Search

The t(1;19) chromosomal translocation of pediatric pre-B cell leukemia produces chimeric oncoprotein E2a-Pbx1, which contains the N-terminal transactivation domain of the basic helix-loop-helix (bHLH) transcription factor, E2a, joined to the majority of the homeodomain protein, Pbx1. There are three Pbx family members, which bind DNA as heterodimers with both broadly expressed Meis/Prep1 homeo-domain proteins and specifically expressed Hox homeodomain proteins. These Pbx heterodimers can augment the function of transcriptional activators bound to adjacent elements. In heterodimers, a conserved tryptophan motif in Hox proteins binds a pocket on the surface of the Pbx homeodomain, while Meis/Prep1 proteins bind an N-terminal Pbx domain, raising the possibility that the tryptophan-interaction pocket of the Pbx component of a Pbx-Meis/Prep1 complex is still available to bind trypto-phan motifs of other transcription factors bound to flanking elements. Here, we report that Pbx-Meis1/Prep1 binds DNA cooperatively with heterodimers of E2a and MyoD, myogenin, Mrf-4 or Myf-5. As with Hox proteins, a highly conserved tryptophan motif N-terminal to the DNA-binding domains of each myogenic bHLH family protein is required for cooperative DNA binding with Pbx-Meis1/Prep1. In vivo, MyoD requires this tryptophan motif to evoke chromatin remodeling in the Myogenin promoter and to activate Myogenin transcription. Pbx-Meis/Prep1 complexes, therefore, have the potential to cooperate with the myogenic bHLH proteins in regulating gene transcription.

Most normal human diploid cells have no detectable telomerase; however, expression of the catalytic subunit of telomerase is sufficient to induce telomerase activity and, in many cases, will bypass normal senescence. We and others have previously demonstrated in vitro assembly of active telomerase by combining the purified RNA component with the reverse transcriptase catalytic component synthesized in rabbit reticulocyte extract. Here we show that assembly of active telomerase from in vitro-synthesized components requires the contribution of proteins present in reticulocyte extracts. We have identified the molecular chaperones p23 and Hsp90 as proteins that bind to the catalytic subunit of telomerase. Blockade of this interaction inhibits assembly of active telomerase in vitro. Also, a significant fraction of active telomerase from cell extracts is associated with p23 and Hsp90. Consistent with in vitro results, inhibition of Hsp90 function in cells blocks assembly of active telomerase. To our knowledge, p23 and Hsp90 are the first telomerase-associated proteins demonstrated to contribute to telomerase activity.

We have developed a panel of monoclonal antibodies against rat myogenin, a skeletal muscle regulatory protein of the bHLH family. Some of these monoclonals have been widely used by others, and details of their production are presented. Mapping the epitopes by immunoprecipitation of myogenin deletion mutants demonstrates that this panel recognizes epitopes spanning the entire molecule outside the HLH region. Four antibodies against epitopes outside the bHLH region interfere with the binding of myogenin/E-protein heterodimers to DNA sequences containing the myogenin heterodimer consensus recognition site. Three of these epitopes are partially masked in the heterodimers; antibody binding to these epitopes reduces the interactions between myogenin and E12. This suggests that surfaces outside the HLH dimerization domain may contribute to the stability of myogenin/E12 complexes. The binding of one antibody to its epitope did not appear to affect the myogenin/E12 interaction but nonetheless interfered with the binding of the complex to DNA, suggesting that this epitope lies near to a surface occupied by DNA.

Nucleic acids not only code for proteins, but also play a role in a multitude of biological processes, where they act as structural supports, binding sites, co-factors, or catalysts. Recently, an array of techniques has been developed in which molecules that are best fit to perform a given task are selected from a pool of randomized RNA or DNA molecules. These techniques can provide information about the structure/function relationship governing the various biochemical properties of RNA and DNA, including their interaction with proteins. Immediate applications are found not only in the field of transcriptional regulation, but also in the field of RNA-based catalysis.

Tumor-specific activation of the TAL1 gene is the most common genetic alteration seen in patients with T-cell acute lymphoblastic leukemia. The TAL1 gene products contain the basic helix-loop-helix (bHLH) domain, a protein dimerization and DNA-binding motif common to several known transcription factors. A binding-site selection procedure has now been used to evaluate the DNA recognition properties of TAL1. These studies demonstrate that TAL1 polypeptides do not have intrinsic DNA-binding activity, presumably because of their inability to form bHLH homodimers. However, TAL1 readily interacts with any of the known class A bHLH proteins (E12, E47, E2-2, and HEB) to form heterodimers that bind DNA in a sequence-specific manner. The TAL1 heterodimers preferentially recognize a subset of E-box elements (CANNTG) that can be represented by the consensus sequence AACAGATGGT. This consensus is composed of half-sites for recognition by the participating class A bHLH polypeptide (AACAG) and the TAL1 polypeptide (ATGGT). TAL1 heterodimers with DNA-binding activity are readily detected in nuclear extracts of Jurkat, a leukemic cell line derived from a patient with T-cell acute lymphoblastic leukemia. Hence, TAL1 is likely to bind and regulate the transcription of a unique subset of subordinate target genes, some of which may mediate the malignant function of TAL1 during T-cell leukemogenesis.

