Search

Layered Ni-rich oxide is a promising cathode material for lithium-ion batteries (LIBs) of high energy density, yet its poor electrochemical stability induced by electrode-electrolyte interfacial degradation has still needed to be addressed. Surface coating is one of the powerful techniques to tackle this issue, nevertheless, it has been extensively used on particle but not electrode regarding a larger area of protection. Herein, we have covered a nano-scaled layer of lithium phosphorus oxynitride (LiPON) on the electrode level of LiNi0.8Co0.1Mn0.1O2 (NCM) surface and found lower impedance, longer cycle life, and better safety for treated battery. Most notably, such an NCM-LiPON based 1.3 Ah pouch cell delivers an energy density of 364.4 Wh kg−1 (based on positive and negative materials), along with the retention of 80.0% over 745 cycles at 0.5 C-rate, which is 1.3 times longer than the bare one. This results from modification of both superficial cathode-electrolyte interphase (CEI) and structure stabilization of general particle surface, therefore, role of conformal coating upon electrode surface should be highlighted.

Fungal laccases are industrially important inducible enzymes extensively used in the delignification of lignocellulosics, detoxification of environmental wastes and decolorization of textile dyes. The discovery of new inducers is crucial for laccase productivity by filamentous fungi. In this study, a novel laccase-producing strain S8 from a bambusicolous fungus Shiraia bambusicola was identified by using 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonate) as laccase secretion indicator and native polyacrylamide gel electrophoresis. The corresponding full-length cDNA of laccase was cloned and characterized. The effect of lanthanum (LaCl3) on extracellular laccase activity was tested at the concentration from 0.2 to 2.0 g/L and at different addition time (day 1–4) in the mycelium culture. In the presence of 1.0 g/L La3+ at the beginning of the mycelium cultures, the highest laccase activity (2.7 × 104 U/L) reached after 10 days of cultivation, about tenfold higher compared with non-induced cultures. La3+ was shown to be a very strong inducer for fungal laccase activity with no inhibitory effect on fungal growth at the optimized concentration. In vivo, La3+ added to the mycelium culture not only promoted a continuous and high expression of laccase gene (lcc1), but also induced a rapid generation of signaling molecules including reactive oxygen species (ROS) and nitric oxygen (NO). Both the NO donor sodium nitroprusside (SNP) and exogenous hydrogen peroxide (H2O2) potentiated La3+-induced laccase activity and increased membrane permeability of hyphal cells. Moreover, the scavenger such as 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (cPTIO) for NO and vitamin C for ROS suppressed the induction. These results suggest these signals could mediate La3+-induced laccase biosynthesis and its secretion. Our study provides a basis for understanding the induction mechanism of La3+ on laccase and a practical strategy for enhanced fungal laccase production.

High-contrast mechanochromic (MC) materials are prominent candidates for sensor, security, and memory applications; however, the development of materials with a large luminescence change (Δλem > 10...

A direct strategy toward the synthesis of functionalized abietane-type diterpenes and related polycyclic molecules was developed through an Au-catalyzed 1,3-acyloxy migration/cyclization/electrophi...

Purpose To identify anatomic endpoints altered by intravitreal ranibizumab in central retinal vein occlusion (CRVO) to determine any potential underlying disease modification that occurs with anti-vascular endothelial growth factor (anti-VEGF) therapy beyond best-corrected visual acuity and central optical coherence tomography outcomes. Methods A post hoc analysis of a double-masked, multicenter, randomized clinical trial was performed. A total of 392 patients with macular edema after CRVO were randomized 1:1:1 to receive monthly intraocular injections of 0.3 or 0.5 mg of ranibizumab or sham injections. Central reading center-read data were reviewed to explore potential anatomic endpoints altered by therapy. Results At 6 months, there was a reduction in the ranibizumab groups compared with sham groups with respect to total area of retinal hemorrhage (median change from baseline in disc areas: − 1.17 [sham], − 2.37 [ranibizumab 0.3 mg], − 1.64 [ranibizumab 0.5 mg]), development of disc neovascularization (prevalence: 3% [sham], 0% [ranibizumab 0.3 mg], 0% [ranibizumab 0.5 mg]), and presence of papillary swelling (prevalence: 22.9% [sham], 8.0% [ranibizumab 0.3 mg], 8.3% [ranibizumab 0.5 mg], p Conclusions Ranibizumab for CRVO resulted in beneficial disease-modifying effects through a reduction in retinal hemorrhage, neovascularization, and papillary swelling. These findings may form the basis for future work in the development of a treatment response or severity scale for eyes with CRVO.

Mei-Qi Xu,1,2 Yan-Li Hao,1,2 Jing-Ru Wang,1,2 Zhuo-Yue Li,1,2 Hui Li,1 Zhen-Han Feng,1,2 Hui Wang,1,2 Jing-Wen Wang,1,2 Xuan Zhang1,2 1Beijing Key Laboratory of Molecular Pharmaceutics and New Drug Delivery Systems, School of Pharmaceutical Sciences, Peking University, Beijing, 100191, People’s Republic of China; 2Department of Pharmaceutics, School of Pharmaceutical Sciences, Peking University, Beijing, 100191, People’s Republic of ChinaCorrespondence: Xuan ZhangDepartment of Pharmaceutics, School of Pharmaceutical Sciences, Peking University, Xueyuan Road 38, Beijing, 100191, People’s Republic of ChinaTel +86-10-82805765Fax +86-10-8280576Email xuanzhang@bjmu.edu.cnPurpose: Small molecule modified antitumor drug conjugate nanoparticles have the advantages of high drug loading, simple synthesis and preparation, and better biocompatibility. Due to the large demand for exogenous α-linolenic acid (ALA) by tumor cells, we synthesized α-linolenic acid-paclitaxel conjugate (ALA-PTX) and prepared α-linolenic acid-paclitaxel conjugate nanoparticles (ALA-PTX NPs), in order to obtain better tumor cellular uptake and antitumor activity in vitro and in vivo.Methods: We synthesized and characterized ALA-PTX, and then prepared and characterized ALA-PTX NPs. The cellular uptake, uptake pathways, intracellular behavior, in vitro and in vivo antitumor activity of ALA-PTX NPs were evaluated.Results: The size of ALA-PTX NPs was approximately 110.7± 1.7 nm. The drug loading was approximately 90% (w/w) with CrEL-free and organic solvent-free characteristics. The cellular uptake of ALA-PTX NPs was significantly higher than that of PTX injection by MCF-7, MCF-7/ADR and HepG2 cells. In these three cell lines, the cellular uptake of ALA-PTX NPs at 6h was approximately 1.5– 2.6 times higher than that of PTX injection. ALA-PTX NPs were ingested through clathrin-mediated endocytosis, then transferred to lysosomes, and could dissolve in cells to play an antitumor activity. The in vitro and in vivo antitumor activity of ALA-PTX NPs was confirmed in MCF-7/ADR and HepG2 cell models and tumor-bearing nude mouse models.Conclusion: ALA-PTX NPs developed in our study could provide a new method for the preparation of nano-delivery systems suitable for antitumor therapy that could increase tumor cellular uptake and enhance antitumor activity.Keywords: α-linolenic acid, α-linolenic acid-paclitaxel conjugate, α-linolenic acid-paclitaxel conjugate nanoparticles, cellular uptake, antitumor activity

The discovery of molecular markers which associate with livestock economic traits is of great significance for livestock breeding. Selective analysis has found a potential correlation between CDKL5 and growth traits, but there is still a lack of experimental proof. In this study, a 31-bp deletion (g.176595_176626delATGTCACATGTGGTACTGCCATGTGGAATTT) of CDKL5 gene was found by sequencing. The 31-bp indel was then genotyped in 380 individuals of Dezhou donkeys by polyacrylamide gel electrophoresis and there were three genotypes in this population. After the association analysis between growth traits and genotypes, it was found that this 31-bp indel polymorphism was significantly associated with the chest circumference of Dezhou donkeys (p < 0.05), and body length, chest depth and rump width (p < 0.01). In addition, all individuals with DD genotype were better than those with other genotypes in growth traits. This study revealed that a newly identified polymorphic locus in the CDKL5 gene is related to growth traits, which provides a molecular marker for genetic improvement of Dezhou donkey and may lay a solid foundation for the breeding of Dezhou donkey.

