Search

DNA supercoiling is an essential mechanism of bacterial chromosome compaction, whose level is mainly regulated by topoisomerase I and DNA gyrase. Inhibiting either of these enzymes with antibiotics leads to global supercoiling modifications and subsequent changes in global gene expression. In previous studies, genes responding to DNA relaxation induced by gyrase inhibition were categorised as “supercoiling-sensitive”. Here, we studied the opposite variation of DNA supercoiling in the phytopathogen Dickeya dadantii using the non-marketed antibiotic seconeolitsine. We showed that the drug is active against topoisomerase I from this species, and analysed the first transcriptomic response of a Gram-negative bacterium to topoisomerase I inhibition. We find that the responding genes essentially differ from those observed after DNA relaxation, and further depend on the growth phase. We characterised these genes at the functional level, and also detected distinct patterns in terms of expression level, spatial and orientational organisation along the chromosome. Altogether, these results highlight that the supercoiling-sensitivity is a complex feature, which depends on the action of specific topoisomerases, on the physiological conditions, and on their genomic context. Based on previous in vitro expression data of several promoters, we propose a qualitative model of SC-dependent regulation that accounts for many of the contrasting transcriptomic features observed after gyrase or topoisomerase I inhibition.

In this study, we investigated the diversity of AAB from fermenting cocoa and the production of acetic acid in response to various environmental conditions. Ribosomal 16S gene sequence analysis and PCR-RFLP showed a restricted microbiota mainly composed of Acetobacter pasteurianus, Acetobacter tropicalis and Acetobacter okinawensis sp., consistently found in all six regions studied. Meanwhile Acetobacter malorum, Acetobacter ghanensis and Gluconobacter oxydans were isolated as minor species in specific regions. The dominant species were mainly isolated in the first 72 h period of natural cocoa fermentation while the minor species were present toward the later stages. Acetobacter okinawensis, a newly isolated species, was able to yield an unusually high quantity, up to 62 g/L of acetic acid at 30 °C. However, a shift of temperature to 35 °C severely impaired acid production in most strains of this species. While acetic acid production increases for up to 6 days in Acetobacter okinawensis and Acetobacter pasteurianus, it decreases beyond 4 days in Acetobacter tropicalis strains. The production of acetic acid was strongly dependent on environmental conditions, with optimal production between pH 4 and 5, under ethanol concentration below 8% and temperatures above 35–40 °C, corresponding to conditions prevailing in the first half of fermentation process. Acetobacter tropicalis was more productive at higher ethanol concentration and Acetobacter okinawensis at low pH. Species diversity and different behavior of strains highlight the importance of valuable starter selection for well-controlled cocoa fermentation. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (10.1007/s13197-019-04226-2) contains supplementary material, which is available to authorized users.

DNA supercoiling acts as a global transcriptional regulator in bacteria, that plays an important role in adapting their expression programme to environmental changes, but for which no quantitative or even qualitative regulatory model is available. Here, we focus on spatial supercoiling heterogeneities caused by the transcription process itself, which strongly contribute to this regulation mode. We propose a new mechanistic modeling of the transcription-supercoiling dynamical coupling along a genome, which allows simulating and quantitatively reproducing in vitro and in vivo transcription assays, and highlights the role of genes’ local orientation in their supercoiling sensitivity. Consistently with predictions, we show that chromosomal relaxation artificially induced by gyrase inhibitors selectively activates convergent genes in several enterobacteria, while conversely, an increase in DNA supercoiling naturally selected in a long-term evolution experiment with Escherichia coli favours divergent genes. Simulations show that these global expression responses to changes in DNA supercoiling result from fundamental mechanical constraints imposed by transcription, independently from more specific regulation of each promoter. These constraints underpin a significant and predictable contribution to the complex rules by which bacteria use DNA supercoiling as a global but fine-tuned transcriptional regulator.

Summary Nucleoid-associated proteins (NAPs) are a class of highly abundant DNA-binding proteins in bacteria and archaea. While both the composition and relative abundance of the NAPs change during the bacterial growth cycle, surprisingly little is known about their crosstalk in mutually binding and stabilizing higher-order nucleoprotein complexes in the bacterial chromosome. Here, we use atomic force microscopy and solid-state nanopores to investigate long-range nucleoprotein structures formed by the binding of two major NAPs, FIS and H-NS, to DNA molecules with distinct binding site arrangements. We find that spatial organization of the protein binding sites can govern the higher-order architecture of the nucleoprotein complexes. Based on sequence arrangement the complexes differed in their global shape and compaction as well as the extent of FIS and H-NS binding. Our observations highlight the important role the DNA sequence plays in driving structural differentiation within the bacterial chromosome., Graphical abstract, Highlights • The location of protein binding sites along DNA is important for 3D organization • FIS protein forms DNA loops while H-NS forms compact DNA plectonemes • FIS DNA loops inhibit H-NS from spreading over the DNA • FIS and H-NS competition creates regions of ‘open’ and ‘closed’ DNA, Organizational Aspects of Cell Biology;Structural Biology

DNA supercoiling acts as a global transcriptional regulator, which contributes to the rapid transcriptional response of bacteria to many environmental changes. Although a large fraction of promoters from distant species respond to superhelical variations, the sequence or structural determinants of this behaviour remain elusive. Here, we propose the sequence of the "discriminator" element located downstream of the -10 hexamer to play an important role in this response, by modulating the facility of open-complex formation during transcription initiation. We develop a quantitative model of this regulatory mechanism relying on known parameters of DNA thermodynamics, and show that its predictions quantitatively match the in vitro and in vivo supercoiling response of stable RNA promoters previously measured, as well as the in vivo response of selected mRNA promoters with mutated discriminator sequences. We then test the universality of this mechanism by statistical analysis of promoter sequences in transcriptomes of phylogenetically distant bacteria under conditions of supercoiling variations, (1) by gyrase inhibitors, (2) by environmental stresses, (3) inherited in the longest-running evolution experiment. In all cases, we identify a robust and significant sequence signature in the discriminator region, suggesting that promoter opening underpins an ubiquitous regulatory mechanism in the prokaryotic kingdom, based on the fundamental mechanical properties of DNA.

