Search

Polyguanine tracts (PolyGs) are short guanine homopolymer repeats that are prone to accumulating mutations when cells divide. This feature makes them especially suitable for cell lineage tracing, which has been exploited to detect and characterize precancerous and cancerous somatic evolution. PolyG genotyping, however, is challenging because of the inherent biochemical difficulties in amplifying and sequencing repetitive regions. To overcome this limitation, we developed PolyG-DS, a next-generation sequencing (NGS) method that combines the error-correction capabilities of duplex sequencing (DS) with enrichment of PolyG loci using CRISPR-Cas9-targeted genomic fragmentation. PolyG-DS markedly reduces technical artifacts by comparing the sequences derived from the complementary strands of each original DNA molecule. We demonstrate that PolyG-DS genotyping is accurate, reproducible, and highly sensitive, enabling the detection of low-frequency alleles (

Significance Epimutations arising from transcriptional mutagenesis have been hypothesized to contribute to viral and bacterial evolution, drug resistance, and age-related diseases, including cancer and neurodegeneration. However, methodology limitations have inhibited progress toward elucidating the contributions of epimutations to cellular evolution and survival in vivo. Recent efforts to overcome these limitations remain constrained by artifacts arising during RNA library preparation. We present accurate RNA consensus sequencing (ARC-seq), an accurate, high-throughput RNA sequencing method that effectively eliminates errors introduced during RNA library preparation and sequencing and represents a major advance over previous methods. ARC-seq will enable investigations of the causal roles of transcriptional fidelity and epimutations in multiple fields, including viral evolution, bacterial resistance, and age-related diseases, such as cancer and neurodegeneration.

Cockayne syndrome (CS) and xeroderma pigmentosum (XP) are human photosensitive diseases with mutations in the nucleotide excision repair (NER) pathway, which repairs DNA damage from UV exposure. CS is mutated in the transcription-coupled repair (TCR) branch of the NER pathway and exhibits developmental and neurological pathologies. The XP-C group of XP patients have mutations in the global genome repair (GGR) branch of the NER pathway and have a very high incidence of UV-induced skin cancer. Cultured cells from both diseases have similar sensitivity to UV-induced cytotoxicity, but CS patients have never been reported to develop cancer, although they often exhibit photosensitivity. Because cancers are associated with increased mutations, especially when initiated by DNA damage, we examined UV-induced mutagenesis in both XP-C and CS cells, using duplex sequencing for high-sensitivity mutation detection. Duplex sequencing detects rare mutagenic events, independent of selection and in multiple loci, enabling examination of all mutations rather than just those that confer major changes to a specific protein. We found telomerase-positive normal and CS-B cells had increased background mutation frequencies that decreased upon irradiation, purging the population of subclonal variants. Primary XP-C cells had increased UV-induced mutation frequencies compared with normal cells, consistent with their GGR deficiency. CS cells, in contrast, had normal levels of mutagenesis despite their TCR deficiency. The lack of elevated UV-induced mutagenesis in CS cells reveals that their TCR deficiency, although increasing cytotoxicity, is not mutagenic. Therefore the absence of cancer in CS patients results from the absence of UV-induced mutagenesis rather than from enhanced lethality.

Summary: High-accuracy next-generation DNA sequencing promises a paradigm shift in early cancer detection by enabling the identification of mutant cancer molecules in minimally invasive body fluid samples. We demonstrate 80% sensitivity for ovarian cancer detection using ultra-accurate Duplex Sequencing to identify TP53 mutations in uterine lavage. However, in addition to tumor DNA, we also detect low-frequency TP53 mutations in nearly all lavages from women with and without cancer. These mutations increase with age and share the selection traits of clonal TP53 mutations commonly found in human tumors. We show that low-frequency TP53 mutations exist in multiple healthy tissues, from newborn to centenarian, and progressively increase in abundance and pathogenicity with older age across tissue types. Our results illustrate that subclonal cancer evolutionary processes are a ubiquitous part of normal human aging, and great care must be taken to distinguish tumor-derived from age-associated mutations in high-sensitivity clinical cancer diagnostics. : Salk et al. demonstrate that ultra-sensitive DNA sequencing to identify TP53 mutations among cells shed into uterine fluid shows potential for minimally invasive ovarian cancer detection. Yet they also reveal ubiquitous age-related accumulations of cancer-like TP53 mutations in the normal tissues of healthy women. This highlights an important challenge of using tumor driver mutations for cancer screening. Keywords: Duplex Sequencing, next-generation sequencing, TP53, clonal evolution, early detection, somatic mutations, high-grade serous ovarian cancer, uterine lavage, aging, gynecologic oncology

High accuracy next-generation DNA sequencing promises a paradigm shift in early cancer detection by enabling the identification of mutant cancer molecules in minimally-invasive body fluid samples. We demonstrate 80% sensitivity for ovarian cancer detection using ultra-accurate Duplex Sequencing to identify TP53 mutations in uterine lavage. However, in addition to tumor DNA, we also detect low frequency TP53 mutations in nearly all lavages from women with and without cancer. These mutations increase with age and share the selection traits of clonal TP53 mutations commonly found in human tumors. We show that low frequency TP53 mutations exist in multiple healthy tissues, from newborn to centenarian, and progressively increase in abundance and pathogenicity with older age across tissue types. Our results illustrate that subclonal cancer evolutionary processes are a ubiquitous part of normal human aging and great care must be taken to distinguish tumor-derived, from age-associated mutations in high sensitivity clinical cancer diagnostics.

Despite the remarkable throughput of next-generation sequencing technologies, standard techniques are limited by the difficulty in distinguishing sequencing errors from genuine low-frequency DNA variants within heterogeneous cellular or molecular populations. This Review discusses sequencing methodologies and bioinformatic strategies that have been devised for the reliable detection of rare mutations and describes various important applications in diverse fields including cancer, ageing and metagenomics. Mutations, the fuel of evolution, are first manifested as rare DNA changes within a population of cells. Although next-generation sequencing (NGS) technologies have revolutionized the study of genomic variation between species and individual organisms, most have limited ability to accurately detect and quantify rare variants among the different genome copies in heterogeneous mixtures of cells or molecules. We describe the technical challenges in characterizing subclonal variants using conventional NGS protocols and the recent development of error correction strategies, both computational and experimental, including consensus sequencing of single DNA molecules. We also highlight major applications for low-frequency mutation detection in science and medicine, describe emerging methodologies and provide our vision for the future of DNA sequencing.

Background: Leukemia stem cells (LSCs) play a critical role in AML propagation and relapse. Other investigators have also highlighted unique gene expression profiles for the leukemia stem cell population. Here we compared the results of in vitro drug sensitivity testing against a custom panel of drugs and drug combinations for blast populations vs. leukemia stem cell populations derived from the same patients, as well as mutation analysis for a panel of 194 recurrently mutated genes in AML. Patients and Methods: Patient AML samples were obtained with IRB approval. LSCs were isolated by fluorescence-activated cell sorting (FACS) and the blast population enriched to >90% using immunomagnetic beads from blood samples from 5 patients with AML. A sixth AML patient sample was used for NOD/SCID IL2R γc−/− engraftment, in order to compare characteristics of pre- and post-engraftment subclones. Our CLIA approved custom assay includes 153 drugs and targeted agents, both FDA approved and investigational, with additional drug combinations. High throughput screens (HTS) were conducted with enriched cells adherent to matrix protein in 384 well plates with 8 concentrations of each drug spanning 4 logs. Viability was assessed with CellTiter-Glo (Promega). HTS were performed on LSCs, blasts and pre- as well as post-engraftment AML subclones from the xenograft. Dose-response curves were generated to calibrate drug resistance patterns. Mutation analysis by NGS for a panel of 194 recurrently mutated genes in AML (MyAML®) including 37 translocations was also conducted for the LSC and blast populations. Results: AML blasts and LSCs exhibited divergent drug susceptibility patterns (see volcano plot in Figure). Of 11 drugs commonly used in AML, 8 were typical chemotherapy drugs. Five of these compounds were effective against blasts, but none were effective against LSCs (p-value: 0.0256), suggesting a possible mechanism for post-treatment relapse or primary refractoriness. LSCs were also resistant to mitomycin-C, an agent that induces DNA interstrand crosslinks and DNA breaks, in contrast to blasts that were variably sensitive. Of note, we identified 12 drugs from 8 classes defined by mechanism of action that may target LSCs, in some cases preferentially, when compared with blasts. Drugs effective in preferentially targeting LSCs included tyrosine kinase inhibitors, histone deacetylase inhibitors, 1 cyclin-dependent kinase inhibitor, 1 proteasome inhibitor and 1 microtubule assembly inhibitor. Several of the drugs that efficiently killed LSCs have been studied clinically in AML, while others have theoretical or established efficacy against LSCs by drug class. Only one commonly used drug in AML, sorafenib, a multikinase inhibitor used in FLT3+ disease that may improve survival in younger patients, was effective against LSCs. Blast specific drugs include romidepsin, dinaciclib, alvocidib, ganetespib, selinexor, dorsomorphin, vinblastine, cladribine, dabrafenib, selumetinib, etoposide, torkinib and those in Figure. Blast and LSC drug susceptibility patterns were distinct for each patient. Further, the engrafted xenograft subclone grew very rapidly, was resistant to standard chemotherapy, and possessed three new deleterious mutations in KMT2C (2), SF3B1 and 1 possibly damaging mutation in NUP214, suggesting possible genetic contributions to chemotherapy resistance. We also compared mutation profiles for LSCs vs. blasts in 5 patients, and identified LSC specific mutations in WNK3, WNK4 and BUB1, each in 2 of the 5, and there were also other mutations that were LSC or blast specific. Of note, Bub1 is a mitotic checkpoint serine/threonine kinase that controls mitosis in cancer stem cells (Venere et al Cancer Discov. 2013). WNK3 and WNK4 also both encode serine/threonine protein kinases. Conclusions: The distinct drug susceptibility patterns of patient-specific LSC and blast populations highlight the potential of an individualized approach to treat AML. LSCs are resistant to S-phase agents used in standard-of-care chemotherapy. Genetically distinct minority resistant LSC subclones present at diagnosis may grow rapidly under some conditions, and contribute to drug resistance and relapse. Incorporating the results of functional drug screening focused on LSC subclones may allow more individualized treatment of AML patients and identify patient-specific therapies that lead to improved outcomes. Figure Figure. Disclosures Carson: Invivoscribe Inc.: Employment. Patay:Invivoscribe Inc.: Consultancy, Equity Ownership, Patents & Royalties. Becker:Novartis: Research Funding; Trovagene: Research Funding; CVS Caremark: Consultancy; JW Pharmaceuticals: Research Funding; Rocket Pharmaceuticals: Research Funding; Pfizer: Consultancy; Amgen: Research Funding; BMS: Research Funding; Abbvie: Research Funding; GlycoMimetics: Research Funding.

