat breeders for use in marker-assisted selection. Electronic supplementary material The online version of this article (10.1186/s12870-017-1114-3) contains supplementary material, which is available to authorized users.

A panel of 94 diverse hexaploid wheat accessions was used to map quantitative trait loci (QTL) underlying the yield related traits on chromosome 3A. Population structure and kinships were estimated using unlinked SSR markers from all 21 chromosomes. Analysis of variance revealed significant difference among accessions; however, genotype × year interaction was non-significant for majority of yield related traits. A mixed linear model (MLM) approach identified six QTLs for four traits that individually accounted for 10.7 to 17.3% phenotypic variability. All QTLs were consistently observed for both study years. New putative QTLs for the maximum fertile florets per spike and spike length were identified. This report on QTLs for yield related traits on chromosome 3A will extend the existing knowledge and may prove useful in marker-assisted selection (MAS) for development of high yielding cultivars.

Diminishing water resources as a result of excessive use of water for irrigation and climate change posture a severe global threat to food security. Herein, an experiment was conducted to determine the selection criteria for drought-tolerant bread wheat genotypes at the seedling stage using morphological and photosynthetic pigmentation-related traits. A panel of 105 wheat landraces, historical Pakistani varieties, and advance breeding lines were evaluated under normal and drought stress using factorial completely randomized design. The root length, fresh weight, dry weight, cell membrane thermo-stability, and chlorophyll b were positively correlated among themselves under both normal and stress conditions. Hence, selection of any one of these traits enhances the performance of other traits. The shoot length was non-significant and negatively associated with all other studied characters except relative water content. The results suggested that selection for shoot length could not improve genetic gain for drought tolerance. Out of 10 principal components (PCs), the first three PCs were showed significant genetic variation under both conditions. The first three PCs showed 74.6% and 76% cumulative genetic variation under normal and drought conditions, respectively. Based on PCA, 10 drought-tolerant and five drought-susceptible genotypes were identified. Overall results suggested that selection for root length, fresh weight, dry weight, cell membrane thermo-stability, and chlorophyll b at the seedling stage would improve genetic gain for drought tolerance. The outperforming genotypes under drought stress conditions can be useful in future wheat breeding programs, and early selection for the traits recommended in this study will be effective for developing high-yielding and drought-tolerant wheat varieties.

The past few decades have witnessed hundreds of family-based linkage studies mapping for numerous traits but only a limited number of QTLs were actually cloned, tagged, or used for marker-assisted selection. Although providing valuable information, this conventional approach cannot be scaled up to underpin the incredible amount of phenotypic variation in the form of 266, 589 hexaploid wheat accessions maintained in public germplasm collections. Association mapping has recently emerged as an alternative and more powerful mapping approach where a natural population is surveyed to determine marker-trait associations using linkage disequilibrium (LD). After its first application for milling quality in 2006, association mapping studies in hexaploid wheat are being extended to tag yield traits, protein quality, and tolerance to biotic and abiotic stresses. Advances in genotyping technology and statistical approaches greatly accelerated the shift from conventional linkage-based mapping to LD-based association mapping. Association mapping stands out because of simultaneous utilization of a large number of ex situ-conserved natural variation due to historical recombination events accumulated over centuries.

The economic value of wheat grain is determined by morphology, texture and size of grain. Very little knowledge is available about the genetic inheritance pattern of the physical characteristics of wheat grain. The mechanical properties of wheat kernel have direct or indirect link on the milling and baking quality of wheat. Six bread wheat genotypes/lines were crossed in all possible combinations in order to assess the genetic inheritance pattern and combining ability of the grain’s physical properties. Additive type of gene action was involved in number of spikelets per spike, spike length, number of grains per spike, grain weight and grain area. Therefore, selection of superior plants can be done in early generations for development of better wheat genotypes. Grain yield per spike, grain width, grain length, grain height and grain sphericity having nonadditive type of gene actions clearly indicated that selection of superior plants should be postponed to later generations. The genotype 9481 was the best general combiner, while among the crosses 1 × 3 and 4 × 6 exhibited the highest positive specific combining ability in most of the prominent traits. This study will be useful for wheat breeders to develop high yielding genotypes with better grain architecture to improve the milling and baking quality of bread wheat.

Five wheat populations were investigated for two years to explore the pattern of trait associations and their contribution to grain yield. The correlation pattern between two traits and their association with grain yield was similar in CIMMYT and Pakistani germplasm. Indian germplasm had different pattern of trait association from those of CIMMYT and Pakistani germplasm. The number of kernels per plant, number of spikes per plant, spike length and spike dry weight were the major yield contributing traits in CIMMYT, Pakistani and ICARDA genotypes. In Indian and miscellaneous genotypes, the number of kernels per plant and number of spikes per plant were the only traits with a positive effect on grain yield. Furthermore, three traits, the number of kernels per plant, the number of spikes per plant and the spike dry weight appeared to have positive effect on grain yield and other major yield traits. Spike density had a negative effect on grain yield in CIMMYT germplasm in dry season. Chlorophyll contents showed no correlation with grain yield in all populations.Key words: Pakistani, CIMMYT, genotypes, wheat, ICARDA, populations.