Bacterial pathogenic growth requires a swift coordination of pathogenicity functions with various kinds of environmental stresses encountered in the course of host infection. Among the factors critical for bacterial adaptation are changes of DNA topology and binding effects of nucleoid-associated proteins transducing the environmental signals to the chromosome and coordinating the global transcriptional response to stress. In this study we use the model phytopathogen Dickeya dadantii to analyse the organisation of transcription by the nucleoid-associated protein IHF. We determine both phenotypic effects of ihfA mutation on D. dadantii virulence and the transcriptional response under various conditions of growth. For the first time in enterobacteria, we examine the transcriptome of an IHF-depleted mutant under conditions of DNA relaxation, revealing a subtle interplay between IHF and DNA topology. We show that this mutation reorganises the genomic expression by altering the distribution of DNA supercoils along the chromosome at different length scales, thus affecting many virulence genes involved in both symptomatic and asymptomatic phases of infection, including those required for pectin catabolism. Altogether, we propose that IHF is a “domainin” protein, the inactivation of which impairs the coordination of chromosomal stress-response domains harbouring various virulence traits, thus abrogating the pathogenicity of D. dadantii.

A rapid and sensitive High Performance Liquid Chromatography (HPLC) method with photometric and fluorescence detection is developed for routine analysis of 2-Keto-3-deoxy-gluconate (KDG), a catabolite product of pectin and alginate. These polysaccharides are primary-based compounds for biofuel production and for generation of high-value-added products. HPLC is performed, after derivatization of the 2-oxo-acid groups of the metabolite with o-phenylenediamine (oPD), using a linear gradient of trifluoroacetic acid and acetonitrile. Quantification is accomplished with an internal standard method. The gradient is optimized to distinguish KDG from its close structural analogues such as 5-keto-4-deoxyuronate (DKI) and 2,5-diketo-3-deoxygluconate (DKII). The proposed method is simple, highly sensitive and accurate for time course analysis of pectin or alginate degradation.HighlightsA fluorescent based-HPLC method report the quantification of KDG, a metabolite originating from alginate and from pectin degradation pathways, using derivatization with o-phenylenediamine (oPD)

The catabolism of pectin from plant cell walls plays a crucial role in the virulence of the phytopathogen Dickeya dadantii. In particular, the timely expression of pel genes encoding major pectate lyases is essential to circumvent the plant defense systems and induce massive pectinolytic activity during the maceration phase. While previous studies identified the role of a positive feedback loop specific to the pectin degradation pathway, the precise signals controlling the dynamics of pectate lyase expression were unclear. Here we show that the latter is controlled by a metabolic switch involving both glucose and pectin. We measured the HPLC concentration profiles of the key metabolites related to these two sources of carbon, cyclic adenosine monophosphate (cAMP) and 2-keto-3-deoxygluconate (KDG), and developed a dynamic and quantitative model of the process integrating the associated regulators, CRP and KdgR. The model describes the regulatory events occurring at the promoters of two major pel genes, pelE and pelD. It highlights that their activity is controlled by a mechanism of carbon catabolite repression, which directly controls the virulence of D. dadantii. The model also shows that quantitative differences in the binding properties of common regulators at these two promoters resulted in a qualitatively different role of pelD and pelE in the metabolic switch, and also likely in conditions of infection, justifying their evolutionary conservation as separate genes in this species.

Recombinases are responsible for homologous recombination and maintenance of genome integrity. In Escherichia coli, the recombinase RecA forms a nucleoprotein filament with the ssDNA present at a DNA break and searches for a homologous dsDNA to use as a template for break repair. During the first step of this process, the ssDNA is bound to RecA and stretched into a Watson–Crick base-paired triplet conformation. The RecA nucleoprotein filament also contains ATP and Mg2+, two cofactors required for RecA activity. Then, the complex starts a homology search by interacting with and stretching dsDNA. Thanks to supercoiling, intersegment sampling and RecA clustering, a genome-wide homology search takes place at a relevant metabolic timescale. When a region of homology 8–20 base pairs in length is found and stabilized, DNA strand exchange proceeds, forming a heteroduplex complex that is resolved through a combination of DNA synthesis, ligation and resolution. RecA activities can take place without ATP hydrolysis, but this latter activity is necessary to improve and accelerate the process. Protein flexibility and monomer–monomer interactions are fundamental for RecA activity, which functions cooperatively. A structure/function relationship analysis suggests that the recombinogenic activity can be improved and that recombinases have an inherently large recombination potential. Understanding this relationship is essential for designing RecA derivatives with enhanced activity for biotechnology applications. For example, this protein is a major actor in the recombinase polymerase isothermal amplification (RPA) used in point-of-care diagnostics.

International audience; In the quest for a sustainable economy of the earth resources and for renewable sources of energy, a promising avenue is to exploit the vast quantity of polysaccharide molecules contained in green wastes. To that end, the decomposition of pectin appears to be an interesting target because this polymeric carbohydrate is abundant in many fruit pulps and soft vegetables. To quantitatively study this degradation process, here we designed a bioreactor that is continuously fed with de-esterified pectin (PGA). Thanks to the pectate lyases produced by bacteria cultivated in the vessel, the PGA is depolymerized into oligo-galacturonates (UGA) which is continuously extracted from the tank. A mathematical model of our system predicted that the conversion efficiency of PGA into UGA increases in a range of coefficient of dilution until reaching an upper limit where the fraction of UGA that is extracted from the bioreactor is maximized. Results from experiments with a continuous reactor hosting a strain of the plant pathogenic bacterium Dickeya dadantii and in which the dilution coefficients were varied, quantitatively validated the predictions of our model. A further theoretical analysis of the system enabled an a priori comparison of the efficiency of eight other pectate lyases-producing microorganisms with that of D. dadantii. Our findings suggest that D. dadantii is as the most efficient microorganism and therefore the best candidate for a practical implementation of our scheme for the bioproduction of UGA from PGA.

