Search

Tankyrase (TANK1) is a human telomere-associated poly(ADP-ribose) polymerase (PARP) that binds the telomere-binding protein TRF1 and increases telomere length when overexpressed. Here we report characterization of a second human tankyrase, tankyrase 2 (TANK2), which can also interact with TRF1 but has properties distinct from those of TANK1. TANK2 is encoded by a 66-kilobase pair gene (TNKS2) containing 28 exons, which express a 6.7-kilobase pair mRNA and a 1166-amino acid protein. The protein shares 85% amino acid identity with TANK1 in the ankyrin repeat, sterile alpha-motif, and PARP catalytic domains but has a unique N-terminal domain, which is conserved in the murine TNKS2 gene. TANK2 interacted with TRF1 in yeast and in vitro and localized predominantly to a perinuclear region, similar to the properties of TANK1. In contrast to TANK1, however, TANK2 caused rapid cell death when highly overexpressed. TANK2-induced death featured loss of mitochondrial membrane potential, but not PARP1 cleavage, suggesting that TANK2 kills cells by necrosis. The cell death was prevented by the PARP inhibitor 3-aminobenzamide. In vivo, TANK2 may differ from TANK1 in its intrinsic or regulated PARP activity or its substrate specificity.

The protein product of the normal p53 gene binds to the DNA p53CON element (GGACATGCCCGGGCATGTCC, Funk et al., 1992), thereby activating transcription from adjacent promoters. Two mutants, 248 (Arg-->Trp) and 281 (Asp-->Gly), failed to bind p53CON and to activate transcription. However, in contrast to previous reports that all p53 mutants fail to bind to the other p53 binding elements, two p53 mutants, 143 (Val-->Ala) and 273 (Arg-->His), retained both p53CON binding and transcriptional activation functions. A third mutant 175 (Arg-->His) bound to the p53CON but did not activate transcription. These data suggest that the DNA binding and transcriptional activation functions of p53 mutants in tumor cells are dependent on the specific missense mutations acquired in the p53 gene and the target sequences of p53 in the genome.

Degenerate oligonucleotides and polymerase chain reaction-based reiterative selection techniques have been used to define the consensus binding sites for an increasing number of transcription factors. The use of crude nuclear extracts rather than purified proteins permits multicomponent complexes to form, and allows the technique to generate information about the combinatorial interactions involved in gene regulation.

Myogenin is one of four muscle-specific basic helix-loop-helix regulatory factors involved in controlling myogenesis. We here describe various protein complexes that increase the affinity of myogenin for DNA. We mixed an oligonucleotide containing a degenerate center large enough to accommodate multiple binding sites with crude myotube nuclear extracts and used cyclic amplification and selection of targets with an antimyogenin monoclonal antibody to isolate protein-DNA complexes. Since each cycle of selection results in the enrichment for the sequences with the highest affinity, we isolated multicomponent sites in which myogenin binding was increased by its interaction with other DNA binding proteins. Myogenin interacts with members of the nuclear factor 1 family, the muscle-specific factor myocyte-specific enhancer-binding factor 2, and another factor, COMP1 (cooperates with myogenic proteins 1), that binds to the sequence TGATTGAC. Myogenin also exhibits cooperative binding with other proteins that recognize CANNTG motifs, and various constraints on spacing and orientation were observed. The application of this approach to other transcription factors should not only help identify the different functions of myogenin versus other members of the muscle basic helix-loop-helix regulatory family but also help define the general combinatorial mechanisms involved in eukaryotic gene regulation.

Recent studies have demonstrated transcriptional activation domains within the tumor suppressor protein p53, while others have described specific DNA-binding sites for p53, implying that the protein may act as a transcriptional regulatory factor. We have used a reiterative selection procedure (CASTing: cyclic amplification and selection of targets) to identify new specific binding sites for p53, using nuclear extracts from normal human fibroblasts as the source of p53 protein. The preferred consensus is the palindrome GGACATGCCCGGGCATGTCC. In vitro-translated p53 binds to this sequence only when mixed with nuclear extracts, suggesting that p53 may bind DNA after posttranslational modification or as a complex with other protein partners. When placed upstream of a reporter construct, this sequence promotes p53-dependent transcription in transient transfection assays.