The medicinal plant Artemisia annua L. is presently the sole plant source of artemisinin, the key ingredient of first-line antimalarial drug. As the content of artemisinin in the native plant is very low, the growth and artemisinin biosynthesis of A. annua attract extensive attentions. Endophytic microbes, which spend their entire life spans within plant tissue are widespread in healthy A. annua plants. Although endophytes have emerged in recent years as the novel resources for secondary metabolites of antioxidant, antimicrobial and anticancer activities, the roles of endophytes in plant growth and metabolism have not been fully understood. This review presents the current development of researches into endophytes in model medicinal herb A. annua and focuses on the regulatory roles of endophytes. We introduced the isolation, cultivation and identification method for endophytes in A. annua. Distribution, biodiversity and novel bioactive metabolites of the endophytes were presented. Endophytes promoted the growth of A. annua through the enhanced photosynthesis, nutrient acquisition and phytohormones. The defense resistance against microbial pathogens of A. annua was partially involved with endophyte metabolites. The development of glandular secretory trichomes and the oxidative stress induced by endophytes could be key factors for enhanced artemisinin production. Understanding the endophyte-host partnerships has the potential to improve agricultural practices for A. annua growth and artemisinin production. The aim of this review is to shed light on the importance of endophytes in plant growth and the production of medicinally important secondary metabolites.

Background Previous studies reported worsened lipid profiles in patients infected with hepatitis C virus (HCV) during direct-acting antivirals (DAAs) treatment. This study aimed to investigate the effect of sofosbuvir (SOF)-based DAAs on changes in low-density lipoprotein (LDL) in HCV patients. Methods A systematic review of articles published before 31 May 2021 was conducted by searching MEDLINE, Cochrane Library, EMBASE, and CINAHL Plus. Eligible studies were those comparing SOF-based DAAs and non-SOF DAAs for HCV patients and providing numerical data for changes in LDL. Risk of Bias in Non-randomized Studies- of Interventions was used for assessing risk of bias, and meta-analysis was performed for changes in LDL. Results Six studies comprising 1248 patients were included, 848 patients treated with SOF-based DAAs and 400 patients with non-SOF DAAs vs. SOF-based DAAs group had significantly greater increases in LDL from baseline to week 4 than non-SOF DAAs group (P = 0.001). However, changes in LDL from baseline to the end of treatment (P = 0.060), to post-treatment week 12 (P = 0.263), and to post-treatment week 24 (P = 0.319) did not significantly differ between the two groups. Further comparison of SOF/ledipasvir with asunaprevir/daclatasvir revealed a similar trend in changes in LDL. Conclusions For HCV patients, SOF-based DAA regimens were associated with rapid and significant increases in LDL during the initial 4 weeks of treatment, and the changes did not sustain after the end of treatment. Potential mechanism might be related to the phosphoramidate side chain of SOF.

Porous polycaprolactone (PCL)/calcium sulfate hemihydrate (CSH) composite fibers with different compositions were fabricated via electrospinning by using chloroform/dimethyl sulfoxide (volume ratio = 8:2) as the co-solvent. It was found that the incorporation of fine CSH powders greatly improved the morphology of the PCL fibers and generated continuous, bead-free PCL/CSH composite fibers with the pore diameter varying from 0.2 to 1.1 μm when 20% CSH was added. As compared with the PCL fibers, the PCL/CSH composite fibers also exhibited enhanced thermal stability and hydrophilicity. The tensile strength and elastic modulus of the PCL/CSH fibrous membranes first increased and then decreased with the increase of the CSH content, while their ductility exhibited a sustained decrease. Moreover, after immersion in water, the PCL-20%CSH composite fibers presented a much higher tensile strength than the pristine ones probably due to the self-setting of the CSH powders through the porous structure. In addition, the PCL-20%CSH composite fibers displayed a strong ability to form bone-like apatite after immersion in simulated body fluid for 3 days, which suggests their potential applications in bone tissue regeneration as a novel type of substitute.

He-Jiun Jiang,1 Yen-Hsiang Chang,2 Yen-Hao Chen,3 Che-Wei Wu,4 Pei-Wen Wang,5 Pi-Jung Hsiao6 1Division of Endocrinology and Metabolism, Department of Internal Medicine, E-DA DaChang Hospital, Kaohsiung, Taiwan; 2Department of Nuclear Medicine, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung, Taiwan; 3Department of Hematology-Oncology, Kaohsiung Chang-Gung Memorial Hospital, Chang Gung University, Kaohsiung, Taiwan; 4Department of Otolaryngology-Head and Neck Surgery, Kaohsiung Medical University, Kaohsiung, Taiwan; 5Division of Endocrinology and Metabolism, Department of Internal Medicine; Department of Nuclear Medicine; Kaohsiung Chang-Gung Memorial Hospital, Chang Gung University, Kaohsiung, Taiwan; 6Division of Endocrinology and Metabolism, Department of Internal Medicine, E-DA Hospital; Thyroid Center, E-DA Cancer Hospital; College of Medicine, I-Shou University, Kaohsiung, TaiwanCorrespondence: Pi-Jung HsiaoDivision of Endocrinology and Metabolism, Department of Internal Medicine, E-DA Hospital; Thyroid Center, E-DA Cancer Hospital; College of Medicine, I-Shou University, No. 1, Yida Road, Yanchao District, Kaohsiung, 82445, TaiwanTel +886-7-6150011 ext 2325Fax +886-7-5581421Email pjhsiao101@gmail.comBackground: Lenvatinib treatment of 24 mg/day for radioiodine-refractory differentiated thyroid carcinoma (RRDTC) patients was almost intolerable, with high rates of dose reduction, interruption and discontinuation. Balancing treatment safety with disease risks remains challenging, and the appropriate dosage remains unclear in Asia.Patients and Methods: A total of 65 RRDTC patients treated with lenvatinib were retrospectively collected from Oct. 2015 to Jun. 2020 from two medical centers of South Taiwan. The drug tolerability, treatment efficacy and clinical outcomes were analyzed.Results: Different doses of lenvatinib were initiated but ultimately maintained with a median dose of 10 mg/day within the first 3 months. The disease control rate reached 89.2%, including 24.6% partial response and 64.6% stable disease. Disease progression occurred in 10.8% of patients and increased to 40.0% at the end. Eventually, the treatment dose achieved a median progression-free survival (PFS) of 26.1 months (95% CI: 17.1-NA) with overall survival (OS) not reached yet (24.1∼NA). Overall, the 48-month PFS rate was 35.6% (95% CI: 18.5– 68.4) and 48-month OS was 54.3% (95% CI: 41.2– 71.7). The dose was tolerable with a dose reduction rate of 44.6%, dose interruption rate of 40.0% and fewer high-graded adverse events. The drug discontinuation rate was only 3.1%. However, RRDTC patients with bone metastasis or maximal dose exposure to RAI (≥ 600 mCi) may have less efficacy to the low maintenance dose treatment.Conclusion: Assessing treatment intensity, safety and efficacy, low-dose lenvatinib treatment was well tolerated by RRDTC patients and displayed acceptable drug efficacy and outcomes.Keywords: lenvatinib, radioiodine-refractory differentiated thyroid carcinoma, RRDTC, disease control rate, DCR, progression-free survival, PFS, overall survival, OS

G-quadruplexes (G4s) are noncanonical DNA secondary structures formed through the self-association of guanines, and G4s are distributed widely across the genome. G4 participates in multiple biological processes including gene transcription, and G4-targeted ligands serve as potential therapeutic agents for DNA-targeted therapies. However, genome-wide studies of the exact roles of G4s in transcriptional regulation are still lacking. Here, we establish a sensitive G4-CUT&Tag method for genome-wide profiling of native G4s with high resolution and specificity. We find that native G4 signals are cell type–specific and are associated with transcriptional regulatory elements carrying active epigenetic modifications. Drug-induced promoter-proximal RNA polymerase II pausing promotes nearby G4 formation. In contrast, G4 stabilization by G4-targeted ligands globally reduces RNA polymerase II occupancy at gene promoters as well as nascent RNA synthesis. Moreover, ligand-induced G4 stabilization modulates chromatin states and impedes transcription initiation via inhibition of general transcription factors loading to promoters. Together, our study reveals a reciprocal genome-wide regulation between native G4 dynamics and gene transcription, which will deepen our understanding of G4 biology toward therapeutically targeting G4s in human diseases.