The protein product of the normal p53 gene binds to the DNA p53CON element (GGACATGCCCGGGCATGTCC, Funk et al., 1992), thereby activating transcription from adjacent promoters. Two mutants, 248 (Arg-->Trp) and 281 (Asp-->Gly), failed to bind p53CON and to activate transcription. However, in contrast to previous reports that all p53 mutants fail to bind to the other p53 binding elements, two p53 mutants, 143 (Val-->Ala) and 273 (Arg-->His), retained both p53CON binding and transcriptional activation functions. A third mutant 175 (Arg-->His) bound to the p53CON but did not activate transcription. These data suggest that the DNA binding and transcriptional activation functions of p53 mutants in tumor cells are dependent on the specific missense mutations acquired in the p53 gene and the target sequences of p53 in the genome.

Degenerate oligonucleotides and polymerase chain reaction-based reiterative selection techniques have been used to define the consensus binding sites for an increasing number of transcription factors. The use of crude nuclear extracts rather than purified proteins permits multicomponent complexes to form, and allows the technique to generate information about the combinatorial interactions involved in gene regulation.

Myogenin is one of four muscle-specific basic helix-loop-helix regulatory factors involved in controlling myogenesis. We here describe various protein complexes that increase the affinity of myogenin for DNA. We mixed an oligonucleotide containing a degenerate center large enough to accommodate multiple binding sites with crude myotube nuclear extracts and used cyclic amplification and selection of targets with an antimyogenin monoclonal antibody to isolate protein-DNA complexes. Since each cycle of selection results in the enrichment for the sequences with the highest affinity, we isolated multicomponent sites in which myogenin binding was increased by its interaction with other DNA binding proteins. Myogenin interacts with members of the nuclear factor 1 family, the muscle-specific factor myocyte-specific enhancer-binding factor 2, and another factor, COMP1 (cooperates with myogenic proteins 1), that binds to the sequence TGATTGAC. Myogenin also exhibits cooperative binding with other proteins that recognize CANNTG motifs, and various constraints on spacing and orientation were observed. The application of this approach to other transcription factors should not only help identify the different functions of myogenin versus other members of the muscle basic helix-loop-helix regulatory family but also help define the general combinatorial mechanisms involved in eukaryotic gene regulation.

Recent studies have demonstrated transcriptional activation domains within the tumor suppressor protein p53, while others have described specific DNA-binding sites for p53, implying that the protein may act as a transcriptional regulatory factor. We have used a reiterative selection procedure (CASTing: cyclic amplification and selection of targets) to identify new specific binding sites for p53, using nuclear extracts from normal human fibroblasts as the source of p53 protein. The preferred consensus is the palindrome GGACATGCCCGGGCATGTCC. In vitro-translated p53 binds to this sequence only when mixed with nuclear extracts, suggesting that p53 may bind DNA after posttranslational modification or as a complex with other protein partners. When placed upstream of a reporter construct, this sequence promotes p53-dependent transcription in transient transfection assays.

The retinoblastoma tumor-suppressor gene encodes a 105-kDa nuclear phosphoprotein (RB) that can associate with DRTF-1 and E2F. These two transcription factors can recognize the same DNA motif in the adenovirus E2A promoter and can bind to it by themselves or in association with RB. In the present report, we describe the use of CASTing (cyclic amplification and selection of targets) to determine the consensus binding site of RB-containing complexes. An anti-human RB antibody was used to isolate RB-containing complexes formed after mixing nuclear extracts obtained from human diploid fibroblasts with a pool of random oligonucleotides flanked with polymerase chain reaction (PCR) primers. After the immunoselection, the DNA was isolated, amplified, mixed with fresh nuclear extract and reselected. After six CASTing cycles, the DNA was cloned and sequenced. We found that the highest affinity motifs recognized by RB-containing complexes are related to the E2F/DRTF-1 binding site and fall into three classes: TTTTCCCGCCAAAA, TTTTCCCGCCTTTTTT or TTTTCCCGCGCTTTTTT. Competition experiments revealed that these three classes are functionally equivalent to each other and to the E2F/DRTF-1 binding site in the adenovirus E2A promoter. Screening these sequences against a DNA database identified their presence in non-coding regions of many oncogenes, growth factor genes and in the RB gene itself.