Recent reports have suggested that cotton leaf curl virus (CLCuV), a geminivirus of the genus Begomovirus, may be responsible for cotton leaf curl disease in Pakistan. However, the causal agent of the disease remains unclear as CLCuV genomic components resembling begomovirus DNA A are unable to induce typical disease symptoms when reintroduced into plants. All attempts to isolate a genomic component equivalent to begomovirus DNA B have been unsuccessful. Here, we describe the isolation and characterisation of a novel circular single-stranded (ss) DNA associated with naturally infected cotton plants. In addition to a component resembling DNA A, purified geminate particles contain a smaller unrelated ssDNA that we refer to as DNA 1. DNA 1 was cloned from double-stranded replicative form of the viral DNA isolated from infected cotton plants. Blot hybridisation using probes specific for either CLCuV DNA or DNA 1 was used to demonstrate that both DNAs co-infect naturally infected cotton plants from different geographical locations. DNA 1 was detected in viruliferous Bemisia tabaci and in tobacco plants infected under laboratory conditions using B. tabaci, indicating that it is transmitted by whiteflies. Sequence analysis showed that DNA 1 is approximately half the size of CLCuV DNA but shares no homology, indicating that it is not a defective geminivirus component. DNA 1 has some homology to a genomic component of members of Nanoviridae, a family of DNA viruses that are normally transmitted by aphids or planthoppers. DNA 1 encodes a homologue of the nanovirus replication-associated protein (Rep) and has the capacity to autonomously replicate in tobacco. The data suggest that a nanovirus-like DNA has become whitefly-transmissible as a result of its association with a geminivirus and that cotton leaf curl disease may result from a mutually dependent relationship that has developed between members of two distinct DNA virus families that share a similar replication strategy.

Tomato leaf curl disease is the most important constraint on tomato production in Pakistan, where it is found throughout the country. The disease, which occurs in high incidence in Punjab and Sindh provinces, causes 30 to 40% yield losses in the spring crop and uneconomically high losses when grown as an autumn crop. The symptoms of the disease include upward or downward leaf curling, vein thickening, and stunting of the plant. The disease is transmitted by Bemisia tabaci whiteflies (non-B, biotype K) and is suspected to be caused by a geminivirus. For the detection of geminivirus, total DNA was extracted from infected plants, fractionated in an agarose gel, transferred to a nylon membrane, and Southern blotted. A full-length clone of DNA-A of cotton leaf curl virus from Pakistan (S. Mansoor, I. Bedford, M. S. Pinner, A. Bashir, R. Briddon, J. Stanley, Y. Zafar, K. A. Malik, and P. G. Markham, unpublished) was labeled with [32P]dCTP by the oligo-labeling method and hybridized at medium stringency. Geminivirus DNA forms that are normally found in infected plants were detected in plants with tomato leaf curl disease but not in healthy plants. To further confirm the presence of a whiteflytransmitted geminivirus, universal primers for dicot-infecting geminiviruses (1) were used in polymerase chain reaction (PCR) and a product of expected size (approximately 2.7 kb) was detected. The 2.7-kb PCR-amplified DNA from diseased tomato plants was labeled with [32P]dCTP and used as probe in Southern hybridization. This probe also detected geminivirus DNA forms at medium stringency. Both monopartite and bipartite geminiviruses transmitted by whiteflies have been reported to cause leaf curl symptoms on tomato from the Eastern hemisphere. Degenerate primers (PBLv2040 and PCRc1), which amplify B component DNA, were used to determine if tomato leaf curl was monopartite or bipartite (2). A product of expected size (0.65 kb) was amplified, suggesting this virus to be bipartite. DNA-B PCR product obtained from diseased tomato plants was hybridized as described above and detected geminivirus DNA forms at medium stringency. Samples of diseased tomato plants were collected from tomato fields throughout Punjab. DNA-A was detected in all 20 samples whereas DNA B was detected in 17 samples when hybridized by dot blot method at medium stringency. Our data show that tomato leaf curl virus from Pakistan is a bipartite geminivirus. This is the first evidence for a bipartite geminivirus in tomato plants from Pakistan. References: (1) R. W. Briddon and P. G. Markham. Mol. Biotechnol. 1:202, 1993. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.

The photosynthetic proteins RuBiSCO, ferredoxin I and ferredoxin NADP+-oxidoreductase (pFNR) were efficiently imported into isolated pea chloroplasts but not into pea root plastids. By contrast non-photosynthetic ferredoxin III and heterotrophic FNR (hFNR) were efficiently imported into both isolated chloroplasts and root plastids. Chimeric ferredoxin I/III (transit peptide of ferredoxin I attached to the mature region of ferredoxin III) only imported into chloroplasts. Ferredoxin III/I (transit peptide of ferredoxin III attached to the mature region of ferredoxin I) imported into both chloroplasts and root plastids. This suggests that import depends on specific interactions between the transit peptide and the translocon apparatus.

A comprehensive study was conducted to investigate (i) the effect of drought stress on genetic association among various yield traits and (ii) molecular and phenotypic diversity in the selected spring wheat accessions. A panel of 24 spring wheat accessions was evaluated under normal irrigation and drought stress. Data were collected for chlorophyll contents, canopy temperature, days to heading, grain filling period, relative water content, plant height, peduncle length, number of kernels per spike, 1000-kernel weight and grain yield. Analysis of variance depicted significant differences for genotypes (G), effect of treatment (T) and interaction between T and G. Correlation analysis revealed that genetic association among various traits was stronger in normal treatment than water stressed. The Biplot analysis grouped the genotypes into tolerant and susceptible groups. Molecular characterization of tolerant and susceptible genotypes was done with 14 ISSR markers. ISSR primers revealed a mean of 0.63 genetic similarities among genotypes. Polymorphism information content (PIC) values varied from 0.24 to 0.49. The genetic diversity in selected germplasm can be used to develop drought tolerant lines considering the changing pattern of traits association under drought stress.