To overcome the structural complexity and improve the bioconversion efficiency of Pennisetum purpureum into bioethanol or/and biomethane, the effects of ensiling pretreatment, NaOH pretreatment, and their combination on digestion performance and mass flow were comparatively investigated. The coproduction of bioethanol and biomethane showed that 65.2 g of ethanol and 102.6 g of methane could be obtained from 1 kg of untreated Pennisetum purpureum, and pretreatment had significant impacts on the production; however, there is no significant difference between the results of NaOH pretreatment and ensiling-NaOH pretreatment in terms of production improvement. Among them, 1 kg of ensiling-NaOH treated Pennisetum purpureum could yield 269.4 g of ethanol and 144.5 g of methane, with a respective increase of 313.2% and 40.8% compared to that from the untreated sample; this corresponded to the final energy production of 14.5 MJ, with the energy conversion efficiency of 46.8%. In addition, for the ensiling-NaOH treated Pennisetum purpureum, the energy recovery from coproduction (process III) was 98.9% higher than that from enzymatic hydrolysis and fermentation only (process I) and 53.6% higher than that from anaerobic digestion only (process II). This indicated that coproduction of bioethanol and biomethane from Pennisetum purpureum after ensiling and NaOH pretreatment is an effective method to improve its conversion efficiency and energy output., We investigated the effects of pretreatment on the coproduction (ethanol and methane) performance and material flow from Pennisetum purpureum.

Objective: To assess the efficacy and safety of the novel histone deacetylase inhibitor, chidamide, in combination with cyclophosphamide, doxorubicin, vincristine, etoposide, and prednisone (Chi-CHOEP) for untreated peripheral T-cell lymphoma (PTCL). Methods: A prospective, multicenter, single arm, phase 1b/2 study was conducted. A total of 128 patients with untreated PTCL (18–70 years of age) were enrolled between March 2016 and November 2019, and treated with up to 6 cycles with the Chi-CHOEP regimen. In the phase 1b study, 3 dose levels of chidamide were evaluated and the primary endpoint was determination of the maximum-tolerated dose and recommended phase 2 dose (RP2D). The primary endpoint of the phase 2 study was 2-year progression-free survival (PFS). Results: Fifteen patients were enrolled in the phase 1b study and the RP2D for chidamide was determined to be 20 mg, twice a week. A total of 113 patients were treated at the RP2D in the phase 2 study, and the overall response rate was 60.2%, with a complete response rate of 40.7%. At a median follow-up of 36 months, the median PFS was 10.7 months, with 1-, 2-, and 3-year PFS rates of 49.9%, 38.0%, and 32.8%, respectively. The Chi-CHOEP regimen was well-tolerated, with grade 3/4 neutropenia occurring in approximately two-thirds of the patients. No unexpected adverse events (AEs) were reported and the observed AEs were manageable. Conclusions: This large cohort phase 1b/2 study showed that Chi-CHOEP was well-tolerated with modest efficacy in previously untreated PTCL patients.

SARM1, an executioner in axon degeneration, is an autoinhibitory NAD-consuming enzyme, composed of multiple domains. NMN and its analogs, CZ-48 and VMN, are the only known activators, which can release the inhibitory ARM domain from the enzymatic TIR domain. Here, we document that acid can also activate SARM1, even more efficiently than NMN, possibly via the protonation of the negative residues. Systematic mutagenesis revealed that a single mutation, E689Q in TIR, led to the constitutive activation of SARM1. It forms a salt bridge with R216 in the neighboring ARM, maintaining the autoinhibitory structure. Using this 'acid activation' protocol, mutation K597E was found to inhibit activation, while H685A eliminated SARM1 catalytic activity, revealing two distinct inhibitory mechanisms. The protocol has also been applied to differentiate two classes of chemical inhibitors. NAD, dHNN, disulfiram, CHAPS, and TRX-100 mainly inhibited the activation process, while nicotinamide and Tweens mainly inhibited SARM1 catalysis. Taken together, we demonstrate a new mechanism for SARM1 activation and decipher two distinct inhibitory mechanisms of SARM1.

Food packaging materials, especially biodegradable polymer composites incorporated with natural antimicrobial agents with excellent antibacterial activities, are in high demand and attracted immense attention. Herein, a polycaprolactone/curcumin@zeolitic imidazolate framework-8 (PCL/Cur@ZIF-8) composite film with enhanced antibacterial activity was developed. Curcumin, a natural photosensitizer, was loaded in the highly porous nanocrystals ZIF-8 to improve its poor water solubility and stability. The integral structure of Cur@ZIF-8 was maintained well in the PCL matrix even at the highest loading of 35% (w/w), and all composite films had good light transmittance at 420-430 nm. The PCL/Cur@ZIF-8 composite films responded to the acidic growth environment of bacteria by releasing zinc ions and curcumin molecules. Furthermore, upon blue light irradiation (420-430 nm, 2.2 mW/cm2 ), curcumin molecules generated singlet oxygen. With the synergistic effects of zinc ions and singlet oxygen, the composite films exhibited a 99.9% reduction of Escherichia coli and Staphylococcus aureus strains when the amount of Cur@ZIF-8 loading was more than 15% (w/w), as well as a strong anti-adhesion effect on bacteria. Moreover, bacterial resuscitation tests indicated that the composite films exhibited 99.9% reduction in the adhered bacteria population through treatment with photodynamic sterilization. This is the first study presenting that the incorporated curcumin ZIF-8 nanoparticles in the matrix of polymer are pH and light responsive for anti-adhesion of bacteria, which is of great potential application as antibacterial packaging material for the food industry. PRACTICAL APPLICATION: A novel, biodegradable, pH, and light-responsive composite film was developed for antibacterial activity. Natural photosensitizer curcumin was encapsulated in ZIF-8 nanocrystals (Cur@ZIF-8) as the antimicrobial agent. With the synergistic effects of Zn2+ and singlet oxygen, the composite film exhibited a 99.9% reduction of Escherichia coli and Staphylococcus aureus strains, and a strong anti-adhesion property toward bacteria. This composite film is of great potential application as an antibacterial packaging material that enhances the shelf life of fruits, meat, and so on.

Background Adenosine 5′-triphosphate (ATP) plays both a central role as an intracellular energy source, and a crucial extracellular signaling role in diverse physiological processes of animals and plants. However, there are less reports concerning the signaling role of microbial extracellular ATP (eATP). Hypocrellins are effective anticancer photodynamic therapy (PDT) agents from bambusicolous Shiraia fungi. The co-culture of Shiraia sp. S9 and a bacterium Pseudomonas fulva SB1 isolated from Shiraia fruiting bodies was established for enhanced hypocrellin A (HA) production. The signaling roles of eATP to mediate hypocrellin biosynthesis were investigated in the co-culture. Results The co-culture induced release of eATP at 378 nM to the medium around 4 h. The eATP release was interdependent on cytosolic Ca2+ concentration and reactive oxygen species (ROS) production, respectively. The eATP production could be suppressed by the Ca2+ chelator EGTA or abolished by the channel blocker La3+, ROS scavenger vitamin C and NADPH oxidase inhibitor diphenyleneiodonium chloride (DPI). The bacterium-induced H2O2 production was strongly inhibited by reactive blue (RB), a specific inhibitor of membrane purinoceptors, but dependent on the induced Ca2+ influx in the co-culture. On the other hand, the application of exogenous ATP (exATP) at 10–300 µM to Shiraia cultures also promoted fungal conidiation and HA production, both of which were blocked effectively by the purinoceptor inhibitors pyridoxalphosphate-6-azophenyl-2′, 4′-disulfonic acid (PPADS) and RB, and ATP hydrolase apyrase. Both the induced expression of HA biosynthetic genes and HA accumulation were inhibited significantly under the blocking of the eATP or Ca2+ signaling, and the scavenge of ROS in the co-culture. Conclusions Our results indicate that eATP release is an early event during the intimate bacterial–fungal interaction and eATP plays a signaling role in the bacterial elicitation on fungal metabolites. Ca2+ and ROS are closely linked for activation of the induced ATP release and its signal transduction. This is the first report on eATP production in the fungal–bacterial co-culture and its involvement in the induced biosynthesis of fungal metabolites. Graphic abstract