Cancer recapitulates Darwinian evolution. Mutations acquired during life that provide cells with a growth or survival advantage will preferentially multiply to form a tumor. As a result of The Cancer Genome Atlas Project, we have gathered detailed information on the nucleotide sequence changes in a number of human cancers. The sources of mutations in cancer are diverse, and the complexity of those found to be clonally present in tumors has increasingly made it difficult to identify key rate-limiting genes for tumor growth that could serve as potential targets for directed therapies. The impact of DNA sequencing on future cancer research and personalized therapy is likely to be profound and merits critical evaluation.

Human alkyladenine-DNA glycosylase (AAG) initiates base excision repair (BER) of alkylated and deaminated bases in DNA. Here, we assessed the mutability of the AAG substrate binding pocket, and the essentiality of individual binding pocket amino acids for survival of methylation damage. We used oligonucleotide-directed mutagenesis to randomize 19 amino acids, 8 of which interact with substrate bases, and created more than 4.5 million variants. We expressed the mutant AAGs in repair-deficient Escherichia coli and selected for protection against the cytotoxicity of either methylmethane sulfonate (MMS) or methyl-lexitropsin (Me-lex), an agent that produces 3-methyladenine as the predominant base lesion. Sequence analysis of 116 methylation-resistant mutants revealed no substitutions for highly conserved Tyr(127)and His(136). In contrast, one mutation, L180F, was greatly enriched in both the MMS- and Me-lex-resistant libraries. Expression of the L180F single mutant conferred 4.4-fold enhanced survival at the high dose of MMS used for selection. The homogeneous L180F mutant enzyme exhibited 2.2-fold reduced excision of 3-methyladenine and 7.3-fold reduced excision of 7-methylguanine from methylated calf thymus DNA. Decreased excision of methylated bases by the mutant glycosylase could promote survival at high MMS concentrations, where the capacity of downstream enzymes to process toxic BER intermediates may be saturated. The mutant also displayed 6.6- and 3.0-fold reduced excision of 1,N(6)-ethenoadenine and hypoxanthine from oligonucleotide substrates, respectively, and a 1.7-fold increase in binding to abasic site-containing DNA. Our work provides in vivo evidence for the substrate binding mechanism deduced from crystal structures, illuminates the function of Leu(180) in wild-type human AAG, and is consistent with a role for balanced expression of BER enzymes in damage survival.

P140K-MGMT and G156A-MGMT genes encode two O6-benzylguanine–resistant O6-alkylguanine DNA alkyltransferase proteins that confer a high degree of O6-benzylguanine and 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) or O6-benzylguanine and temozolomide resistance to primary hematopoietic cells. In this study, we directly compared these and three other O6-benzylguanine–resistant MGMT genes for their ability to protect the human erythroleukemia cell line, K562, using a direct competitive selection strategy to identify the mutation that conferred the greatest degree of protection from O6-benzylguanine and either BCNU or temozolomide. MFG retroviral vector plasmids for each of these mutants [G156A-MGMT (ED50 for O6-benzylguanine, 60 μmol/L); and P140K-MGMT, MGMT-2 (S152H, A154G, Y158H, G160S, L162V), MGMT-3 (C150Y, A154G, Y158F, L162P, K165R), and MGMT-5 (N157T, Y158H, A170S; ED50 for benzylguanine, >1,000 μmol/L)] were mixed, and the virus produced from Phoenix cells was transduced into K562 cells. Stringent selection used high doses of O6-benzylguanine (800 μmol/L) and temozolomide (1,000 μmol/L) or BCNU (20 μmol/L) administered twice, and following regrowth, surviving clones were isolated, and the MGMT transgene was sequenced. None of the mutants was lost during selection. Using temozolomide, the enrichment factor was greatest for P140K-MGMT (1.7-fold). Using BCNU selection, the greatest enrichment was observed with MGMT-2 (1.5-fold). G156A-MGMT, which is the least O6-benzylguanine–resistant MGMT gene of the mutants tested, was not lost during selection but was selected against. The optimal mutant MGMT useful as a drug resistance gene may depend on whether a methylating or chloroethylating agent is used for drug selection. [Mol Cancer Ther 2006;5(1):121–8]

Mutations in mitochondrial DNA (mtDNA) are involved in a variety of pathologies, including cancer and neurodegenerative diseases, as well as in aging. mtDNA mutations result predominantly from damage by reactive oxygen species (ROS) that is not repaired prior to replication. Repair of ROS-damaged bases occurs mainly via base excision repair (BER) in mitochondria and nuclei. In nuclear BER, the two penultimate steps are carried out by DNA polymerase-beta (Polbeta), which exhibits both 5'-deoxyribose-5-phosphate (5'-dRP) lyase and DNA polymerase activities. In mitochondria, DNA polymerase-gamma (Polgamma) is believed to be the sole polymerase and is therefore assumed to function in mitochondrial BER. However, a recent report suggested the presence of Polbeta or a "Polbeta-like" enzyme in bovine mitochondria. Consequently, in the present work, we tested the hypothesis that Polbeta is present and functions in mammalian mitochondria. Initially we identified two DNA polymerase activities, one corresponding to Polgamma and the other to Polbeta, in mitochondrial preparations obtained by differential centrifugation and discontinuous sucrose density gradient centrifugation. However, upon further fractionation in linear Percoll gradients, we were able to separate Polbeta from mitochondria and to show that intact mitochondria, identified by electron microscopy, lacked Polbeta activity. In a functional test for the presence of Polbeta function in mitochondria, we used a new assay for detection of random (i.e., non-clonal) mutations in single mtDNA molecules. We did not detect enhanced mutation frequency in mtDNA from Polbeta null cells. In contrast, mtDNA from cells harboring mutations in the Polgamma exonuclease domain that abolish proofreading displayed a >or=17-fold increase in mutation frequency. We conclude that Polbeta is not an essential component of the machinery that maintains mtDNA integrity.