International audience; Microbial fermentation is an indispensable process for high quality chocolate from cocoa bean raw material. lactic acid bacteria (LAB) are among the major microorganisms responsible for cocoa fermentation but their exact role remains to be elucidated. In this study, we analyzed the diversity of LAB in six cocoa producing regions of Ivory Coast. Ribosomal 16S gene sequence analysis showed that Lactobacillus plantarum and Leuconostoc mesenteroides are the dominant LAB species in these six regions. In addition, other species were identified as the minor microbial population, namely Lactobacillus curieae, Enterococcus faecium, Fructobacillus pseudoficulneus, Lactobacillus casei, Weissella paramesenteroides and Weissella cibaria. However, in each region, the LAB microbial population was composed of a restricted number of species (maximum 5 species), which varied between the different regions. LAB implication in the breakdown of citric acid was investigated as a fundamental property for a successful cocoa fermentation process. High citrate lyase producer strains were characterized by rapid citric acid consumption, as revealed by a 4-fold decrease in citric acid concentration in the growth medium within 12h, concomitant with an increase in acetic acid and lactic acid concentration. The production of citrate lyase was strongly dependent on environmental conditions, with optimum production at acidic pH (pH

International audience; Recent studies strongly suggest that in bacteria, both the genomic pattern of DNA thermodynamic stability and the order of genes along the chromosomal origin-to-terminus axis are highly conserved and that this spatial organization plays a crucial role in coordinating genomic transcription. In this article, we explore the relationship between genomic sequence organization and transcription in the commensal bacterium Escherichia coli and the plant pathogen Dickeya. We argue that, while in E. coli the gradient of DNA thermodynamic stability and gene order along the origin-to-terminus axis represent major organizational features orchestrating temporal gene expression, the genomic sequence organization of Dickeya is more complex, demonstrating extended chromosomal domains of thermodynamically distinct DNA sequences eliciting specific transcriptional responses to various kinds of stress encountered during pathogenic growth. This feature of the Dickeya genome is likely an adaptation to the pathogenic lifestyle utilizing differences in genomic sequence organization for the selective expression of virulence traits. We propose that the coupling of DNA thermodynamic stability and genetic function provides a common organizational principle for the coordinated expression of genes during both normal and pathogenic bacterial growth.

Bacteria are colonizers of various environments and host organisms, and they are often subjected to drastic temperature variations. Dickeya dadantii is a pathogen infecting a wide range of plant species. Soft rot, the visible symptom, is mainly due to the production of pectate lyases (Pels) that destroy plant cell walls. The production of Pels is controlled by a complex regulation system that responds to various stimuli, such as the presence of pectin, growth phase and temperature. Despite numerous regulatory studies, the thermoregulation mechanism of Pel production remains unexplained. Here, we show that PecT, a previously identified repressor, modulates pel gene expression in a temperature-dependent manner, and we demonstrate that PecT binding on pel promoters increases concomitantly with temperature. High temperatures relax the DNA in D. dadantii, and remarkably, artificial relaxation of DNA at low temperatures increases PecT binding to DNA. Deletion of pecT augmented the capacity of D. dadantii to initiate soft-rot symptoms at high temperatures. These results reveal that DNA topology and PecT act in concert to fine-tune D. dadantii virulence in response to temperature. This novel combination between DNA topology and a conventional transcriptional regulator extends our understanding of the thermoregulation mechanisms involved in bacterial virulence.

Pectin degrading enzymes are essential for quality of product from cocoa fermentation. Previously, we studied purified pectate lyases (Pel) produced by Bacillus strains from fermenting cocoa and characterized the cloned pel genes. This study aims to search for biological signals that modulates Pel production and regulators that influence pel gene expression. Strains were grown to the end of exponential phase in media containing various carbon sources. Pel enzymes production in Bacillus was unaffected by simple sugar content variation up to 2%. Additionally, it appeared that pel gene is not under the control of the most common carbon and pectin catabolism regulators ccpA and kdgR, which could explain the insensitivity of Pel production to carbon source variation. However, a 6-fold decrease in Pel production was observed when bacteria were grown in LB rich medium as opposed to basal mineral medium. Subsequently, bioinformatics analysis of cloned pel gene promoter region revealed the presence of DegU binding site. Furthermore, the deletion of degU gene dramatically reduces the pel gene expression, as revealed by real time quantitative PCR, showing an activation effect of DegU on Pel synthesis in Bacillus strains studied. We assumed that, during the latter stage of cocoa fermentation when simple sugars are depleted, production of Pel in Bacillus is stimulated by DegU to supply microbial cells with carbon source from polymeric pectic compounds.

International audience; Dickeya dadantii is a pathogen infecting a wide range of plant species. Soft rot, the visible symptom, is mainly due to the production of pectate lyases (Pels) that can destroy the plant cell walls. Previously we found that the pel gene expression is modulated by H-NS and FIS, two nucleoid-associated proteins (NAPs) modulating the DNA topology. Here, we show that relaxation of the DNA in growing D. dadantii cells decreases the expression of pel genes. Deletion of fis aggravates, whereas that of hns alleviates the negative impact of DNA relaxation on pel expression. We further show that H-NS and FIS directly bind the pelE promoter and that the response of D. dadantii pel genes to stresses that induce DNA relaxation is modulated, although to different extents, by H-NS and FIS. We infer that FIS acts as a repressor buffering the negative impact of DNA relaxation on pel gene transcription, whereas H-NS fine-tunes the response of virulence genes precluding their expression under suboptimal conditions of supercoiling. This novel dependence of H-NS effect on DNA topology expands our understanding of the role of NAPs in regulating the global bacterial gene expression and bacterial pathogenicity.

Pathogenicity of Dickeya dadantii is a process involving several factors, such as plant cell wall-degrading enzymes and adaptation systems to adverse conditions encountered in the apoplast. Regulators of the MarR family control a variety of biological processes, including adaptation to hostile environments and virulence. Analysis of the members of this family in D. dadantii led to the identification of a new regulator, MfbR, which controls virulence. MfbR represses its own expression but activates genes encoding plant cell wall-degrading enzymes. Purified MfbR increases the binding of RNA polymerase at the virulence gene promoters and inhibits transcription initiation at the mfbR promoter. MfbR activity appeared to be modulated by acidic pH, a stress encountered by pathogens during the early stages of infection. Expression of mfbR and its targets, during infection, showed that MfbR is unable to activate virulence genes in acidic conditions at an early step of infection. In contrast, alkalinization of the apoplast, during an advanced stage of infection, led to the potentialization of MfbR activity resulting in plant cell wall degrading enzyme production. This report presents a new example of how pathogens adjust virulence-associated factors during the time-course of an infection.