The isomerization of glucose to fructose provides an important way to expand the utilization of biomass. Herein, an amidoximated polyacrylonitrile (PAO) with an amidoxime functional group was prepared and used as an active heterogeneous catalyst for the isomerization of glucose to fructose. The PAO was characterized by SEM, XPS, and FTIR. The yield of fructose reached 48.9% with a selectivity of 98.6% for a 5 h reaction in aqueous solution at an initial pH of 6.5 and 85 °C. The pH caused a great influence on the conversion of glucose and selectivity of fructose while a little effect on the yield of fructose in the range of pH 5-10. The activation energy of isomerization reaction was evaluated as 79.7 kJ·mol-1. The catalysis mechanism was proposed, and the synergistic effect of oxime and amino groups played an important role in the isomerization of glucose. PAO maintained good catalytic activity after four cycles.

The association among plasma trimethylamine-N-oxide (TMAO), FMO3 polymorphisms, and chronic heart failure (CHF) remains to be elucidated. TMAO is a microbiota-dependent metabolite from dietary choline and carnitine. A prospective study was performed including 955 consecutively diagnosed CHF patients with reduced ejection fraction, with the longest follow-up of 7 years. The concentrations of plasma TMAO and its precursors, namely, choline and carnitine, were determined by liquid chromatography-mass spectrometry, and the FMO3 E158K polymorphisms (rs2266782) were genotyped. The top tertile of plasma TMAO was associated with a significant increment in hazard ratio (HR) for the composite outcome of cardiovascular death or heart transplantation (HR = 1.47, 95% CI = 1.13-1.91, P = 0.004) compared with the lowest tertile. After adjustments of the potential confounders, higher TMAO could still be used to predict the risk of the primary endpoint (adjusted HR = 1.33, 95% CI = 1.01-1.74, P = 0.039). This result was also obtained after further adjustment for carnitine (adjusted HR = 1.33, 95% CI = 1.01-1.74, P = 0.039). The FMO3 rs2266782 polymorphism was associated with the plasma TMAO concentrations in our cohort, and lower TMAO levels were found in the AA-genotype. Thus, higher plasma TMAO levels indicated increased risk of the composite outcome of cardiovascular death or heart transplantation independent of potential confounders, and the FMO3 AA-genotype in rs2266782 was related to lower plasma TMAO levels.

5-iododeoxyuridine (IUdR), a radiosensitizer able to be incorporated into nascent DNA during synthesis, makes the DNA easy to break upon irradiation. IUdR has been used together with low energy radiation in cancer treatments mechanistically by Auger electron induction to damage DNA. In this study, a small-sized transmission X-ray tube equipped with a Lanthalum target (La-tX ray) generating 33–40 keV-enriched photons was used in combination with IUdR for Auger cancer therapy, and the performance was evaluated by multiple assays in vitro and in vivo. Cytotoxicity, thymidine replacement and nuclear incorporation of IUdR were evaluated in NG4TL4 fibrosarcoma cells and SAS head and neck cancer cells. After treatment of IUdR + La-tX ray irradiation or IUdR + Co-60 irradiation, cell survival and DNA damages were evaluated by colony forming assay and comet assay/γH2AX staining, respectively. Growth of tumor xenografts receiving an intratumoral IUdR injection (45 μg) and/or La-tX ray irradiation were measured. For NG4TL4 and SAS cells, the IC50 of IUdR were ~ 7 and ~ 10 μg/ml, respectively. As compared to IUdR + Co-60 irradiation, IUdR + La-tX ray resulted in higher DNA breaks in cancer cells. Also, IUdR + La-tX ray resulted in higher cell toxicity than IUdR + Co-60. In the in vivo study, tumor xenografts showed inhibited growth in the IUdR + La-tX ray treatment, compared to those in the IUdR or La-tX ray treatment alone. This study demonstrated the potential of cancer Auger electron therapy using a small-sized transmission X ray tube that generated enriched specific energy X rays for Auger electron induction.

Alizarin (1,2-dihydroxyanthraquinone) and purpurin (1,2,4-trihydroxyanthraquinone), natural anthraquinone compounds from Rubia tinctorum L., are reported to have diverse biological effects including antibacterial, antitumor, antioxidation, and so on, but the inhibition activity against amyloid aggregation has been rarely reported. In this study, we used insulin as a model protein to explore the anti-amyloid effects of the two compounds. The results showed that alizarin and purpurin inhibited the formation of insulin fibrils in a dose-dependent manner and reduced insulin-induced cytotoxicity. Meanwhile, purpurin had a more significant inhibitory effect on insulin amyloid fibrils compared with alizarin. In addition, computer simulations indicated that the two compounds interacted mainly with the hydrophobic residues of insulin chain B and interfered with the binding of phenylalanine residues. The research indicated that natural anthraquinone compounds had potential effects in preventing protein misfolding diseases and could be further used to design effective antiamyloidosis compounds.

Linezolid, the principal oxazolidinone antibiotic for therapy of Gram-positive infections, is limited by its myelosuppression and monoamine oxidase (MAO) inhibition, with the latter manifested as serotonergic neurotoxicity. The oral oxazolidinone contezolid and its injectable prodrug contezolid acefosamil are developed to overcome the above limitations. Serotonergic profiles for contezolid in vitro and for orally administered contezolid acefosamil in rodents are reported. Contezolid exhibited 2- and 148-fold reduction over linezolid reversible inhibition of MAO-A and MAO-B human enzyme isoforms. In the mouse head-twitch model, contezolid acefosamil was devoid of neurotoxicity at supratherapeutic oral doses of 40, 80, and 120 mg/kg. In the rat tyramine challenge model, no significant increase in arterial blood pressure was observed for contezolid acefosamil up to 120 mg/kg oral dosing. In these tests, the comparator linezolid has elicited serotonergic responses. Thus, contezolid and contezolid acefosamil exhibited an attenuated propensity to induce MAO-related serotonergic neurotoxicity. The data support a continued clinical evaluation of these agents, with potential to expand oxazolidinone therapies to patient populations on concurrent selective serotonin reuptake inhibitor medications or where MAO inhibitors are contraindicated.

All RecJ proteins are known to date only perform exonuclease activity. The present study reports that a novel RecJ protein obtained from Bacillus cereus isolated from marine sediments has both endonuclease and exonuclease activities. Analysis of the BcRecJ expression induction in E. coli BL21 revealed that the BcRecJ protein cleaved plasmids and genomic DNA in the host cell, and led to cell death and decreased the DNA content. Further, the BcRecJ protein had the ability to degrade supercoiled plasmid DNA into circular or linear forms in vitro. Meanwhile, the BcRecJ protein loaded with an S-modified guide facilitated plasmid linearization and reduced smear formation. The results suggested that this novel BcRecJ protein was different from any reported RecJs and had a longer C-terminus. Testing the BcRecJ mutants indicated that the endonuclease activity was affected by two residues of BcRecJ (D561, E637) after testing the BcRecJ mutants. The discovery of the type of protein is a new breakthrough for the RecJ proteins, which has both endonuclease and exonuclease activities.