DNA polymerases of the Family A catalyze the addition of deoxynucleotides to a primer with high efficiency, processivity, and selectivity-properties that are critical to their function both in nature and in the laboratory. These polymerases tolerate many amino acid substitutions, even in regions that are evolutionarily conserved. This tolerance can be exploited to create DNA polymerases with novel properties and altered substrate specificities, using rational design and molecular evolution. These efforts have focused mainly on the Family A DNA polymerises -Taq, E. coli Pol I, and T7 - because they are widely utilized in biotechnology today. The redesign of polymerases often requires knowledge of the function of specific residues in the protein, including those located in six evolutionarily conserved regions. The most well characterized of these are motifs A and B, which regulate the fidelity of replication and the incorporation of nucleotide analogs such as dideoxynucleotides. Regions that remain to be more thoroughly characterized are motif C, which is critical for catalysis, and motifs 1, 2 and 6, all of which bind to DNA primer or template. Several recently identified mutants with abilities to incorporate nucleotides with bulky adducts have mutations that are not located within conserved regions and warrant further study. Analysis of these mutants will help advance our understanding of how DNA polymerases select bases with high fidelity.

Hairpin or tetrahelical structures formed by a d(CGG)n sequence in the FMR1 gene are thought to promote expansion of the repeat tract. Subsequent to this expansion FMR1 is silenced and fragile X syndrome ensues. The injurious effects of d(CGG)n secondary structures may potentially be countered by agents that act to decrease their stability. We showed previously that the hnRNP-related protein CBF-A destabilized G′2 bimolecular tetraplex structures of d(CGG)n. Analysis of mutant proteins revealed that the CBF-A-conserved domains RNP11 and ATP/GTP binding box were sufficient and necessary for G′2 d(CGG)n disruption while the RNP21 motif inhibited the destabilization activity. Here, we report that a C-terminal fragment of CBF-A whose only remaining conserved domain was the ATP/GTP binding motif, disrupted G′2 d(CGG)n more selectively than wild-type CBF-A. Further, two additional members of the hnRNP family, hnRNP A2 and mutant hnRNP A1 effectively destabilized G′2 d(CGG)n. Examination of mutant hnRNP A2 proteins revealed that, similar to CBF-A, their RNP11 element and ATP/GTP binding motif mediated G′2 d(CGG)n disruption, while the RNP21 element blocked their action. Similarly, the RNP11 and RNP21 domains of hnRNP A1 were, respectively, positive and negative mediators of G′2 d(CGG)n destabilization. Last, employing the same conserved motifs that mediated disruption of the DNA tetraplex G′2 d(CGG)n, hnRNP A2 destabilized r(CGG)n RNA tetraplex.

Mutagenesis of protein-encoding sequences occurs ubiquitously; it enables evolution, accumulates during aging, and is associated with disease. Many biotechnological methods exploit random mutations to evolve novel proteins. To quantitate protein tolerance to random change, it is vital to understand the probability that a random amino acid replacement will lead to a protein's functional inactivation. We define this probability as the “ x factor.” Here, we develop a broadly applicable approach to calculate x factors and demonstrate this method using the human DNA repair enzyme 3-methyladenine DNA glycosylase (AAG). Three gene-wide mutagenesis libraries were created, each with 10 5 diversity and averaging 2.2, 4.6, and 6.2 random amino acid changes per mutant. After determining the percentage of functional mutants in each library using high-stringency selection (>19,000-fold), the x factor was found to be 34% ± 6%. Remarkably, reanalysis of data from studies of diverse proteins reveals similar inactivation probabilities. To delineate the nature of tolerated amino acid substitutions, we sequenced 244 surviving AAG mutants. The 920 tolerated substitutions were characterized by substitutability index and mapped onto the AAG primary, secondary, and known tertiary structures. Evolutionarily conserved residues show low substitutability indices. In AAG, β strands are on average less substitutable than α helices; and surface loops that are not involved in DNA binding are the most substitutable. Our results are relevant to such diverse topics as applied molecular evolution, the rate of introduction of deleterious alleles into genomes in evolutionary history, and organisms' tolerance of mutational burden.

The Werner syndrome (WS) protein (WRN), a DNA helicase/exonuclease, is required for genomic stability and avoidance of cancer. Current evidence suggests that WRN is involved in the resolution of stalled and/or collapsed replication forks. This function is indicated, in part, by replication defects in WS cells and by hypersensitivity to agents causing major structural aberrations in DNA that block replication. We show here that antisense suppression of WRN in two human glioma cell lines reproduces hallmarks of the drug cytotoxicity profile of WS cells, namely, hypersensitivity to 4-nitroquinoline 1-oxide, camptothecin and hydroxyurea. We also show that antisense-treated cells are hypersensitive to methyl-lexitropsin, a site-specific alkylating agent that produces mainly N3-methyladenine, a cytotoxic and replication-blocking lesion. Antisense-treated cells are hypersensitive to O(6)-methylguanine adducts as well, but only when repair by O(6)-methylguanine-DNA methyltransferase is lacking. Our results illustrate the drug sensitivity caused by deficiency of WRN in a uniform genetic background. They extend the WRN DNA damage sensitivity spectrum to methyl base adducts that can result in blocked replication, and suggest that WRN may be required for resumption of processive replication when incomplete repair of DNA damage leaves blocking lesions at forks. The evidence that highly disparate lesions fall within the purview of WRN, and that abrogating DNA repair can reveal dependence on WRN, suggests that WRN may protect the genome from the lethal, mutagenic and carcinogenic effects of widely diverse DNA damage arising from endogenous processes and environmental agents.

Recent crystallographic studies reveal loops in human AP endonuclease 1 (APE1) that interact with the major and minor grooves of DNA containing apurinic/apyrimidinic (AP) sites. These loops are postulated to stabilize the DNA helix and the flipped out AP residue. The loop alpha8 interacts with the major groove on the 3' side of the AP site. To determine the essentiality of the amino acids that constitute the alpha8 loop, we created a mutant library containing random nucleotides at codons 222-229 that, in wild-type APE1, specify the sequence NPKGNKKN. Upon expression of the library (2 x 10(6) different clones) in Escherichia coli and multiple rounds of selection with the alkylating agent methyl-methane sulfonate (MMS), we obtained approximately 2 x 10(5) active mutants that complemented the MMS sensitivity of AP endonuclease-deficient E. coli. DNA sequencing showed that active mutants tolerated amino acid substitutions at all eight randomized positions. Basic and uncharged polar amino acids together comprised the majority of substitutions, reflecting the positively charged, polar character of the wild-type loop. Asn-222, Asn-226, and Asn-229 exhibited the least mutability, consistent with x-ray data showing that each asparagine contacts a DNA phosphate. Substitutions at residues 226-229, located nearer to the AP site, that reduced basicity or hydrogen bonding potential, increased Km 2- to 6-fold and decreased AP site binding; substitutions at residues 222-225 exhibited lesser effects. This initial mutational analysis of the alpha8 loop supports and extends the conclusion of crystallographic studies that the loop is important for binding of AP.DNA and AP site incision.

Mutations in DNA accrue relentlessly, largely via stochastic processes. Random changes accumulate, eventually disabling genetic components which result in the formation of the cancer phenotype. Given the infrequency of measured nucleotide changes and the requirement for several mutations to occur in the same cell, it has been postulated that the rate of mutation must become elevated early in the course of evolution of the cancer. Recently, large scale sequencing of tumor DNA has sought to directly measure random mutations. We discuss the implications of these findings and the factors that must be considered in order for fruitful determination of whether a mutator phenotype is a necessary precursor for cancer.

Translesion (TLS) DNA polymerases are specialized, error-prone enzymes that synthesize DNA across bulky, replication-stalling DNA adducts. In so doing, they facilitate the progression of DNA synthesis and promote cell proliferation. To potentiate the effect of cancer chemotherapeutic regimens, we sought to identify inhibitors of TLS DNA polymerases. We screened five libraries of ∼ 3000 small molecules, including one comprising ∼ 600 nucleoside analogs, for their effect on primer extension activity of DNA polymerase η (Pol η). We serendipitously identified sphingosine, a lipid-signaling molecule that robustly stimulates the activity of Pol η by ∼ 100-fold at low micromolar concentrations but inhibits it at higher concentrations. This effect is specific to the Y-family DNA polymerases, Pols η, κ, and ι. The addition of a single phosphate group on sphingosine completely abrogates this effect. Likewise, the inclusion of other sphingolipids, including ceramide and sphingomyelin to extension reactions does not elicit this response. Sphingosine increases the rate of correct and incorrect nucleotide incorporation while having no effect on polymerase processivity. Endogenous Pol η activity is modulated similarly as the recombinant enzyme. Importantly, sphingosine-treated cells exhibit increased lesion bypass activity, and sphingosine tethered to membrane lipids mimics the effects of free sphingosine. Our studies have uncovered sphingosine as a modulator of TLS DNA polymerase activity; this property of sphingosine may be associated with its known role as a signaling molecule in regulating cell proliferation in response to cellular stress.