Pectinolytic enzymes play an important role in cocoa fermentation. In this study, we characterized three extracellular pectate lyases (Pels) produced by bacilli isolated from fermenting cocoa beans. These enzymes, named Pel-22, Pel-66, and Pel-90, were synthesized by Bacillus pumilus BS22, Bacillus subtilis BS66, and Bacillus fusiformis BS90, respectively. The three Pels were produced under their natural conditions and purified from the supernatants using a one-step chromatography method. The purified enzymes exhibited optimum activity at 60°C, and the half-time of thermoinactivation at this temperature was approximately 30 min. Pel-22 had a low specific activity compared with the other two enzymes. However, it displayed high affinity for the substrate, about 2.5-fold higher than those of Pel-66 and Pel-90. The optimum pHs were 7.5 for Pel-22 and 8.0 for Pel-66 and Pel-90. The three enzymes trans -eliminated polygalacturonate in a random manner to generate two long oligogalacturonides, as well as trimers and dimers. A synergistic effect was observed between Pel-22 and Pel-66 and between Pel-22 and Pel-90, but not between Pel-90 and Pel-66. The Pels were also strongly active on highly methylated pectins (up to 60% for Pel-66 and Pel-90 and up to 75% for Pel-22). Fe 2+ was found to be a better cofactor than Ca 2+ for Pel-22 activity, while Ca 2+ was the best cofactor for Pel-66 and Pel-90. The amino acid sequences deduced from the cloned genes showed the characteristics of Pels belonging to Family 1. The pel - 66 and pel - 90 genes appear to be very similar, but they are different from the pe l- 22 gene. The characterized enzymes form two groups, Pel-66/Pel-90 and Pel-22; members of the different groups might cooperate to depolymerize pectin during the fermentation of cocoa beans.

Colonization factors (CFs) mediate early adhesion of Enterotoxigenic Escherichia coli (ETEC) in the small intestine. Environmental signals including bile, glucose, and contact with epithelial cells have previously been shown to modulate CF expression in a strain dependent manner. To identify novel components modulating CF surface expression, 20 components relevant to the intestinal environment were selected for evaluation. These included mucin, bicarbonate, norepinephrine, lincomycin, carbon sources, and cations. Effects of individual components on surface expression of the archetype CF, CFA/I, were screened using a fractional factorial Hadamard matrix incorporating 24 growth conditions. As most CFs agglutinate erythrocytes, surface expression was evaluated by mannose resistant hemagglutination. Seven components, including porcine gastric mucin, lincomycin, glutamine, and glucose were found to induce CFA/I surface expression in vitro in a minimal media while five others were inhibitory, including leucine and 1,10-phenanthroline. To further explore the effect of components positively influencing CFA/I surface expression, a response surface methodology (RSM) was designed incorporating 36 growth conditions. The optimum concentration for each component was identified, thereby generating a novel culture media, SP1, for CFA/I expression. CFs closely related to CFA/I, including CS4 and CS14 were similarly induced in SP1 media. Other epidemiologically relevant CFs were also induced when compared to the level obtained in minimal media. These results indicate that although CF surface expression is complex and highly variable among strains, the CF response can be predicted for closely related strains. A novel culture media inducing CFs in the CF5a group was successfully identified. In addition, mucin was found to positively influence CF expression in strains expressing either CFA/I or CS1 and CS3, and may function as a common environmental cue.

The bacterial gene regulatory regions often demonstrate distinctly organized arrays of RNA polymerase binding sites of ill-defined function. Previously we observed a module of closely spaced polymerase binding sites upstream of the canonical promoter of the Escherichia coli fis operon. FIS is an abundant nucleoid-associated protein involved in adjusting the chromosomal DNA topology to changing cellular physiology. Here we show that simultaneous binding of the polymerase at the canonical fis promoter and an upstream transcriptionally inactive site stabilizes a RNAP oligomeric complex in vitro. We further show that modulation of the upstream binding of RNA polymerase affects the fis promoter activity both in vivo and in vitro. The effect of the upstream RNA polymerase binding on the fis promoter activity depends on the spatial arrangement of polymerase binding sites and DNA supercoiling. Our data suggest that a specific DNA geometry of the nucleoprotein complex stabilized on concomitant binding of RNA polymerase molecules at the fis promoter and the upstream region acts as a topological device regulating the fis transcription. We propose that transcriptionally inactive RNA polymerase molecules can act as accessory factors regulating the transcription initiation from a nearby promoter.

Production of the main virulence determinant pectate lyases (Pels) of the phytopathogenic bacterium Erwinia chrysanthemi is modulated by a complex regulatory network involving the repressor proteins KdgR, PecS and PecT and the activator systems Pir, ExpI-ExpR and CRP. Of these regulators, CRP and PecT are particularly important since the absence of CRP or a slight overproduction of PecT leads to a drastic reduction in synthesis of Pel species. Recently, it has been shown that production of Pel species is strongly reduced in an E. chrysanthemi hns mutant, suggesting an activator function of the nucleoid-associated protein H-NS in the expression of the pel genes. Here, we report that the reduced synthesis of Pel species in the hns mutant results from a negative control, exerted by H-NS, on the transcription of the regulatory gene pecT. This H-NS/PecT cascade regulation is one of the first elucidations of a positive effect of H-NS on target gene expression. Moreover, we found that H-NS also represses the expression of expI, expR and pel genes. H-NS control is the result of H-NS binding to extended regions within the pecT, expI, expR and pel genes. Investigation of the simultaneous binding of CRP, RNA polymerase (RNAP) and H-NS on the pelD gene revealed that these three proteins form a nucleoprotein com-plex. Together, these data indicate that, by exerting a negative control at multiple levels, H-NS plays a crucial role in the E. chrysanthemi pel regulatory network.

The DNA architectural proteins FIS and CRP are global regulators of transcription in Escherichia coli involved in the adjustment of cellular metabolism to varying growth conditions. We have previously demonstrated that FIS modulates the expression of the crp gene by functioning as its transcriptional repressor. Here we show that in turn, CRP is required to maintain the growth phase pattern of fis expression. We demonstrate the existence of a divergent promoter in the fis regulatory region, which reduces transcription of the fis promoter. In the absence of FIS, CRP activates fis transcription, thereby displacing the polymerase from the divergent promoter, whereas together FIS and CRP synergistically repress fis gene expression. These results provide evidence for a direct cross-talk between global regulators of cellular transcription during the growth phase. This cross-talk is manifested in alternate formation of functional nucleoprotein complexes exerting either activating or repressing effects on transcription.