Device stability under illumination is the main obstacle of nonfullerene (NF) organic solar cells for moving toward practical application. ZnO, a generally used electron-transporting layer in inverted cells, is prone to induce the decomposition of NF acceptors under illumination with air mass 1.5 (AM1.5) spectrum, resulting in poor device stability. Herein, we report an aqueous polyethylenimine (a-PEI) modification on the ZnO surface could significantly enhance the stability of the NF organic solar cells. After 1000 h of AM1.5 illumination, the efficiency of the cell without a-PEI modification degrades to 43% of its initial value, while the cell with a-PEI modification could maintain 75% of its initial efficiency. The a-PEI modification reduces the number of surface defects with reduced adsorbed oxygen ZnO surface, faster work function recovery kinetics after UV irradiation, and suppressed electron spin resonance response. The reduction of surface defects is beneficial to the stability of NF acceptors on ZnO and also device performance.

In this article, the nanoparticles of CoFe2O4 and FeS2/FeCoS2 have been generated by direct oxidation and sulfurization of Fe–Co precursor and used as counter electrode (CE) material for dye-sensitized solar cells (DSSCs). Compared with CoFe2O4, FeS2/FeCoS2 nanoparticles have superior electrical conductivity and catalytic activity. Furthermore, the introduction of reduced graphene oxide (RGO) improved the performance of FeS2/FeCoS2. By attaching FeS2/FeCoS2 nanoparticles to the surface of RGO, it alleviated the agglomeration of nanoparticles effectively. Meanwhile, the catalytic activity and electrical conductivity of FeS2/FeCoS2@RGO in DSSC are greatly improved. With increasing contact area, the penetration rate of the electrolyte is accelerated, which results in a faster reaction rate of tri-iodide that can be significantly accelerated. We explain the modification of FeS2/FeCoS2 nanoparticles by RGO through the morphology characterization and electrochemical performance test. The DSSCs assembled by FeS2/FeCoS2@RGO achieved a choiceness power conversion efficiency (PCE) of 7.84%, which is higher than those of CoFe2O4 nanoparticles (3.71%), FeS2/FeCoS2 nanoparticles (7.05%), and platinum (Pt) (7.54%).

In this study, maleic anhydride grafted polypropylene (MAPP) was incorporated as coupling agent in the wood-flour/polypropylene/ammonium polyphosphate composites (flame-retardant WPCs). The effects of MAPP content (5 wt.%, 10 wt.% and 15 wt.%) on the physical, mechanical and flammability properties of flame-retardant WPCs were investigated. The water soaking tests showed that the incorporation of MAPP could reduce the hygroscopicity of flame-retardant WPCs. The mechanical properties of WPCs were evaluated by three-point bending tests, unnotched Izod impact strength tests, and dynamic mechanical analysis. The results showed that the flame-retardant WPC containing 10 wt.% MAPP (WPC/APP/MAPP-10 %) performed the best flexural properties, the highest impact strength, E′ value, and tan δ at room temperature. The limiting oxygen index (LOI) tests and cone calorimetry tests showed that the incorporation of 10 wt.% MAPP endowed the flame-retardant WPC with the highest LOI value, the lowest peak-heat release rate, total heat release, CO/CO2 weight ratio and total smoke release. Moreover, the characterization of the WPCs combustion residues performed that WPC/APP/MAPP-10 % had the most complete carbonaceous structure with the highest graphitization degree after combustion. In general, the addition of 10 wt.% MAPP could impart the flame-retardant WPC with the optimum physical-mechanical properties and flame-retardant performance.

The fabrication of flexible electronic sensors with self-healing capability is of great importance for the applications in wearable devices and skin-like electronics. Herein, a molybdenum disulfide (MoS2) nanosheets-based hydrogel (Gel-PEG-MoS2, GPM hydrogel), with near infrared (NIR) light-induced self-healing property, was first reported as a flexible sensor. Only a small amount of MoS2 nanosheets (0.04 wt‰) could impart the hydrogel with fast self-healing property under NIR irradiation in 90 s. The healing efficiencies increased with the increasing of MoS2 loadings. Moreover, the GPM hydrogel exhibited both contact and noncontact sensing properties based on its deformation-dependent and light-sensitive conductivity, showing potential application as mechanical sensor and light-activated switches. By employing the versatile MoS2 nanosheets, the hydrogel exhibited both fast self-healing ability and mechanical/light sensing capability. Therefore, the MoS2-based hydrogel provides a two-pronged approach for construction of self-healing flexible electronics.

Cardiac dysfunction is involved in disorders of energy metabolism. High-titre autoantibodies against the β1 -adrenoceptor (β1 -AAs) have been reported to exist in patients with cardiac dysfunction; however, the mechanism by which β1 -AAs affect cardiac function is unknown. This study aimed to determine whether β1 -AAs disturb myocardium energy metabolism and cause cardiac dysfunction. β1 -AA monoclonal antibodies (β1 -AAmAbs) were successfully pre-synthesized by hybridoma clones and used in all experiments. β1 -AAmAbs impaired cardiac function and induced a myocardial metabolic disturbance, as evidenced by decreased left ventricular ejection fraction and fractional shortening. In addition, β1 -AAmAbs decreased the adenosine triphosphate level and increased cardiac energy consumption (rate-pressure product). We further showed that the effects of β1 -AAmAbs on heart tissue might involve the mitochondria and metabolic pathways via the β1 -adrenoceptor based on an immunoprecipitation and mass spectrometry. Additionally, we found that β1 -AAmAbs impaired myocardial mitochondrial structure, decreased the membrane potential, and induced insufficient mitophagy. In conclusion, β1 -AAmAb-induced cardiac dysfunction is partly due to a disturbance in myocardial energy metabolism.

Objective. To develop and validate a sensitive and rapid ultraperformance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) method for the determination of enasidenib in rat plasma and to investigate the effect of Xiao-ai-ping injection (XAPI) on the pharmacokinetics of enasidenib in rats. Methods. The rat plasma was precipitated with acetonitrile, enasidenib and internal standard (IS) were separated on an Acquity UPLC BEH C18 column, and acetonitrile and 0.1% formic acid were used as the mobile phase in gradient mode. Enasidenib and IS were monitored and detected by multiple reaction monitoring (MRM) using tandem mass spectrometry in positive ion mode. 12 Sprague-Dawley (SD) rats were randomly divided into control group (group A) and experimental group (group B), 6 rats in each group. Group B was intramuscularly injected with XAPI (0.3 mL/kg) every morning, 7 days in a row. Group A was intramuscularly injected with normal saline, 7 days in a row. On the seventh day, enasidenib (10 mg/kg) was given to both groups 30 min after injection of normal saline (group A) or XAPI (group B), and the blood was collected at different time points such as 0.33, 0.67, 1, 1.5, 2, 3, 4, 6, 9, 12, 24, and 48 h. The concentration of enasidenib was detected by UPLC-MS/MS, and the main parameters of pharmacokinetic of enasidenib were calculated using the DAS 2.0 software. Results. Under the current experimental conditions, this UPLC method showed good linearity in the detection of enasidenib. Interday and intraday precision did not exceed 10%, the range of accuracy values were from -1.43% to 2.76%. The results of matrix effect, extraction recovery, and stability met the requirements of FDA approval guidelines of bioanalytical method validation. The C max of enasidenib in the group A and the group B was ( 458.87 ± 136.02 ) ng/mL and ( 661.47 ± 107.32 ) ng/mL, t 1 / 2 was ( 7.74 ± 0.91 ) h and ( 8.64 ± 0.42 ) h, AU C 0 − t was ( 4067.24 ± 1214.36 ) ng·h/mL and ( 5645.40 ± 1046.30 ) ng·h/mL, AU C 0 − ∞ was ( 4125.79 ± 1235.91 ) ng·h/mL and ( 5759.61 ± 1078.59 ) ng·h/mL, respectively. The C max of enasidenib in group B was 44.15% higher than that in group A, and the AU C 0 − t and AU C 0 − ∞ of enasidenib in group B were 38.80% and 39.60% higher than that in group A, respectively, and the t 1 / 2 was prolonged from 7.74 h to 8.64 h. Conclusion. An UPLC-MS/MS method for the determination of enasidenib in rat plasma was established. XAPI can inhibit the metabolism of enasidenib and increase the concentration of enasidenib in rats. It is suggested that when XAPI was combined with enasidenib, the herb-drug interaction and adverse reactions should be paid attention to, and the dosage should be adjusted if necessary.