Nucleotide excision repair (NER) excises bulky DNA lesions induced by mutagens and carcinogens. The repair process includes recognition of DNA damage, excision of a short patch of nucleotides containing the damaged base, re-synthesis of a new DNA strand and ligation of the nicks to restore the sequence integrity. Mutation or aberrant transcription of NER genes reduces repair efficiency and results in the accumulation of mutations that is associated with the development of cancer. Here we present a rapid, sensitive and quantitative assay to measure NER activity in human cells, which we term the Oligonucleotide Retrieval Assay (ORA). We used oligonucleotide constructs containing the UV-damaged adduct, cyclobutane pyrimidine dimer (CPD), to transfect human cells, and retrieved the oligonucleotides for quantification of the repaired, CPD-free DNA by real-time quantitative PCR. We demonstrate that ORA can quantify the extent of NER in diverse cell types, including immortalized, primary and stem-like cells.

Human DNA polymerase eta (hPol eta) is one of the newly identified Y-family of DNA polymerases. These polymerases synthesize past template lesions that are postulated to block replication fork progression. hPol eta accurately bypasses UV-associated cis-syn cyclobutane thymine dimers in vitro and contributes to normal resistance to sunlight-induced skin cancer. We describe here mutational analysis of motif II, a highly conserved sequence, recently reported to reside in the fingers domain and to form part of the active site in Y-family DNA polymerases. We used a yeast-based complementation system to isolate biologically active mutants created by random sequence mutagenesis, synthesized the mutant proteins in vitro and assessed their ability to bypass thymine dimers. The mutability of motif II in 210 active mutants has parallels with natural evolution and identifies Tyr52 and Ala54 as prime candidates for involvement in catalytic activity or bypass. We describe the ability of hPol eta S62G, a mutant polymerase with enhanced activity, to bypass five other site-specific lesions. Our results may serve as a prototype for studying other members of the Y-family DNA polymerases.

DNA polymerases play a central role in maintenance of genetic information, and the structures of polymerases in complex with DNA and dNTP provide valuable insights into mechanisms utilized by DNA polymerases to achieve high fidelity. Comparison of several high resolution complexes of DNA polymerases bound with relevant substrates indicates that the two major families of polymerases function by very similar mechanisms.

DNA and RNA polymerase exhibit similarities in structures and catalytic mechanisms, suggesting that both classes of enzymes are evolutionarily related. To probe the biochemical and structure-function relationship between the two classes of polymerases, a large library (200,000 members) of mutant Thermus aquaticus DNA polymerase I (Taq pol I) was created containing random substitutions within a portion of the dNTP binding site (motif A; amino acids 605-617), and a fraction of all selected active Taq pol I (291 of 8000) was tested for the ability to incorporate successive ribonucleotides; 23 unique mutants that added rNTPs into a growing polynucleotide chain were identified and sequenced. These mutants, each containing one to four substitutions, incorporate ribonucleotides at a efficiency approaching 10(3)-fold greater than that of wild type Taq pol I. Several mutants added successive ribonucleotides and thus can catalyze the synthesis of RNA. Sequence analysis of these mutants demonstrates that at least two amino acid residues are involved in excluding ribonucleotides from the active site. Interestingly, wild type DNA polymerases from several distinct families selectively discriminate against rUTP. This study suggests that current DNA and RNA polymerases could have evolved by divergent evolution from an ancestor that shared a common mechanism for polynucleotide synthesis.

Hairpin and tetrahelical structures of a d(CGG)(n) sequence in the FMR1 gene have been implicated in its expansion in fragile X syndrome. The identification of tetraplex d(CGG)(n) destabilizing proteins (Fry, M., and Loeb, L. A.(1999) J. Biol. Chem. 274, 12797-12803; Weisman-Shomer, P., Naot, Y., and Fry, M. (2000) J. Biol. Chem. 275, 2231-2238) suggested that proteins might modulate d(CGG)(n) folding and aggregation. We assayed human TK-6 lymphoblastoid cell extracts for d(CGG)(8) oligomer binding proteins. The principal binding protein was identified as Ku antigen by its partial amino acid sequence and antigenicity. The purified 88/75-kDa heterodimeric Ku bound with similar affinities (K(d) approximately 1. 8-10.2 x 10(-9) mol/liter) to double-stranded d(CGG)(8).d(CCG)(8), hairpin d(CGG)(8), single-stranded d(CII)(8), or tetraplex structures of telomeric or IgG switch region sequences. However, Ku associated more tightly with bimolecular G'2 tetraplex d(CGG)(8) (K(d) approximately 0.35 x 10(-9) mol/liter). Binding to Ku protected G'2 d(CGG)(8) against nuclease digestion and impeded its unwinding by the tetraplex destabilizing protein qTBP42. Stabilization of d(CGG)(n) tetraplex domains in FMR1 by Ku or other proteins might promote d(CGG) expansion and FMR1 silencing.

Damage to DNA by reactive oxygen species may be a significant source of endogenous mutagenesis in aerobic organisms. Using a selective assay for microsatellite instability in E. coli, we have asked whether endogenous oxidative mutagenesis can contribute to genetic instability. Instability of repetitive sequences, both in intronic sequences and within coding regions, is a hallmark of genetic instability in human cancers. We demonstrate that exposure of E. coli to low levels of hydrogen peroxide increases the frequency of expansions and deletions within dinucleotide repetitive sequences. Sequencing of the repetitive sequences and flanking non-repetitive regions in mutant clones demonstrated the high specificity for alterations with the repeats. All of the 183 mutants sequenced displayed frameshift alterations within the microsatellite repeats, and no base substitutions or frameshift mutations occurred within the flanking non-repetitive sequences. We hypothesize that endogenous oxidative damage to DNA can increase the frequency of strand slippage intermediates occurring during DNA replication or repair synthesis, and contribute to genomic instability.

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.

The human immunodeficiency virus (HIV) replicates its genome and mutates at exceptionally high rates. As a result, the virus is able to evade immunological and chemical antiviral agents. We tested the hypothesis that a further increase in the mutation rate by promutagenic nucleoside analogs would abolish viral replication. We evaluated deoxynucleoside analogs for lack of toxicity to human cells, incorporation by HIV reverse transcriptase, resistance to repair when incorporated into the DNA strand of an RNA⋅DNA hybrid, and mispairing at high frequency. Among the candidates tested, 5-hydroxydeoxycytidine (5-OH-dC) fulfilled these criteria. In seven of nine experiments, the presence of this analog resulted in the loss of viral replicative potential after 9–24 sequential passages of HIV in human CEM cells. In contrast, loss of viral replication was not observed in 28 control cultures passaged in the absence of the nucleoside analog, nor with other analogs tested. Sequence analysis of a portion of the HIV reverse transcriptase gene demonstrated a disproportionate increase in G → A substitutions, mutations predicted to result from misincorporation of 5-OH-dC into the cDNA during reverse transcription. Thus, “lethal mutagenesis” driven by the class of deoxynucleoside analogs represented by 5-OH-dC could provide a new approach to treating HIV infections and, potentially, other viral infections.

Werner Syndrome (WS) is a human progeroid disorder characterized by genomic instability. The gene defective in WS encodes a 3′ → 5′ DNA helicase (Gray, M. D., Shen, J.-C., Kamath-Loeb, A. S., Blank, A., Sopher, B. L., Martin, G. M., Oshima, J., and Loeb, L. A.(1997) Nat. Genet. 17, 100–103). Sequence alignment analysis identified an N-terminal motif in WRN that is homologous to several exonucleases. Using combined molecular genetic, biochemical, and immunochemical approaches, we demonstrate that WRN also exhibits an integral DNA exonuclease activity. First, whereas wild-type recombinant WRN possesses both helicase and exonuclease activities, mutant WRN lacking the nuclease domain does not display exonucleolytic activity. In contrast, WRN proteins with defective helicase activity are active in exonucleolytic digestion of DNA. Second, the exonuclease co-purifies with the 160-kDa WRN protein and its associated DNA helicase and ATPase activities through successive steps of ion exchange and affinity chromatography, suggesting that all three activities are physically associated. Lastly, anti-WRN antiserum specifically co-precipitates the WRN helicase and exonuclease activities indicating that both activities reside on the same antigenic WRN polypeptide. The association of an exonuclease with WRN distinguishes it from other RecQ homologs and raises the possibility that the distinct phenotypic characteristics of WS may be due in part to a defective exonuclease.