Activation of the two divergent Escherichia coli cai and fix operons involved in anaerobic carnitine metabolism is co-dependent on the cyclic AMP receptor protein (CRP) and on CaiF, the specific carnitine-sensitive transcriptional regulator. CaiF was overproduced using a phage T7 system, purified on a heparin column and ran as a 15 kDa protein on SDS-PAGE. DNase I footprinting and interference experiments identified two sites, F1 and F2, with apparently comparable affinities for the binding of CaiF in the cai-fix regulatory region. These sites share a common perfect inverted repeat comprising two 11 bp half-sites separated by 13 bp, and centred at -70 and -127 from the fix transcription start site. They were found to overlap the two low-affinity binding sites, CRP2 and CRP3, determined previously for CRP. Gel shift assays and footprinting experiments suggest that CaiF and CRP bind co-operatively to the F1/CRP2 and F2/CRP3 sites of the intergenic cai-fix region. Moreover, they appeared to serve the simultaneous binding of each other, giving rise to an original multiprotein CRP-CaiF complex enabling RNA polymerase recruitment and local DNA untwisting, at least at the fix promoter. Using random mutagenesis, two CaiF mutants impaired in transcription activation were isolated. The N-terminal A27V mutation affected the structural organization of the activator, whereas the central I62N mutation was suggested to interfere with DNA binding.

Erwinia chrysanthemi 3937 secretes an arsenal of pectinolytic enzymes including several pectate lyases encoded by the pel genes. We characterized a novel cluster of pectinolytic genes consisting of the three adjacent genes pehV, pehW and pehX, whose products have polygalacturonase activity. The high similarity between the three genes suggests that they result from duplication of an ancestral gene. The transcription of pehV, pehW and pehX is dependent on several environmental conditions. They are induced by pectin catabolic products and this induction results from inactivation of the KdgR repressor which controls almost all the steps of pectin catabolism. The presence of calcium ions strongly reduced the transcription of the three peh genes. Their expression was also affected by growth phase, osmolarity, oxygen limitation and nitrogen starvation. In addition, the pehX transcription is affected by catabolite repression and controlled by the activator protein CRP. PecS, which was initially isolated as a repressor of virulence factors, acts as an activator of the peh transcription. We showed that the three regulators KdgR, PecS and CRP act by direct interaction with the promoter regions of the peh genes. Analysis of simultaneous binding of KdgR, PecS, CRP and RNA polymerase indicated that the activator effect of PecS results from a competition between PecS and KdgR for the occupation of overlapping binding sites. Thus, to activate peh transcription, PecS behaves as an anti-repressor against KdgR.

The expI-expR locus drives a quorum-sensing system in the phytopathogenic bacterium, Erwinia chrysanthemi. Purified ExpR, an N-acyl homoserine lactone-responsive regulatory protein, binds to the promoter/operator region of the expI and expR genes. DNase I footprinting experiments showed that ExpR protects the regions between -66 and -40 from the P1 transcription initiation site of expl and between -54 and -18 from the expR transcription initiation site P1. The protected region overlaps the two expR promoters, P1 and P2, suggesting that ExpR exerts a negative control on its own gene expression. This assertion is reinforced by the fact that the addition of OHHL dissociates the ExpR-expR DNA complex. In contrast, the location of the ExpR binding site on the expI gene suggests an activator function, as reported for the pel genes. Moreover, ExpR is able to induce DNA bending. In vivo and in vitro studies revealed that CRP functions as an activator of expR expression, but as a repressor of expI transcription. A second level of control of expR and expI occurs through the PecS repressor, a regulator of pectinase synthesis. PecS represses expI expression, while ExpR activates pecS transcription, suggesting the existence of a mutual control between pecS and the expI-expR system in E. chrysanthemi. Regulation of pectinase synthesis in soft rot Erwinia appears to be a complex network of multiple cross-acting regulatory elements. A model that integrates these regulatory elements is proposed.

In Erwinia chrysanthemi 3937, pectate lyase activity mainly results from the cumulative action of five major isoenzymes, PelA to PelE. Comparison of their amino acid sequences revealed two families, PelB-C and PelA-D-E. Molecular cloning permitted expression of the different pel genes in Escherichia coli and the isolation of each Pel independently from the other isoenzymes. We used similar experimental conditions to overproduce and purify the five Pels in a one-step chromatography method. We analyzed some of the basic enzymatic properties of these five isoenzymes. PelA has a low specific activity compared to the other four enzymes. PelB and PelC have a high affinity for their substrate: about 10-fold higher than the enzymes of the PelA-D-E group. The optimum pH is more alkaline for PelB and PelC (about 9.2) than for PelA, PelD, and PelE (from 8 to 8.8). Below pH 7, activity was negligible for PelB and PelC, while PelA, PelD, and PelE retained 25 to 30% of their activities. The temperature optima were determined to be 50 degrees C for PelD and PelE, 55 degrees C for PelA, and 60 degrees C for PelB and PelC. Enzymes of the PelB-C group are more stable than those of the PelA-D-E group. Use of substrates presenting various degrees of methylation revealed that PelA, PelD, and PelE are active only for very low levels of methylation, while PelB and PelC are more active on partially methylated pectins (up to 22% for PelC and up to 45% for PelB). Pectate lyases have an absolute requirement for Ca2+ ions. For the five isoenzymes, maximal activity was obtained at a Ca2+ concentration of 0.1 mM. None of the tested cations (Ba2+, Co2+, Cu2+, Mg2+, Mn2+, Sr2+, Zn2+) can substitute for Ca2+. At a high concentration (1 mM), most of the divalent cations inhibited pectate lyase activity. In addition, we demonstrated that two compounds present in plant tissues, epicatechin and salicylic acid, inhibit the pectate lyases at a concentration of 0.2 mM.