The arachidonic acid (AA) pathway plays a key role in cardiovascular biology, carcinogenesis, and many inflammatory diseases, such as asthma, arthritis, etc. Esterified AA on the inner surface of the cell membrane is hydrolyzed to its free form by phospholipase A2 (PLA2), which is in turn further metabolized by cyclooxygenases (COXs) and lipoxygenases (LOXs) and cytochrome P450 (CYP) enzymes to a spectrum of bioactive mediators that includes prostanoids, leukotrienes (LTs), epoxyeicosatrienoic acids (EETs), dihydroxyeicosatetraenoic acid (diHETEs), eicosatetraenoic acids (ETEs), and lipoxins (LXs). Many of the latter mediators are considered to be novel preventive and therapeutic targets for cardiovascular diseases (CVD), cancers, and inflammatory diseases. This review sets out to summarize the physiological and pathophysiological importance of the AA metabolizing pathways and outline the molecular mechanisms underlying the actions of AA related to its three main metabolic pathways in CVD and cancer progression will provide valuable insight for developing new therapeutic drugs for CVD and anti-cancer agents such as inhibitors of EETs or 2J2. Thus, we herein present a synopsis of AA metabolism in human health, cardiovascular and cancer biology, and the signaling pathways involved in these processes. To explore the role of the AA metabolism and potential therapies, we also introduce the current newly clinical studies targeting AA metabolisms in the different disease conditions.

Sp1-CSE-H2S pathway plays an important role in homocysteine-metabolism, whose disorder can result in hyperhomocysteinemia. H2S deficiency in hyperhomocysteinemia has been reported, while the underlying mechanism and whether it in turn affects the progress of hyperhomocysteinemia are unclear. This study focused on the post-translational modification of Sp1/CSE and revealed four major findings: (1) Homocysteine-accumulation augmented CSE's nitration, inhibited its bio-activity, thus caused H2S deficiency. (2) H2S deficiency inhibited the S-sulfhydration of Sp1, down-regulated CSE and decreased H2S further, which in turn weakened CSE's own S-sulfhydration. (3) CSE was S-sulfhydrated at Cys84, Cys109, Cys172, Cys229, Cys252, Cys307 and Cys310, among which the S-sulfhydration of Cys172 and Cys310 didn't affect its enzymatic activity, while the S-sulfhydration of Cys84, Cys109, Cys229, Cys252 and Cys307 was necessary for its bio-activity. (4) H2S deficiency trapped homocysteine-metabolism into a vicious cycle, which could be broken by either blocking nitration or restoring S-sulfhydration. This study detected a new mechanism that caused severe hyperhomocysteinemia, thereby provided new therapeutic strategies for hyperhomocysteinemia.

Layered titanium carbide (Ti3C2Tx) MXene is a promising electrode material for use in next-generation electrochemical capacitors. However, the atomic-level information needed to correlate the distribution of intercalated cations with surface redox reactions, has not been investigated in detail. Herein we report on sodium preintercalated MXene with high sodium content (up to 2Na per Ti3C2Tx formula) using a solution of Na-biphenyl radical anion complex (E0 ≈ -2.6 SHE). Multiple sodiation sites and formation of a two-dimensional sodium domain structure at interfaces/surfaces is identified through combined computational simulations with neutron pair distribution function analysis. The induced layer charges and the redox process characterized by the density-functional tight-binding method on a local scale are found to greatly depend on the location of sodium ions. Electrochemical testing of the pre-sodiated MXene as an electrode material in a sodium-ion capacitor shows excellent reversibility and promising performance, indicating the feasibility of chemical preintercalation as an approach to prepare MXene electrodes for ion capacitors.

Phthalates can leach into indoor and outdoor airborne particulate matter and dust, which can then be ingested or absorbed and induce lung injury. Dermal phthalate levels can be used as a matrix for exposure direct absorption from air, particle deposition, and contact with contaminated products. However, the association between dermal phthalate levels in skin wipes and lung function tests remains unknown. A total of 397 participants were included. Spirometry measurements of forced expiratory volume in 1 s (FEV1, L) and forced vital capacity (FVC, L) were calculated. Dermal phthalate levels of diethyl phthalate (DMP), diethyl phthalate (DEP), di(n-butyl) phthalate (DnBP), butyl benzyl phthalate (BBzP), di(2-ethylhexyl) phthalate (DEHP), diisononyl phthalate (DiNP), and diisodecyl phthalate (DiDP) on forehead skin wipes were detected. The one-unit increases in logarithm (log) dermal DnBP (β = − 0.08; 95% CI − 0.16, − 0.003, p = 0.041), BBzP (β = − 0.09; 95% CI − 0.16, − 0.02, p = 0.009), DEHP (β = − 0.07; 95% CI − 0.14, − 0.003, p = 0.042), and DiNP (β = − 0.08; 95% CI − 0.15, − 0.02, p = 0.017) were significantly associated with decreases in FVC. For elderly participants, one-unit increases in log dermal DnBP (β = − 0.25; 95% CI − 0.46, − 0.04, p = 0.021), BBzP (β = − 0.17; 95% CI − 0.33, − 0.01, p = 0.042), and DiDP (β = − 0.19; 95% CI − 0.39

Growing evidence has suggested that hyperhomocysteinemia (HHcy) is a risk factor for cerebral infarction. However, the effect of HHcy on postoperative cerebral ischemia is still unclear. We aim to investigate the relationship between HHcy and postoperative ischemia of adult patients with moyamoya disease (MMD). A total of 138 adult patients with MMD were prospectively recruited from July 1 to December 31, 2019. After excluding 14 patients accepting conservative therapy, all 124 patients who underwent surgical treatment were enrolled. Patients were grouped according to postoperative ischemia and HHcy presentation, respectively. Clinical data and laboratory examinations were compared by statistical analyses. Potential risk factors were evaluated by univariate and multivariate logistic regression analysis. Comparing to the normal, patients with postoperative ischemia were higher in serum homocysteine (Hcy) level (P = 0.039) and HHcy ratio (P = 0.035). Furthermore, HHcy was more common in males (P = 0.007) than females. Logistic analysis results showed that HHcy (OR 5.234, 95% CI 1.127-24.315; P = 0.035) was an independent risk factor. HHcy was significantly associated with postoperative ischemia in MMD patients. Our study found that HHcy was correlated to the risk of postoperative ischemia. HHcy can be used as an indicator and a potential therapeutic target for postoperative ischemia in adult patients with MMD. URL: http://www.chictr.org . Unique identifier: ChiCTR2000031412.

Barium titanate nickelate (BTN) nanorod (NR)-based resistive random access memory (RRAM) has been demonstrated by using the hydrothermal method. The prepared BTN NR materials have the advantages of ease of fabrication, low temperature application, ability to grow various materials, and relative cost effectiveness. In addition, the BTN NR-based RRAM displayed a highly repeatable and forming-free bipolar resistive switching behavior with an ON/OFF ratio of over 105. The resistive switching behavior may be related to the oxygen vacancies on the surface of the BTN NRs, giving rise to the formation of straight and extensible conducting filaments along each vertically aligned BTN NR. Compared to its counterpart of BTN thin film, superior reproducibility was also observed, demonstrating that the nanostructured material provides an effective way to improve the memory properties.

An important challenge for commercializing dye-sensitized solar cells (DSSCs) is the development of efficient non-precious metal counter electrode (CE) materials, which must be solved using non-precious metal catalysts because of their poor stability and low efficiency. In this work, N-doping was applied to synthesize Co/NC based on the preparation of one-dimensional carbon nanotube-encapsulating metal Co monomers, which showed excellent application prospects as DSSC counter electrodes. The coating of carbon nanotubes makes the metal Co monomers less susceptible to corrosion in the electrolyte, ensures structural stability, and functions as a high-speed transport pathway, facilitating accelerated electron transfer to the active site. The synergistic effect of N-doped carbon and metal Co monomers can further improve the electrocatalytic activity, electrical conductivity and accelerate the reduction of triiodide and enhance the catalytic activity of triiodide, thus improving its photoelectric conversion efficiency (PCE). An excellent PCE of 8.56% was obtained during detailed electrochemical tests and good long-term electrochemical stability was also demonstrated in iodine-based electrolytes. This study illustrates that the encapsulation of metallic Co nanocrystals in nitrogen-doped carbon nanotubes is an effective strategy to increase the overall catalytic activity.