We have used random sequence mutagenesis and complementation in a bacterial selection system to establish a large library of immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) mutants with amino acid substitutions in the beta3-beta4 region of the fingers subdomain [Kim, B., Hathaway, T. R., and Loeb, L. A. (1996) J. Biol. Chem. 271, 4872-4878]. We show here that one of these mutants, D76V, exhibits increased accuracy of copying both DNA and RNA templates in a primer extension assay with biased dNTP pools. More detailed analysis of DNA-dependent polymerization showed that the D76V mutation conferred an up to 14-fold increase in fidelity of nucleotide insertion and a 9-fold reduced mutation rate in an M13mp2 lacZalpha forward mutation assay. Substitution at D76 with positively charged (D76R) and nonpolar (D76V and D76I) residues increased replicational accuracy, while substitutions with negatively charged (D76E) and polar residues (D76S and D76C) had little effect on fidelity. We propose that D76 affects replicational accuracy by mediating interaction between the fingers subdomain and the single-stranded template. Our work shows that the Escherichia coli complementation system can yield HIV RT mutants with increased fidelity that have not been isolated from the natural host and that are valuable in understanding the molecular bases of replicational accuracy.

Deregulation of DNA repair enzymes occurs in cancers and may create a susceptibility to chemotherapy. Expression levels of DNA repair enzymes have been shown to predict the responsiveness of cancers to certain chemotherapeutic agents. The RECQ helicases repair damaged DNA including damage caused by topoisomerase I inhibitors, such as irinotecan. Altered expression levels of these enzymes in colorectal cancer (CRC) may influence the response of the cancers to irinotecan. Thus, we assessed RECQ helicase (WRN, BLM, RECQL, RECQL4, and RECQL5) expression in primary CRCs, matched normal colon, and CRC cell lines. We found that BLM and RECQL4 mRNA levels are significantly increased in CRC (P = .0011 and P < .0001, respectively), whereas RECQL and RECQL5 are significantly decreased (P = .0103 and P = .0029, respectively). RECQ helicase expression patterns varied between specific molecular subtypes of CRCs. The mRNA and protein expression of the majority of the RECQ helicases was closely correlated, suggesting that altered mRNA expression is the predominant mechanism for deregulated RECQ helicase expression. Immunohistochemistry localized the RECQ helicases to the nucleus. RECQ helicase expression is altered in CRC, suggesting that RECQ helicase expression has potential to identify CRCs that are susceptible to specific chemotherapeutic agents.

We describe catalytically active mutants of HIV RT (human immunodeficiency virus reverse transcriptase) generated by random sequence mutagenesis and selected in Escherichia coli for ability to complement the temperature-sensitive phenotype of a DNA polymerase I (Pol I) mutant. We targeted amino acids Asp-67 through Arg-78 in HIV RT, which form part of the β3-β4 flexible loop and harbor many of the currently known mutations that confer resistance to nucleoside analogs. DNA sequencing of 109 selected mutants that complement the Pol I phenotype revealed substitutions at all 12 residues targeted, indicating that none of the wild-type amino acids is essential. However, single mutations were not observed at Trp-71, Arg-72, and Arg-78, consistent with evolutionary conservation of these residues among viral RTs and lack of variation at these positions among isolates from patients. The mutations we recovered included most of those associated with drug resistance as well as previously unidentified mutations. Purification and assay of 14 mutant proteins revealed correlation between their DNA-dependent DNA polymerize activity in vitro and ability to complement the Pol I phenotype. Activity of several mutants was resistant to 3′-azidothymidine triphosphate. We conclude that random sequence mutagenesis coupled with positive genetic selection in E. coli yields large numbers of functional HIV RT mutants. Among these are less active variants which are unlikely to be isolated from HIV-infected individuals and which will be informative of the roles of individual amino acids in the catalytic functions of the enzyme.

DNA polymerase δ (Pol δ) is one of the major replicative DNA polymerases in eukaryotic cells, catalyzing lagging strand synthesis as well as playing a role in many DNA repair pathways. The catalytic site for polymerization consists of a palm domain and mobile fingers domain that opens and closes each catalytic cycle. We explored the effect of amino acid substitutions in a region of the highly conserved sequence motif B in the fingers domain on replication fidelity. A novel substitution, A699Q, results in a marked increase in mutation rate at the yeast CAN1 locus, and is synthetic lethal with both proofreading deficiency and mismatch repair deficiency. Modeling the A699Q mutation onto the crystal structure of Saccharomyces cerevisiae Pol δ template reveals four potential contacts for A699Q but not for A699. We substituted alanine for each of these residues and determined that an interaction with multiple residues of the N-terminal domain is responsible for the mutator phenotype. The corresponding mutation in purified human Pol δ results in a similar 30-fold increase in mutation frequency when copying gapped DNA templates. Sequence analysis indicates that the most characteristic mutation is a guanine-to-adenine (G to A) transition. The increase in deoxythymidine 5′-triphosphate-G mispairs was confirmed by performing steady state single nucleotide addition studies. Our combined data support a model in which the Ala-to-Gln substitution in the fingers domain of Pol δ results in an interaction with the N-terminal domain that affects the base selectivity of the enzyme.

Background: Ponatinib is a tyrosine kinase inhibitor (TKI) with potent activity against BCR-ABL1 and all single resistance mutants. In the Phase 2 PACE study (NCT01207440), ponatinib induced high rates of major hematological response (MaHR) and major cytogenetic response (MCyR) in BP-CML (31% and 23%) and Ph+ ALL (41% and 47%) patients (pts), even though 91% of pts had received at least 2 prior TKIs. However, the median progression free survival was only 4 months for BP-CML and 3 months for Ph+ ALL (Cortes JE, et al. N Engl J Med 2013). Previous studies have shown that certain compound mutations can cause resistance to ponatinib (Zabriskie et al. Cancer Cell 2014), but such mutations were found to be extremely rare in CP-CML pts from the PACE trial despite being heavily pre-treated (Deininger MW, et al. Blood 2016). Here we utilize a multi-level sequencing strategy that combines Sanger Sequencing (SS), Next Generation Sequencing (NGS), and single molecule Duplex Sequencing (DS), which is orders of magnitude more sensitive than NGS, to profile the mutational mechanisms that may account for the survival outcomes observed in BP-CML/Ph+ ALL pts treated with ponatinib in PACE. Methods: The BCR-ABL1 mutation status of the 267 CP-CML, 62 BP-CML, and 32 Ph+ ALL pts treated in the PACE trial was examined using SS and/or NGS as described previously (Cortes JE, et al. N Engl J Med 2013; Deininger MW, et al. Blood 2016). Mutations detected by SS at the end of treatment (EOT) but not at baseline (BL) were considered to have been gained during ponatinib treatment. DS was performed to determine whether mutations gained on treatment could be found in small sub-populations of cells at BL and to provide a direct measurement of the mutation burden in the ABL1 gene. Two distinct mathematical models were used to predict the size of pre-existing resistant sub-populations in BP-CML/Ph+ ALL pts based on the overall ABL1 mutation burden and the doubling time of clonal outgrowth. Results: The number of BCR-ABL1 mutations in BP-CML/Ph+ ALL patients at BL, as detected by SS, was not a significant predictor of intrinsic resistance to ponatinib in refractory patients with Odds Ratios (OR) of 1.0 (0.2-4.9 95% CI) for MaHR and 2.4 (0.5-12.5 95% CI) for MCyR. However, a larger proportion of BP-CML/Ph+ ALL pts, 30/61, acquired mutations in BCR-ABL1 at EOT vs. 19/130 CP-CML pts (p Conclusions: Clonal BL BCR-ABL1 mutation status determined by SS does not predict intrinsic resistance to ponatinib. However, in contrast to CP-CML, BP-CML/Ph+ ALL pts are more likely to relapse on ponatinib with acquired mutations in BCR-ABL1. Two distinct mathematical modeling strategies suggest that most, if not all, BCR-ABL1 resistance mutations in BP-CML/Ph+ ALL pts that emerge during ponatinib treatment were pre-existing. The majority of these pre-existing mutations were compound mutations whose evolutionary path was likely determined by prior TKI therapy. These findings emphasize the risk of the large population expansions that occur following prior TKI treatment failure and may explain the relatively high 2-yr event free survival rate of 81% observed in previously untreated Ph+ ALL pts treated with ponatinib (+hyper-CVAD) (Jabbour E, et al. Lancet Oncol 2015, Sasaki, et al. Cancer 2016). Study sponsor: ARIAD Pharmaceuticals, Inc. Disclosures Pritchard: ARIAD: Employment, Equity Ownership. Schmitt:TwinStrand: Equity Ownership. Hodgson:ARIAD: Employment, Equity Ownership. Lustgarten:ARIAD: Employment, Equity Ownership. Tang:ARIAD: Employment, Equity Ownership. Loeb:TwinStrand: Equity Ownership. Radich:Novartis: Consultancy, Other: laboratory contract; Bristol-MyersSquibb: Consultancy; Pfizer: Consultancy; ARIAD: Consultancy; TwinStrand: Consultancy. Rivera:ARIAD: Employment, Equity Ownership.