Significant progress has been made in defining the structural motifs that distinguish the muscle-specific from other basic helix-loop-helix proteins. Evidence is accumulating for multiple levels of regulation of the expression and action of the muscle basic helix-loop-helix factors.

The native molecular weight of the basic helix-loop-helix (bHLH) proteins myogenin, MyoD, and E12 was calculated from their mobilities on sucrose gradients and molecular sieve chromatography. The muscle bHLH proteins associate to form a variety of higher order complexes, most of which are larger than dimers. Homodimers bind to DNA sequences such as the MEF-1 site in the creatine kinase enhancer whereas homotetramers and larger forms do not recognize this DNA sequence. The ubiquitous bHLH protein E12 forms monomers or homodimers with little evidence for higher order complexes. Mixtures of myogenin and E12 show some heterodimeric structures, but most of the myogenin remains in large complexes. This result using purified proteins is also obtained in nuclear extracts from differentiated myotubes, in which most of the myogenin is present in large complexes that do not bind to the creatine kinase enhancer. A fusion protein containing only the myogenin HLH region forms large homomeric complexes. A model is presented in which each helix associates with a different subunit to form chains or ring structures to explain these observations. The partition of myogenin in nuclear extracts into dimers that recognize known DNA sequences and higher order complexes that do not raises important new issues concerning the regulation of skeletal muscle bHLH protein activity during myogenesis.

Sucrose gradients and molecular sieve chromatography were used to determine the native molecular weight of the basic HLH proteins myogenin, MyoD and E12. The muscle bHLH proteins not only formed dimers but also associated in a variety of higher order complexes. Although homodimers bind to DNA sequences such as the MEF-1 site in the creatine kinase enhancer, homotetramers and larger forms do not recognize this DNA sequence. Little evidence for complexes larger than dimers was found for the ubiquitous bHLH protein E12. Most of the myogenin remains in large complexes when myogenin and E12 are mixed. The same result was obtained in nuclear extracts from differentiated myotubes, in which most of the myogenin was found to be present in large complexes that do not bind to the creatine kinase enhancer. A fusion protein that contains only the myogenin HLH region fused to glutathione-S-transferase also forms large homomeric complexes. A model to explain these results is that each helix of the HLH motif can associate with a different subunit to form chains or ring structures. The presence of myogenin in nuclear extracts as both dimers that recognize known DNA sequences as well as higher order complexes that do not raises significant issues concerning the regulation of skeletal muscle bHLH protein activity during myogenesis.

In this report we provide four lines of evidence indicating that E12/E47-like proteins interact in vivo with the myogenic HLH proteins MyoD and myogenin. First, cotransfection of MyoD and E47 in COS cells indicates that these factors synergistically enhance transcription of a reporter gene containing an oligomerized MyoD-binding site. Second, mobility-shift assays of muscle cell nuclear extracts, "double shifted" with specific antisera, have identified complexes binding to the MEF1 site that contain either MyoD or myogenin in association with E12/E47-like proteins. Third, association with E47 alters the phosphorylation state of MyoD. Fourth, C3H10T1/2 cells expressing antisense E2A transcripts contain low levels of E2A gene products and display less terminal muscle differentiation when infected with retroviral MyoD or when challenged to differentiate with 5-azacytidine treatment. In addition we demonstrate that MyoD, in conjunction with E12/E47-like proteins, is functioning as a regulatory nodal point for activation of several other downstream muscle regulators.

Two recombinant baculoviruses BcV-myf4 and BcV-myf5 have been constructed to synthesize the human myogenic determination factors myogenin (myf4) and myf5 in eucaryotic cells. Both recombinant proteins are localized to the nucleus of virus-infected Spodoroptera frugiperda (sf) insect cells and can be recovered as soluble factors. The virus-produced proteins exhibit high-affinity binding to a muscle-specific DNA sequence in the presence of the ubiquitous helix-loop-helix (HLH) protein E12, but only marginal binding in unsupplemented sf nuclear extracts. Both baculovirus-encoded myogenic factors are able to heterooligomerize with E12 in the absence of DNA-binding sites. We conclude from our results that these muscle-specific HLH proteins produced in eucaryotic cells largely depend on dimerization with E12 or similar HLH proteins to recognize the myosin-light-chain-enhancer-MEF-1-binding site. We have no evidence for intracellular protein modifications exerting major effects on the interaction between these factors and DNA.