Background: We aimed to evaluate the therapeutic effect of additional ursodeoxycholic acid (UDCA) with mesalazine, compared to mesalazine alone in patients with ulcerative colitis (UC). The mechanism was evaluated by monitoring the changes of IL-23-IL-17 axis and the intestinal microflora. Methods: In this prospective, single center study, patients with UC were randomly assigned to the Mesalazine group (n=20) or the UDCA + Mesalazine group (n=20). Mayo score and Inflammatory Bowel Disease Questionnaire (IBDQ), and fecal samples for 16S rRNA sequencing and blood samples for IL-23 and IL-17 ELISA were collected for analysis. Results: Mayo scores and IBDQ score of the UDCA + Mesalazine group were significantly better than those of the Mesalazine group (P = 0.015 and P < 0.001, respectively). At post-treatment week 4, IL-23 and IL-17 levels were significantly lower in the UDCA + Mesalazine group compared to those in the Mesalazine group (both P < 0.038). In patients with UC after treatment, Firmicutes in the UDCA + Mesalazine group was higher than those in the Mesalazine group (P < 0.001). The UDCA + Mesalazine group showed lower percentage of Proteobacteria compared to those in the Mesalazine group (P < 0.001). Conclusion: Additional UDCA could provide better therapeutic effects than mesalazine alone, possibly due to the change of IL-23 and IL-17 and the proportional distribution of intestinal microflora.

Gibbsite [α-Al(OH)3] is the solubility limiting phase for aluminum across a wide pH range, and it is a common mineral phase with many industrial applications. The growth mechanism of this layered-structure material, however, remains incompletely understood. Synthesis of gibbsite at low to circumneutral pH yields nanoplates with substantial interlayer disorder. Here we examine defects in this material in detail, and the effects of recrystallization in highly alkaline sodium hydroxide solution at 80 °C. We employed a multimodal approach, including scanning electron microscopy, magic-angle spinning nuclear magnetic resonance (MAS-NMR), Raman and infrared spectroscopies, X-ray diffraction (XRD), and X-ray total scattering pair distribution function (XPDF) analysis to characterize the ageing of the nanoplates over several days. XRD and XPDF indicate that gibbsite nanoplates precipitated at circumneutral pH contain dense, truncated sheets imparting a local difference in interlayer distance. These interlayer defects appear well described by flat Al13 aluminum hydroxide nanoclusters nearly isostructural with gibbsite sheets present under synthesis conditions and trapped as interlayer inclusions during growth. Ageing at elevated temperature in alkaline solutions gradually improves crystallinity, showing a gradual increase in H-bonding between interlayer OH groups. Between 7 to 8 vol% of the initial gibbsite nanoparticles exhibit this defect, with the majority of differences disappearing after 2-4 hours of recrystallization in alkaline solution. The results not only identify the source of disorder in gibbsite formed under acidic/neutral conditions but also point to a possible cluster-mediated growth mechanism evident through inclusion of relict oligomers with gibbsite-like topology trapped in the interlayer spaces.

This research reports on the atomic layer deposition (ALD) mechanism of MgO thin film using bis(cyclopentadienyl) magnesium [Mg(Cp)2] as the Mg-precursor and O3 or H2O as an oxygen source. The different growth temperature effects of growth behaviour for the two types of oxygen sources were carefully evaluated. Insufficient H2O purging time caused the Mg-hydrides to remain in the deposited MgO thin film, which may cause inhibited growth on the bare-Si substrate. For the case of O3-based ALD, such an adverse reaction was not observed. However, it showed a complicated temperature-dependent growth behaviour, and an abnormal ‘overgrowth’ zone around 290 °C was found when the growth temperature was varied from 140 °C to 390 °C. The carbonate intermediates and OH− reactive sites involving the growth mechanism with Cp-ring rupture were suggested. This mechanism was supported by the subsequent chemical and physical properties analysis, correlating the electrical characteristics using the planar metal–insulator–metal capacitors [metal layer was titanium nitride (TiN)], with the substrate temperature varying from 230 °C to 390 °C. The MgO deposited at 290 °C, where oligomerisation may happen between ligands after the Cp-ring rupture, caused the void formation, low density, and a relatively high-impurity level. The post-deposition and post-metallisation annealing conditions were examined for the optimal leakage current and dielectric constant of the MgO film. MgO and TiN showed local epitaxial growth due to the close lattice match. This finding suggested the possible use of the in situ crystallised MgO as a crystallisation seed layer for ultrathin (

As an emerging class of hybrid complexes, the donor–acceptor (D–A) hybrid crystals containing photoactive organic and inorganic components have gradually become an ideal platform for constructing photochromic materials in recent years. In order to investigate the effect of D–A interactions on photochromic properties, three novel hybrid crystals, [Eu2(NO3)2(cbp-I)4(H2O)8][Co(CN)6](NO3)·6H2O·CH3OH (1), [Eu(NO3)2(cbp-I)2(H2O)3](NO3)·3H2O (2), and (cbp-II)(cbp-III)[Co(CN)6]·7H2O (3), have been designed and synthesized. They all exhibit reversible eye-detectable color changes with different photoresponsive speeds: the photoresponse speeds are 1 > 3 > 2. This result can be attributed to the introduction of effective electron-transfer channels through combining [Co(CN)6]3− as an electron donor with viologen acceptors in 1 and 3, in comparison to 2. Moreover, accompanied with the interesting photochromic process, these unique hybrid compounds simultaneously possess a photomodulated luminescent behaviour. The luminescent intensity of 2 is far greater than that of the other two compounds, and 2 shows high sensitivity towards 4-nitroaniline with a very small LOD of ca. 9.78 × 10−7 M.

Thermocatalytic decomposition (TCD) of methane can produce hydrogen and valuable nanocarbon co-products with low to near-zero CO2 emission. In this study, a series of Pd promoted Ni catalysts, prepared with various Ni/Pd ratios on a CNT support, were evaluated for methane TCD performance. Characterization and calculations using density functional theory (DFT) were carried out to elucidate the activity–structure relationship and growth mechanism of carbon nanomaterials. It was found that the methane conversion and stability of the catalysts were highly dependent on the Ni/Pd ratio and reaction temperature. DFT calculations revealed that the diffusion of carbon in the metal sublayer required for CNT growth was more favorable in the Ni–Pd alloy lattice suggesting that the buildup of carbon in the metal alloy sublayer facilitated the formation of CNTs and CNFs. A cyclic reaction–regeneration process for self-sustained TCD was experimentally demonstrated. In each cycle, a portion of the separated CNT product was used to re-synthesize the Ni–Pd/CNT catalyst for use in the next reaction cycle. After five cycles of operation, the CH4 conversion, morphology and crystallinity of the carbon product remained unchanged.

Recently, the power conversion efficiencies (PCEs) of bulk-heterojunction organic solar cells (BHJ-OSCs) based on non-fullerene acceptors (NFAs) have made a very impressive progress in the research field. However, less attention has been paid to the intrinsic chemical and photochemical stability of NFAs, although they are correlated greatly with the resulting device stability. Herein, we describe a new molecular design strategy to enhance the intrinsic chemical and photochemical stability of acceptor–donor–acceptor (A–D–A)-type NFAs by introducing ring-locked carbon–carbon double bonds between D–A conjugation, attributed to increased steric hindrance of nucleophilic attack and the formation of intramolecular C–H⋯O interactions. Based on this strategy, two types of NFAs were successfully prepared, 2-(1,1-dicyanomethylene)rhodanine-based IDT-CR and IDTT-CR and thiobarbituric acid-based IDT-CT and IDTT-CT. When blended with a wide-bandgap polymer donor (P3HT), the IDTT-CR-based solar cells can exhibit a PCE of 2.86%. Moreover, a much enhanced PCE of 6.13% was realized by adopting a low-bandgap polymer donor PTB7-Th to pair with IDTT-CT. The fabricated PTB7-Th:IDTT-CT-based OSCs showed very encouraging photostability, the PCE of which could retain >80% of the initial values after 200 h one sun irradiation in air without a UV filter. Such photostability performance has greatly outperformed those from conventional NFAs like ITIC, IT-4F, and IT-M, suggesting the effectiveness of our ring-locking design strategy. Moreover, PTB7-Th:IDTT-CT-based OSCs could retain ∼70% of its initial PCE after heating at 85 °C for 100 h. Furthermore, we reported an inferior device stability for P3HT:IDTT-CR based OSCs, which is primarily attributed to the evolution of BHJ film morphology under light illumination.