Human immunodeficiency virus (HIV) reverse transcriptase substitutes for temperature-sensitive DNA polymerase I (Pol Its) in Escherichia coli, providing a screen for anti-HIV reverse transcriptase nucleoside analogs in bacteria. Since phosphorylation of nucleosides in E. coli is limited to thymidine and its derivatives, we coexpressed herpes simplex virus thymidine kinase, an enzyme that phosphorylates a wide variety of nucleoside analogs, together with HIV reverse transcriptase. Coexpression of herpes simplex virus thymidine kinase and HIV reverse transcriptase rendered Pol Its cells sensitive to dideoxycytidine. Studies with different nucleoside analogs indicate that this bacterial screening system is able to select and identify nucleoside analogs that specifically target HIV reverse transcriptase.

The extent of heterogeneity in DNA sequence within human cancers has been difficult to fully assess, due to the absence of methods with sufficient sensitivity to detect minority variants. For example, next-generation sequencing could in principle detect sub-clonal mutations at any genomic position; however due to amplification errors and inaccuracies in the sequencing platform itself, such approaches are limited to detection of mutations present in >1% of cells. We have overcome this limitation by developing an approach, Duplex Sequencing, which improves the accuracy of next-generation sequencing by >100,000 fold. Duplex Sequencing is based upon separately tagging and sequencing the two strands of single molecules of duplex DNA. True mutations are present at the same position in both DNA strands and are complementary, whereas artifacts arising from amplification or sequencing errors are seen in only one strand. The calculated error rate of our approach is less than one artifactual mutation per billion nucleotides sequenced (ref. 1). We have also developed an enrichment approach based on sequential rounds of hybridization to biotinylated probes which enables efficient sequencing of targeted regions of the genome (ref. 2). Duplex Sequencing thereby enables exceptionally sensitive detection of sequence heterogeneity within any set of genes. We have now applied Duplex Sequencing to study of sequence heterogeneity in both normal and malignant samples. In acute myeloid leukemia (AML), we find multiple sub-clonal mutations which fall below the detection limit of conventional approaches, some of which encode mutations that can drive chemotherapy resistance and cancer progression. Our results indicate that prior studies have under-estimated the burden of sub-clonal mutations in AML by more than 1,000-fold. We have additionally studied chronic myeloid leukemia (CML); treatment of CML with inhibitors directed against the Abl kinase represents the prototypical targeted cancer therapy. With Duplex Sequencing, we find that Abl mutations are extremely uncommon at the time of CML diagnosis. In contrast, refractory patients who fail therapy frequently possess multiple sub-clonal mutations within the Abl kinase, most of which are below the resolution of conventional approaches but are readily detected with our method. In ongoing work, we have found multiple sub-clonal mutations within human prostate cancer and colon cancer, suggestive of widespread intratumor heterogeneity that may limit the efficacy of single-agent therapy in these diseases. References: 1. Schmitt MW, Kennedy SR, Salk JJ, Fox EJ, Hiatt JB, Loeb LA (2012). Detection of ultra-rare mutations by next-generation sequencing. Proceedings of the National Academy of Sciences USA. 109(36):14508-13. 2. Schmitt MW, Fox EJ, Prindle MJ, Reid-Bayliss KS, True LD, Radich JP, Loeb LA (2015). Sequencing small genomic targets with high efficiency and extreme accuracy. Nature Methods. 12(5):423-5. Citation Format: Michael W. Schmitt, Jesse J. Salk, Edward J. Fox, Justin R. Pritchard, J Graeme Hodgson, Victor M. Rivera, Pamela S. Becker, Jerald P. Radich, Lawrence A. Loeb. Direct assessment of sequence heterogeneity in human cancers by Duplex Sequencing. [abstract]. In: Proceedings of the 107th Annual Meeting of the American Association for Cancer Research; 2016 Apr 16-20; New Orleans, LA. Philadelphia (PA): AACR; Cancer Res 2016;76(14 Suppl):Abstract nr 2395.

We present evidence that DNA polymerase delta of Saccharomyces cerevisiae, an enzyme that is essential for viability and chromosomal replication, is also required for base excision repair of exogenous DNA methylation damage. The large catalytic subunit of DNA polymerase delta is encoded by the CDC2(POL3) gene. We find that the mutant allele cdc2-2 confers sensitivity to killing by methyl methanesulfonate (MMS) but allows wild-type levels of UV survival. MMS survival of haploid cdc2-2 strains is lower than wild type at the permissive growth temperature of 20 degrees C. Survival is further decreased relative to wild type by treatment with MMS at 36 degrees C, a nonpermissive temperature for growth of mutant cells. A second DNA polymerase delta allele, cdc2-1, also confers a temperature-sensitive defect in MMS survival while allowing nearly wild-type levels of UV survival. These observations provide an in vivo genetic demonstration that a specific eukaryotic DNA polymerase is required for survival of exogenous methylation damage. MMS sensitivity of a cdc2-2 mutant at 20 degrees C is complemented by expression of mammalian DNA polymerase beta, an enzyme that fills single-strand gaps in duplex DNA in vitro and whose only known catalytic activity is polymerization of deoxyribonucleotides. We conclude, therefore, that the MMS survival deficit in cdc2-2 cells is caused by failure of mutant DNA polymerase delta to fill single-strand gaps arising in base excision repair of methylation damage. We discuss our results in light of current concepts of the physiologic roles of DNA polymerases delta and epsilon in DNA replication and repair.

The fragile X mental retardation syndrome is associated with the expansion of trinucleotide 5'-d(CGG)-3' repeats within the FMR1 gene and with hypermethylation of the cytosine residues of these repeats. The expansion and hypermethylation may account for the suppression of the transcription of the FMR1 gene and for the delay of its replication during the cell cycle. Here we show that d(CGG)n oligomers can form a stable Hoogsteen-bonded structure that exhibits properties consistent with those of tetraplex DNA. Oligomers, d(mCGG)n, (n = 4, 5, or 7), at pH 8.0 and in the presence of an alkali metal ion form stable species exhibiting a reduced electrophoretic mobility in nondenaturing polyacrylamide gels. These species are denatured by heating at 90 degrees C for 10 min. With a short d(mCGG)5 oligomer, the slowly migrating species is formed only when the cytosine residue is 5-methylated, whereas with the longer d(CGG)7 it is generated whether or not cytosine is 5-methylated. By contrast, complementary cytosine-rich oligomers do not form analogous complexes. The second-order association kinetics of the formation of the slowly migrating species of d(mCGG)5 suggests that it is an interstrand complex. Formation of intermediate-size complexes between d(mCGG)5 and d(mCGG)7 indicates that the stoichiometry of the slowly migrating structures is tetramolecular. Protection of the complex from methylation by dimethyl sulfate indicates the involvement of the N-7 positions of the guanine residues in Hoogsteen hydrogen bonding, a characteristic of quadruplex structures. If formed in vivo along the expanded and hypermethylated d(mCGG)n stretch, this tetraplex structure could suppress transcription and replication of the FMR1 gene in the fragile X syndrome cells.

The deoxycytidine analog KP1212, and its prodrug KP1461, are prototypes of a new class of antiretroviral drugs designed to increase viral mutation rates, with the goal of eventually causing the collapse of the viral population. Here we present an extensive analysis of viral sequences from HIV-1 infected volunteers from the first “mechanism validation” phase II clinical trial of a mutagenic base analog in which individuals previously treated with antiviral drugs received 1600 mg of KP1461 twice per day for 124 days. Plasma viral loads were not reduced, and overall levels of viral mutation were not increased during this short-term study, however, the mutation spectrum of HIV was altered. A large number (N = 105 per sample) of sequences were analyzed, each derived from individual HIV-1 RNA templates, after 0, 56 and 124 days of therapy from 10 treated and 10 untreated control individuals (>7.1 million base pairs of unique viral templates were sequenced). We found that private mutations, those not found in more than one viral sequence and likely to have occurred in the most recent rounds of replication, increased in treated individuals relative to controls after 56 (p = 0.038) and 124 (p = 0.002) days of drug treatment. The spectrum of mutations observed in the treated group showed an excess of A to G and G to A mutations (p = 0.01), and to a lesser extent T to C and C to T mutations (p = 0.09), as predicted by the mechanism of action of the drug. These results validate the proposed mechanism of action in humans and should spur development of this novel antiretroviral approach., Koronis Pharmaceuticals

Human alkyladenine DNA glycosylase (hAAG) excises alkylated purines, hypoxanthine, and etheno bases from DNA to form abasic (AP) sites. Surprisingly, elevated expression of hAAG increases spontaneous frameshift mutagenesis. By random mutagenesis of eight active site residues, we isolated hAAG-Y127I/H136L double mutant that induces even higher rates of frameshift mutation than does the wild-type hAAG; the Y127I mutation accounts for the majority of the hAAG-Y127I/H136L-induced mutator phenotype. The hAAG-Y127I/H136L and hAAG-Y127I mutants increased the rate of spontaneous frameshifts by up to 120-fold in S. cerevisiae and also induced high rates of microsatellite instability (MSI) in human cells. hAAG and its mutants bind DNA containing one and two base-pair loops with significant affinity, thus shielding them from mismatch repair; the strength of such binding correlates with their ability to induce the mutator phenotype. This study provides important insights into the mechanism of hAAG-induced genomic instability.