The major periplasmic nuclease of Erwinia chrysanthemi strain 3937, NucM, has been purified near to homogeneity by a one step purification procedure, using; chromatography on a sulfopropyl column. NucM cleaves randomly single and double-stranded DNA and RNA. It does not need divalent cations for its action, and is more active in low salt buffers. A serine and a histidine residue could be present in the catalytic site. Formation of disulfide bonds is necessary for NucM activity. NucM is probably synthesized as a reduced inactive polypeptide and becomes active in the periplasm once disulfide bonds are formed.

The pectate lyase (EC 4.2.2.9) from Bacillus subtilis has been crystallized. Crystals of form 1, grown by the hanging drop method using polyethylene glycol as precipitant, diffract to at least 2.4 A resolution. They belong to the spacegroup P2(1) with a = 132.9 A, b = 41.2 A, c = 156.8 A and beta = 114.9 degrees with probably four molecules in the asymmetric unit. A second crystal form grown from 2-methyl-2,4-pentandiol also belongs to the spacegroup P2(1) with a = 55.0 A, b = 88.1 A, c = 50.2 A and beta = 109.0 degrees. These crystals diffract to at least 2.0 A and have one molecule in the asymmetric unit. Both crystal forms are suitable for the determination of high-resolution structures.

3-Deoxy-D-erythro-2-hexulosonic acid (KDG), an important metabolite of bacterial polysaccharide degradation, was prepared from D-glucono-1,5-lactone through a six-step sequence, with a 45% overall yield. Using suitable intermediates. KDG methyl ester and its 5- and 6-O-methylated derivatives were also synthesized. 1H and 13C NMR studies of 5- and 6-O-methylated derivatives (pyranoid and furanoid forms respectively) compared to those of KDG and its methyl ester allowed us to conclude that these two latter compounds exist in equilibrium as forms whose percentages were determined.

International audience; Pathogenicity of the phytopathogenic enterobacterium Erwinia chrysanthemi, the causal agent of soft rot disease on many plants, is a complex process involving several factors whose production is regulated by a complex, intertwined regulatory network. In this work we characterized the GacA regulator, member of the GacS–GacA two-component system, as a global regulator which is required for disease expression but not for bacterial multiplication in planta during the first stages of the plant infection. GacA was shown to control the expression of plant cell wall-degrading enzymes and hrp genes in vitro. Analysis of virulence gene expression during infection of Arabidopsis thaliana revealed a coordinated expression of these virulence genes at 12 h post infection and showed that GacA is required for the appropriate production of virulence factors in planta. GacA might partly act by negatively controlling the expression of the pecT gene encoding the global repressor PecT, indicating a hierarchy in the pathways involved in the E. chrysanthemi regulatory network.

Ten pathogenesis-related (PR) proteins have been extracted at pH 5·2 and purified from maize leaves after bromegrass mosaic virus infection or mercuric chloride treatment. Among these PR proteins several have been found to be 1,3-β-glucanases and chitinases. Thus PRm6a and PRm6b proteins are two acidic glucanases and PRm Ba1 a basic glucanase; PRmBa2 is a basic chitinase found in addition to the four previously characterized acidic chitinases (PRm3, PRm4, PRm5 and PRm7 proteins). The basic 1,3-β-glucanase account for about 15% of the total 1,3-β-glucanase activity and the basic chitinase for about 20% of the total chitinase activity. The cellular distribution of several PR proteins have been investigated, by immunodetection, in the intercellular fluid and in the crude extracts from maize protoplasts. It has been found that the acidic 1,3-β-glucanases and acidic chitinases have an extracellular localization, whereas the corresponding basic enzymes are located inside the cell. PRm2 protein a tobacco PR1b-type protein, is also located in the intercellular spaces of maize leaves.

Bacteria use small signal molecules, referred to as autoinducers, in order to monitor their population density and coordinate gene expression in a process named quorum sensing. In Gram-negative bacteria, acylated homoserine lactones are the most common autoinducer used for cell-to-cell communication. Increasing evidence that many different functions are controlled by acylated homoserine lactone quorum sensing has stimulated intensive investigations into the physiology, molecular biology and biochemistry that underlie this process. Here we review our current understanding of the molecular mechanisms used by the transcriptional regulators responsive to acylated homoserine lactone autoinducers to control gene expression and the structural modifications induced by acylated homoserine lactones binding specifically on these regulators.

A series of 15 racemic alkyl- and aryl-N-substituted ureas, derived from homoserine lactone, were synthesized and tested for their ability to competitively inhibit the action of 3-oxohexanoyl-l-homoserine lactone, the natural inducer of bioluminescence in the bacterium Vibrio fischeri. N-alkyl ureas with an alkyl chain of at least 4 carbon atoms, as well as certain ureas bearing a phenyl group at the extremity of the alkyl chain, were found to be significant antagonists. In the case of N-butyl urea, it has been shown that the antagonist activity was related to the inhibition of the dimerisation of the N-terminal domain of ExpR, a protein of the receptor LuxR family. Molecular modelling suggested that this would result from the formation of an additional hydrogen bond in the protein acylhomoserine lactone binding cavity.