The Ni/SiO2 catalysts were prepared by ammonia evaporation method, with nickel nitrate as Ni source and silica sol as the SiO2 source, for synthesis of 2-MTHF from 2-MF hydrogenation. The catalytic performance of catalysts prepared at different calcination temperatures were tested on a fixed-bed reactor. XRD, N2 adsorption-desorption isothermal, H2-TPR, NH3-TPD, XPS and TG were employed to characterize the structure and surface properties of these catalysts. The effect of calcination temperature on the structure, surface property and catalytic performance of catalysts were investigated. The result indicated that all the catalysts had a phyllosilicate structure after calcination, and maintained the structure after reduction. Ni particles dispersed well with smaller size and strong metal support interaction showed high activity. The surface acidity of catalysts was influenced by the calcination temperature. The maximum catalytic activity and selectivity were obtained on the catalyst calcined by at 500°C, which exhibited a 2-MF conversion of 100% and the 2-MTHF selectivity of 93.5% at the optimized condition, due to smaller particle size and suitable surface acidity.

The composition and configuration are the deciding factors for catalytic properties and are constrained by the physical nature of the selected elements, thereby influencing the functionality of heterogeneous catalysts. In view of this, herein, a one-dimensional bifunctional heterogeneous nanocatalyst consisting of SnO2 capped Pt nanorods (Pt–SnOx NRs) is developed via the formic acid reduction method (FAM), showing high oxygen reduction reaction (ORR) and hydrogen evolution reaction (HER) performance. The performance of the as-prepared Pt–SnOx NRs was 1.4-fold higher than that of the commercial J.M.-Pt/C catalyst with an outstanding mass activity (MA) of 160 mA mgPt−1 at 0.85 V vs. SHE towards the ORR in acidic medium. Of special relevance, these Pt–SnOx NRs exhibit notable stability and retained 87% of their initial MA when operated up to 5k cycles in an accelerated durability test (ADT) in the ORR. Moreover, the Pt–SnOx NRs achieved a remarkably lower overpotential (η) of 48 mV (at a current density of 10 mA cm−2) and a Tafel slope of 33 mV dec −1 in the HER, significantly lower than those of the commercial J.M.-Pt/C catalyst (η = 60 mV and Tafel slope = 38 mV dec−1). Besides, such a material maintained its 100% HER activity in a chronoamperometric (CA) stability test up to 6 h. By cross-referencing the results of structural and electrochemical inspections, such a high bifunctional performance of Pt–SnOx NRs is attributed to the synergistic collaboration between the SnO2 modifier and Pt atoms. The SnO2 accelerates the HO–H bond cleavage during the HER and simultaneously promotes the desorption of oxygen species on the Pt surface in the ORR, which later triggers the reduction reaction performance. Meanwhile, SnO2 provides a shielding effect to Pt under harsh reduction conditions and thus high stability of Pt–SnOx NRs is achieved.

Poly(3,4-ethylenedioxythiophene):poly(styrene sulfonate) (PEDOT:PSS) with high electrical conductivity and optical transmittance is regarded as a promising printable transparent electrode for organic solar cells. Intrinsically, it has a high work function because PEDOT is in an oxidized state. The oxidized state is prone to chemical reduction by polyethylenimine (PEI) or ethoxylated PEI (PEIE) or sol–gel ZnO precursors (ethanolamine contained) during work function tuning. In this work, we report zinc-ion chelated PEIE (denoted as PEI-Zn) deposited on the PEDOT:PSS electrode to reduce its work function as an efficient electron-collecting electrode. The introduction of zinc ions can effectively suppress the chemical reduction of PEDOT:PSS films by PEIE. High optical transmittance and electrical conductivity of PEDOT:PSS remain during the coating. The PEI-Zn can be as thick as 70 nm on PEDOT:PSS as an interlayer. Devices were fabricated on the low-work function PEDOT:PSS/PEI-Zn electrode. With the active layer of PM6:Y6, the cell shows a power conversion efficiency of 11.2% (open-circuit voltage of 0.81 V, short-circuit current of 21.3 mA cm−2, and fill factor of 0.65).

Although traditional functionally graded materials (FGMs) have weakened a certain extent abrupt changes along interfaces between layers, eliminating residual abrupt interfaces which results in great inter laminar stresses remains a major challenge. Herein, ceramic scaffolds with novel continuously graded channels have been firstly prepared through combining layer-by-layer casting with gelation-freeze-dry. Followed by infiltrating soft phase, the co-continuous FGMs without delamination and abrupt changes between layers can be successfully fabricated. The wet layering of suspensions and continuous ice crystals across the interface are the main reasons for the eliminated interfaces. More importantly, the performance of FGMs can be optimized to meet the practical requirement attributed to the varied porosity and pore size distribution of freeze-cast ceramic scaffolds. The novel process for co-continuous ceramics/ FGMs without abrupt interfaces can be extended to other polymers or even metals.

Summary Objective Cartilage health is maintained in response to a range of mechanical stimuli including compressive, shear and tensile strains and associated alterations in osmolality. The osmotic-sensitive ion channel Transient Receptor Potential Vanilloid 4 (TRPV4) is required for mechanotransduction. Mechanical stimuli inhibit interleukin-1β (IL-1β) mediated inflammatory signalling, however the mechanism is unclear. This study aims to clarify the role of TRPV4 in this response. Design TRPV4 activity was modulated glycogen synthase kinase (GSK205 antagonist or GSK1016790 A (GSK101) agonist) in articular chondrocytes and cartilage explants in the presence or absence of IL-1β, mechanical (10% cyclic tensile strain (CTS), 0.33 Hz, 24hrs) or osmotic loading (200mOsm, 24hrs). Nitric oxide (NO), prostaglandin E2 (PGE2) and sulphated glycosaminoglycan (sGAG) release and cartilage biomechanics were analysed. Alterations in post-translational tubulin modifications and primary cilia length regulation were examined. Results In isolated chondrocytes, mechanical loading inhibited IL-1β mediated NO and PGE2 release. This response was inhibited by GSK205. Similarly, osmotic loading was anti-inflammatory in cells and explants, this response was abrogated by TRPV4 inhibition. In explants, GSK101 inhibited IL-1β mediated NO release and prevented cartilage degradation and loss of mechanical properties. Upon activation, TRPV4 cilia localisation was increased resulting in histone deacetylase 6 (HDAC6)-dependent modulation of soluble tubulin and altered cilia length regulation. Conclusion Mechanical, osmotic or pharmaceutical activation of TRPV4 regulates HDAC6-dependent modulation of ciliary tubulin and is anti-inflammatory. This study reveals for the first time, the potential of TRPV4 manipulation as a novel therapeutic mechanism to supress pro-inflammatory signalling and cartilage degradation.

A Pd-catalyzed C–F bond alkynylation of polyfluoroalkyl ketones with terminal alkynes has been developed. The method gives access to a range of modular perfluoroalkyl- and alkynyl-substituted furan derivatives in moderate yields with high chemoselectivity and regioselectivity. The key to the success of the present cascade reaction mainly relies on the well-controlled sequence of functionalization and alkynylation of multiple C(sp3)–F bonds. Mechanistic studies showed that the reaction presumably proceeded through a chelation-assisted oxidative addition of Pd to the C–F bond.