The usefulness of conducting DNA damage and repair studies in a postmitotic tissue like brain is emphasized. We review studies that use brain as a tissue to test the validity of the DNA damage and repair hypothesis of aging. As far as the accumulation of age dependent DNA damage is concerned, the data appear to overwhelmingly support the hypothesis. However, attempts to demonstrate a decline in DNA repair capacity as a function of age are conflicting and equally divided. Possible reasons for this discrepancy are discussed. It is suggested that assessment of the repair capacity of neurons with respect to a specific type of damage in a specific gene might yield more definite answers regarding the role of DNA repair potential in the aging process and as a longevity assurance system.

Reactive oxygen species are generated by a variety of cellular processes. These endogenously generated, reactive intermediates produce a multiplicity of DNA alterations and mutations and have been implicated in the pathogenesis of several human diseases. We report here that treatment of single-stranded M13mp2 bacteriophage DNA with methylene blue and white light generates increased levels of 8-hydroxydeoxyguanosine and that mutagenesis is both highly specific and dependent on the SOS response. Lesions produced block the progression of DNA synthesis one base preceding template guanines. In SOS-induced Escherichia coli, 97% of all methylene blue-induced mutations in the lacZ alpha gene of M13mp2 DNA are single-base substitutions opposite template guanines. The most frequent mutations are G----C transversions. The G----T transversions expected from the presence of 8-hydroxydeoxyguanosine in the template strand occur, but at a lower frequency. Sequence data together with SOS dependency and the presence of replication blockage demonstrate that while 8-hydroxydeoxyguanosine may serve as an important marker to monitor oxygen-induced DNA damage in humans, it does not account for either the observed blockage to replication or the mutagenesis by methylene blue plus light in SOS-induced E. coli. Instead, an as yet unidentified lesion generated by active oxygen species is a more potent mutagenic event.

The extraordinarily high mutation rate of HIV suggests that the viral population exists near the threshold for viral viability. An increase in mutation could mediate a lethal increase in the already high proportion of defective viruses. We initially tested this hypothesis by culturing HIV-infected cells in mutagenic deoxyribonucleoside analogs. In the presence of 5-hydroxydeoxycytidine, there was a loss of viral replication after sequential passages of HIV in human CEM cells (Loeb LA, et al.: Proc Natl Acad Sci USA 1999;96:14921497). We now propose to use mutagenic ribonucleosides to induce lethal mutagenesis. The incorporation of mutagenic analogs into the HIV genome by the host cell RNA polymerase, rather than by the viral reverse transcriptase, augurs well for the avoidance of resistant viruses.

Vinyl chloride is a known human and rodent carcinogen that forms several cyclic base derivatives in DNA. The mutagenic potential of these derivatives has been examined in vitro but not in vivo. One of these derivatives, N2,3-ethenoguanine (epsilon G), is known to base pair with both cytosine and thymine during in vitro DNA synthesis, which would result in G----A transitions. To determine the base pairing specificity of this labile guanine derivative in Escherichia coli, we have developed a genetic reversion assay for guanine derivatives. The assay utilizes DNA polymerase-mediated analogue insertion into a bacteriophage vector, M13G*1, which detects all single-base substitutions at position 141 of the lacZ alpha gene by change in plaque color. After the insertion of a single epsilon G opposite the template cytosine at position 141 by use of epsilon dGTP and DNA polymerase and further extension with all four normal dNTPs, the DNA was transfected into E. coli. Transfection of M13G*1 containing epsilon G at the target site yielded 135 mutants among 26,500 plaques, 134 of which represented G----A transitions. The uncorrected mutation frequency was 0.5%, as compared with the control value, approximately 0.02%; when corrected for epsilon G content and penetrance, the calculated mutagenic potential of epsilon G (mutations/analogue) was about 13%. We thus conclude that epsilon G specifically induces G----A transitions during DNA replication in E. coli. The M13G*1 assay may permit the testing of other labile guanine derivatives not otherwise amenable to mutagenesis studies.

The ability of metal ions to damage DNA and cause mutagenesis has been analyzed with reversion and forward mutation assays using single-stranded DNA templates. We previously reported that incubation of phi X174 am3 DNA with Fe2+ in vitro results in mutagenesis when the treated DNA is transfected into Escherichia coli spheroplasts (Loeb, L. A., James, E. A., Waltersdorph, A. M., and Klebanoff, S. J. (1988) Proc. Natl. Acad. Sci. U.S.A. 85, 3918-3922, 1988). We now extend these studies to other metal ions. Of the metal ions tested, copper ions were the most mutagenic; the frequency of mutants produced was equal to or greater than that produced by Fe2+. Mutagenesis by Cu+ was diminished by catalase, mannitol, and superoxide dismutase suggesting the involvement of H2O2, hydroxyl ions, and superoxide, respectively. However, the findings that Cu+ and Cu2+ are nearly equally mutagenic and that the mutagenic activities are not completely inhibited by oxygen free radical scavengers make it unlikely that the mechanism for mutagenesis is simply the production of hydroxyl free radicals. The spectra of mutations produced by either copper ion using the lacZ gene as a target are very similar and differ from those reported with other agents. The predominant mutagenic sequence changes are single-base substitutions, the most frequent being replacement of a template C by a T. This transition presumably results from mispairing of an altered C with deoxyadenosine. Copper-induced mutations are not randomly distributed. Instead, they are found predominantly in clusters suggesting direct interaction of copper ions with specific nucleotide sequences in DNA. Evidence is considered that the high frequency of C—-T transitions may be a common manifestation of DNA damage by oxygen radicals.

We have constructed a series of mutants within the putative nucleoside-binding site of the herpes simplex type-1 virus (HSV-1) thymidine kinase (TK)-encoding gene ( tk ), contained within an expression vector. While most mutations within this sequence produce an inactive protein, we find no absolute requirement for the wild-type He 166 and Ala 167 . The uptake of thymidine (dT) into Escherichia coli tdk − , lacking functional endogenous TK activity, is proportional to the amount of TK activity expressed from the heterologous HSV-1 tk gene. In contrast, there is no enhancement in deoxycytidine uptake into E. coli producing (HSV-1) TK. These results imply a specific role for TK in the active transport of dT into E. coli .

Mitochondrial DNA (mtDNA) mutations contribute to the pathology of a number of age-related disorders, including Parkinson disease [A. Bender et al., Nat. Genet. 38 (2006) 515,Y. Kraytsberg et al., Nat. Genet. 38 (2006) 518], muscle-wasting [J. Wanagat, Z. Cao, P. Pathare, J.M. Aiken, FASEB J. 15 (2001) 322], and the metastatic potential of cancers [K. Ishikawa et al., Science 320 (2008) 661]. The impact of mitochondrial DNA mutations on a wide variety of human diseases has made it increasingly important to understand the mechanisms that drive mitochondrial mutagenesis. In order to provide new insight into the etiology and natural history of mtDNA mutations, we have developed an assay that can detect mitochondrial mutations in a variety of tissues and experimental settings [M. Vermulst et al., Nat. Genet. 40 (2008) 4, M. Vermulst et al., Nat. Genet. 39 (2007) 540]. This methodology, termed the Random Mutation Capture assay, relies on single-molecule amplification to detect rare mutations among millions of wild-type bases [J.H. Bielas, L.A. Loeb, Nat. Methods 2 (2005) 285], and can be used to analyze mitochondrial mutagenesis to a single base pair level in mammals.

Werner syndrome (WS) is characterized by premature onset of age-associated disorders and predisposition to cancer. The WS protein, WRN, encodes 3′ → 5′ DNA helicase and 3′ → 5′ DNA exonuclease activities, and is implicated in the maintenance of genomic stability. Translesion (TLS) DNA polymerases (Pols) insert nucleotides opposite replication-blocking DNA lesions and presumably prevent replication fork stalling/collapse. Here, we present in vitro and in vivo data that demonstrate functional interaction between WRN and the TLS Pols, Polη, Polκ, and Polι. In vitro , WRN stimulates the extension activity of TLS Pols on lesion-free and lesion-containing DNA templates, and alleviates pausing at stalling lesions. Stimulation is mediated through an increase in the apparent V max of the polymerization reaction. Notably, by accelerating the rate of nucleotide incorporation, WRN increases mutagenesis by Polη. In vivo , WRN and Polη colocalize at replication-dependent foci in response to UVC irradiation. The functional interaction between WRN and TLS Pols may promote replication fork progression, at the expense of increased mutagenesis, and obviate the need to resolve stalled/collapsed forks by processes involving chromosomal rearrangements.