International audience; In Erwinia chrysanthemi production of pectic enzymes is controlled by a complex network involving several regulators. Among them is ExpR, the quorum-sensing regulatory protein. ExpR is a member of the LuxR family of transcriptional regulators, the activity of which is modulated by the binding of diffusible N-acylhomoserine lactone pheromones to the N-terminal receptor site of the proteins. Previous in vitro DNA-ExpR binding studies suggested that ExpR might activate pectic enzyme production and repress its cognate gene expression. This report presents genetic evidence that ExpR represses its own gene expression in the absence of pheromone and that the addition of pheromone promotes concentration-dependent de-repression. In vitro experiments show that (i) ExpR binds target DNA in the absence of pheromone and that the pheromone dissociates ExpR-DNA complexes, (ii) ExpR binds target DNA in a non-cooperative fashion, and (iii) two molecules of pheromone are bound per molecule of ExpR dimer. In the absence of N-(3-oxo-hexanoyl)-homoserine lactone, ExpR prevents RNA polymerase access to the expR promoter, thereby directly repressing transcription initiation. The presence of pheromone renders the expR promoter accessible to RNA polymerase and results in the de-repression of transcription initiation. Overall we have established that there is a direct modulation of the repressive activity of a LuxR family regulator by a pheromone. Furthermore, site-directed mutagenesis experiments strongly suggest that the ExpR residues Leu-19, Tyr-31, and Ser-125 are involved in the transduction of conformational changes induced by ligand binding, and this provides new insights into the structure-function relationship of this bacterial regulator family.In Erwinia chrysanthemi production of pectic enzymes is controlled by a complex network involving several regulators. Among them is ExpR, the quorum-sensing regulatory protein. ExpR is a member of the LuxR family of transcriptional regulators, the activity of which is modulated by the binding of diffusible N-acylhomoserine lactone pheromones to the N-terminal receptor site of the proteins. Previous in vitro DNA-ExpR binding studies suggested that ExpR might activate pectic enzyme production and repress its cognate gene expression. This report presents genetic evidence that ExpR represses its own gene expression in the absence of pheromone and that the addition of pheromone promotes concentration-dependent de-repression. In vitro experiments show that (i) ExpR binds target DNA in the absence of pheromone and that the pheromone dissociates ExpR-DNA complexes, (ii) ExpR binds target DNA in a non-cooperative fashion, and (iii) two molecules of pheromone are bound per molecule of ExpR dimer. In the absence of N-(3-oxo-hexanoyl)-homoserine lactone, ExpR prevents RNA polymerase access to the expR promoter, thereby directly repressing transcription initiation. The presence of pheromone renders the expR promoter accessible to RNA polymerase and results in the de-repression of transcription initiation. Overall we have established that there is a direct modulation of the repressive activity of a LuxR family regulator by a pheromone. Furthermore, site-directed mutagenesis experiments strongly suggest that the ExpR residues Leu-19, Tyr-31, and Ser-125 are involved in the transduction of conformational changes induced by ligand binding, and this provides new insights into the structure-function relationship of this bacterial regulator family.

International audience; A series of 11 new analogues of N-acylhomoserine lactones in which the carboxamide bond was replaced by a sulfonamide one, has been synthesised. These compounds were evaluated for their ability to competitively inhibit the action of 3-oxohexanoyl-L-homoserine lactone, the natural ligand of the quorum sensing transcriptional regulator LuxR, which in turn activates expression of bioluminescence in the model bacterium Vibrio fischeri. Several compounds were found to display antagonist activity. Molecular modeling suggests that the latter prevent a cascade of structural rearrangements necessary for the formation of the active LuxR dimer.A series of 11 new analogues of N-acylhomoserine lactones in which the carboxamide bond was replaced by a sulfonamide one, has been synthesised. These compounds were evaluated for their ability to competitively inhibit the action of 3-oxohexanoyl-L-homoserine lactone, the natural ligand of the quorum sensing transcriptional regulator LuxR, which in turn activates expression of bioluminescence in the model bacterium Vibrio fischeri. Several compounds were found to display antagonist activity. Molecular modeling suggests that the latter prevent a cascade of structural rearrangements necessary for the formation of the active LuxR dimer.

In Erwinia chrysanthemi, production of pectic enzymes is modulated by a complex network involving several regulators. One of them, PecS, which belongs to the MarR family, also controls the synthesis of various other virulence factors, such as cellulases and indigoidine. Here, the PecS consensus-binding site is defined by combining a systematic evolution of ligands by an exponential enrichment approach and mutational analyses. The consensus consists of a 23-base pair palindromic-like sequence (C(-11)G(-10)A(-9)N(-8)W(-7)T(-6)C(-5)G(-4)T(-3)A(-2))T(-1)A(0)T(1)(T(2)A(3)C(4)G(5)A(6)N(7)N(8)N(9)C(10)G(11)). Mutational experiments revealed that (i) the palindromic organization is required for the binding of PecS, (ii) the very conserved part of the consensus (-6 to 6) allows for a specific interaction with PecS, but the presence of the relatively degenerated bases located apart significantly increases PecS affinity, (iii) the four bases G, A, T, and C are required for efficient binding of PecS, and (iv) the presence of several binding sites on the same promoter increases the affinity of PecS. This consensus is detected in the regions involved in PecS binding on the previously characterized target genes. This variable consensus is in agreement with the observation that the members of the MarR family are able to bind various DNA targets as dimers by means of a winged helix DNA-binding motif. Binding of PecS on a promoter region containing the defined consensus results in a repression of gene transcription in vitro. Preliminary scanning of the E. chrysanthemi genome sequence with the consensus revealed the presence of strong PecS-binding sites in the intergenic region between fliE and fliFGHIJKLMNOPQR which encode proteins involved in the biogenesis of flagellum. Accordingly, PecS directly represses fliE expression. Thus, PecS seems to control the synthesis of virulence factors required for the key steps of plant infection.

Erwinia chrysanthemi 3937 secretes an arsenal of pectinolytic enzymes, including at least eight endo-pectate lyases encoded by pel genes, which play a major role in the soft-rot disease caused by this bacterium on various plants. E. chrysanthemi also produces some hydrolases that cleave pectin. Three adjacent hydrolase genes, pehV , pehW , and pehX, encoding exo-poly-α- d -galacturonosidases, have been characterized. These enzymes liberate digalacturonides from the nonreducing end of pectin. We report the identification of a novel gene, named pehN, encoding a protein homologous to the glycosyl hydrolases of family 28, which includes mainly polygalacturonases. PehN has a low hydrolase activity on polygalacturonate and on various pectins. PehN action favors the activity of the secreted endo-pectate lyases, mainly PelB and PelC, and that of the periplasmic exo-pectate lyase PelX. However, removal of the pehN gene does not significantly alter the virulence of E. chrysanthemi . Regulation of pehN transcription was analyzed by using gene fusions. Like other pectinase genes, pehN transcription is dependent on several environmental conditions. It is induced by pectic catabolic products and is affected by growth phase, catabolite repression, osmolarity, anaerobiosis, nitrogen starvation, and the presence of calcium ions. The transcription of pehN is modulated by the repressor KdgR, which controls almost all the steps of pectin catabolism, and by cyclic AMP receptor protein (CRP), the global activator of sugar catabolism. The regulator PecS, which represses the transcription of the pel genes but activates that of pehV , pehW , and pehX , also activates transcription of pehN . The three regulators KdgR, PecS, and CRP act by direct interaction with the pehN promoter region. The sequences involved in the binding of these three regulators and of RNA polymerase have been precisely defined. Analysis of the simultaneous binding of these proteins indicates that CRP and RNA polymerase bind cooperatively and that the binding of KdgR could prevent pehN transcription. In contrast, the activator effect of PecS is not linked to competition with KdgR or to cooperation with CRP or RNA polymerase. This effect probably results from competition between PecS and an unidentified repressor involved in peh regulation.