Tyrosine kinase inhibitors (TKIÕs) vastly improve survival in chronic myeloid leukemia (CML). However resistance is a common occurrence, and is most frequently mediated by point mutations in the Abl kinase. There have been conflicting reports regarding the frequency of resistance mutations in the Abl kinase at the time of CML diagnosis, with some studies indicating that a large number of resistance mutations are pre-existing in many patients. However, a high burden of pre-existing resistance mutations is seemingly at odds with the ability of TKIÕs to initially control CML for months to years in the large majority of patients. Nearly all prior studies have used dozens of cycles of PCR amplification to enrich the Abl gene prior to mutation detection. PCR amplification introduces thousands of errors throughout the gene, which makes accurate identification of mutations challenging. Methods of mutation detection such as next-generation sequencing (NGS) are also error prone, with a background error rate near 1%. These high rates of background mutation render accurate detection of minority variants difficult or impossible. We have developed an alternate DNA mutation detection method, termed Duplex Sequencing (Schmitt MW et al, Nature Methods 2015;12:423-425), which improves on the accuracy of DNA sequencing by >100,000 fold. In Duplex Sequencing, the two strands of single DNA molecules are individually tagged and sequenced. True mutations are present at the same position in both strands and are complementary, whereas artifacts arising from amplification or sequencing errors are seen in only one strand and are not scored. We have additionally developed methods for >1,000,000 fold enrichment of the Abl gene from human cells. This enrichment protocol allows for unbiased detection of all possible mutations throughout the Abl gene, with an accuracy exceeding 99.9999%. We applied Duplex Sequencing to 18 patients with newly diagnosed chronic phase CML (CP-CML). We sequenced the active site exons of Abl from tens of thousands of individual CML genomes; no sub-clonal resistance mutations were seen in any patient. We demonstrate that prior reports indicating frequent resistance mutations at the time of CML diagnosis may be attributable to artifactual mutations introduced by reverse transcription and PCR amplification. We are now studying patients from the PACE trial (Cortes JE et al. N Engl J Med. 2013;369:1783-1796); these patients were heavily pre-treated, with the majority having received 3 or more prior TKIÕs. We identified 29 patients from the trial with a treatment-emergent mutation not detectable at baseline by conventional methods (NGS or Sanger), and have performed Duplex Sequencing on 9 of these patients to date. In contrast to treatment-naïve patients, we find that these heavily pre-treated patients commonly harbor multiple co-existing resistant sub-clones, most of which fall below the detection limit of conventional methods but are readily detected by Duplex Sequencing. In addition, in 44% of patients, mutations that emerged during ponatinib treatment were found as rare sub-clones at baseline (average detection limit of 1 in 11,412 cells), indicating that the mutant sub-clones pre-existed prior to ponatinib therapy. We are now sequencing the remainder of the cohort, and are increasing our detection limit through interrogation of a larger number of cells per patient. Our results indicate the feasibility of detecting sub-clonal resistance mutations at the time of initiation of next-line TKI therapy in order to guide treatment, and argue that high-sensitivity methods for mutation detection are required to optimally stratify patients to the most appropriate TKI. Moreover, our approach can detect sub-clonal mutations in any gene, and could be broadly applicable for identification of sub-clonal drug resistance mutations relevant to other targeted therapies. Figure 1. Detection of sub-clonal mutations in the Abl gene. Top panel: Next-generation sequencing of the Abl gene in a CML patient results in thousands of artifactual errors, preventing detection of low-level mutations. Bottom panel: Duplex Sequencing of the same sample eliminates artifactual errors, revealing a single point mutation in Abl. This mutation (E279K) confers resistance to imatinib. Figure 1. Detection of sub-clonal mutations in the Abl gene. Top panel: Next-generation sequencing of the Abl gene in a CML patient results in thousands of artifactual errors, preventing detection of low-level mutations. Bottom panel: Duplex Sequencing of the same sample eliminates artifactual errors, revealing a single point mutation in Abl. This mutation (E279K) confers resistance to imatinib. Disclosures Pritchard: ARIAD: Employment, Equity Ownership. Hodgson:ARIAD Pharmaceuticals: Employment, Equity Ownership. Rivera:ARIAD: Employment, Equity Ownership.

Subclonal mutations, that are present in a small subset of tumor cells prior to chemotherapy, could serve as a reservoir for the emergence of drug resistance. These could selectively expand during chemotherapy and result in relapse and death. We have used Duplex DNA Sequencing (DS) to detect low frequency subclonal mutations in AML, both prior to treatment and after relapse. DS focuses on a limited number of target genes at the level of single DNA molecules. Mutations are scored only if they are present at the same position in both strands of the same DNA molecule and are complementary, resulting in sequencing accuracy that is more than 10,000-fold greater than that of conventional next-generation DNA sequencing (NGS). To follow the course of mutation accumulation in AML, we used capture hybridization to enrich for 15 genes previously reported to be mutated in AML. We identified multiple subclonal mutations prior to therapy that would not be detected by routine NGS. For example, in one relapse sample, we identified a mutation in NRAS that was present in 32% of the cells. The identical mutation was detected by DS prior to treatment in 1% of cells. To further assess the frequency of subclonal mutations in AML, we targeted a 30 kb panel of genes at 500,000 fold depth, which facilitates detection of mutations present in fewer than 0.01% of cells. 5 subclonal mutations were identified within the 30 kb target, corresponding to a frequency of 170 mutations per megabase, Extrapolation of these results to the whole genome indicates that there are approximately 500,000 subclonal mutations per AML genome, which is 1,000 fold higher than the frequency of clonal mutations. These subclonal mutations would be unevenly distributed throughout the genome and be an important source for the selection of drug resistance during therapy. Citation Format: Lawrence A. Loeb, Michael W. Schmitt, Mark J. Prindle, Pamela S. Becker. Duplex sequencing of AML reveals extensive sub clonal heterogeneity. [abstract]. In: Proceedings of the 106th Annual Meeting of the American Association for Cancer Research; 2015 Apr 18-22; Philadelphia, PA. Philadelphia (PA): AACR; Cancer Res 2015;75(15 Suppl):Abstract nr 4890. doi:10.1158/1538-7445.AM2015-4890

Mutations are rare in normal cells. In contrast, multiple mutations are characteristic in most tumors. Previously we proposed a "mutator phenotype" hypothesis to explain how pre-cancer cells may acquire large number of mutations during carcinogenesis. Here we extend the "mutator phenotype" hypothesis considering recently discovered biochemical activities whose aberrant expression may result in genome-wide random mutations. The scope of this article is to emphasize that simple random point mutations can drive carcinogenesis and highlight new emerging pathways that generate these mutations. We focus specifically on random point mutations generated by replication errors, oxidative base damage, covalent base modifications by enzymes, and spontaneously generated abasic sites as a source of mutator mutants.

Werner syndrome (WS) is a recessive inherited human disease characterized by the early onset of aging. The gene mutated in WS encodes a DNA helicase that unwinds the double helical structure of DNA in the 3′→5′ direction as well as a 3′→5′ exonuclease. Our previous studies indicated that the activity of Werner syndrome helicase (WRN) could be stimulated by human replication protein A (hRPA), a heterotrimeric single-stranded DNA binding protein. We now localize the interaction between WRN and hRPA by measuring the stimulation of helicase activity and the binding of WRN by hRPA and its derivatives. The large subunit of hRPA (hRPA70) stimulates WRN helicase to the same extent as the hRPA heterotrimer, whereas the dimer of the two smaller subunits (hRPA 32·14) does not stimulate. By examining hRPA70 mutants with progressive deletions from either the C- or N-terminus, we found that the domain responsible for stimulation lies in the N-terminal half of the protein. By using enzyme-linked immunosorbent assay (ELISA) to examine physical interaction between WRN and the same deletion mutants, we found that the WRN-binding motif is located within amino acids 100–300 and overlaps with the single-stranded DNA binding domain (amino acids 150–450). We suggest that hRPA, by engaging in both protein–protein and protein–DNA interactions, facilitates unwinding events catalyzed by WRN helicase during DNA synthetic processes. These data should help further elucidation of the molecular mechanisms of genetic instability and premature aging phenotypes manifested by WS.