In the plant-pathogenic bacterium Erwinia chrysanthemi production of pectate lyases, the main virulence determinant, is modulated by a complex network involving several regulatory proteins. One of these regulators, PecS, also controls the synthesis of a blue pigment identified as indigoidine. Since production of this pigment is cryptic in the wild-type strain, E. chrysanthemi ind mutants deficient in indigoidine synthesis were isolated by screening a library of Tn 5 -B21 insertions in a pecS mutant. These ind mutations were localized close to the regulatory pecS-pecM locus, immediately downstream of pecM . Sequence analysis of this DNA region revealed three open reading frames, indA , indB , and indC , involved in indigoidine biosynthesis. No specific function could be assigned to IndA. In contrast, IndB displays similarity to various phosphatases involved in antibiotic synthesis and IndC reveals significant homology with many nonribosomal peptide synthetases (NRPS). The IndC product contains an adenylation domain showing the signature sequence DAWCFGLI for glutamine recognition and an oxidation domain similar to that found in various thiazole-forming NRPS. These data suggest that glutamine is the precursor of indigoidine. We assume that indigoidine results from the condensation of two glutamine molecules that have been previously cyclized by intramolecular amide bond formation and then dehydrogenated. Expression of ind genes is strongly derepressed in the pecS background, indicating that PecS is the main regulator of this secondary metabolite synthesis. DNA band shift assays support a model whereby the PecS protein represses indA and indC expression by binding to indA and indC promoter regions. The regulatory link, via pecS , between indigoidine and virulence factor production led us to explore a potential role of indigoidine in E. chrysanthemi pathogenicity. Mutants impaired in indigoidine production were unable to cause systemic invasion of potted Saintpaulia ionantha . Moreover, indigoidine production conferred an increased resistance to oxidative stress, indicating that indigoidine may protect the bacteria against the reactive oxygen species generated during the plant defense response.

The main virulence factors of the phytopathogenic bacterium Erwinia chrysanthemi are pectinases which attack pectin, the major constituent of the plant cell wall. Of these enzymes, the alkaline isoenzyme named PelD in strain 3937 and PelE in strain EC16 has been described as being particularly important, based on virulence studies of plants. Expression of the pelD and pelE genes is tightly modulated by various regulators, including the KdgR repressor and the cyclic AMP-cyclic AMP receptor protein (CRP) activator complex. The use of a lacZ reporter gene allowed us to quantify the repression of E. chrysanthemi 3937 pelD expression exerted by PecS, another repressor of pectinase synthesis. In vitro DNA-protein interaction experiments, centered on the pelD and pelE wild-type or pelE mutated promoter regions, allowed us to define precisely the sequences involved in the binding of these three regulators and of RNA polymerase (RNAP). These studies revealed an unusual binding of the KdgR repressor and suggested the presence of a UP (upstream) element in the pelD and pelE genes. Investigation of the simultaneous binding of CRP, KdgR, PecS, and the RNAP to the regulatory region of the pelD and pelE genes showed that (i) CRP and RNAP bind cooperatively, (ii) PecS partially inhibits binding of the CRP activator and of the CRP-RNAP complex, and (iii) KdgR stabilizes the binding of PecS and prevents transcriptional initiation by RNAP. Taken together, our data suggest that PecS attenuates pelD and pelE expression rather than acting as a true repressor like KdgR. Overall, control of the pelD and pelE genes of E. chrysanthemi appears to be both complex and novel.

International audience; The plant pathogen Erwinia chrysanthemi produces three acyl-homoserine lactones (acyl-HSLs). One has been identified as N-(3-oxohexanoyl)-homoserine lactone (OHHL), and the two others were supposed to be N-(hexanoyl)-homoserine lactone (HHL) and N-(decanoyl)-homoserine lactone (DHL). The genes for a quorum-sensing signal generator (expI ) and a response regulator (expR ) were cloned. These genes are convergently transcribed and display high similarity to the expI-expR genes of Erwinia carotovora. ExpI is responsible for both OHHL and HHL production. Inactivation of expI had little effect on pectinase synthesis in E. chrysanthemi, as expression of only two of the pectate lyase genes, pelA and pelB, was decreased. E. chrysanthemi expR mutants still produced acyl-HSL and pectinases. However, gel shift and DNAse I footprinting experiments showed that the purified E. chrysanthemi ExpR protein binds specifically to the promoter regions of the five major pel genes. Addition of OHHL modified the ExpR-DNA bandshift profiles, indicating that ExpR interacts with OHHL and binds to DNA in different ways, depending on the OHHL concentration. Localization of the ExpR binding sites just upstream of promoter regions suggests that ExpR functions as an activator of pel expression in the presence of OHHL. The absence of a phenotype in expR mutants strongly suggests that at least an additional interchangeable ExpR homologue exists in E. chrysanthemi. Finally, transcription of expI ::uidA and expR ::uidA fusions is dependent on the population density, suggesting the existence of a quorum-sensing hierarchy in E. chrysanthemi. These results suggest that the expI-expR locus is part of a complex autoregulatory system that controls quorum sensing in E. chrysanthemi.

The main virulence factors of the phytopathogenic bacteria Erwinia chrysanthemi are pectinases that cleave pectin, a major constituent of the plant cell wall. The cyclic AMP receptor protein (CRP) was identified as the main activator of the pectinolysis genes. Gel shift and DNase I footprinting experiments showed that the purified E. chrysanthemi CRP protein binds specifically to the promoter regions of seven pectinolysis genes (pelB, pelC, pelD, pelE, ogl, kduI and kdgT) whose expression is positively regulated in vivo by CRP. In contrast, no interaction was observed between CRP and the promoter-operator region of pelA, whose expression is negatively regulated in vivo by CRP. Primer extension experiments demonstrated that each of the pelB, pelC, pelE and kduI genes is expressed from a unique sigma70 promoter, whereas ogl and kdgT possess three and two functional promoters respectively. The position of the CRP binding site relative to the transcription start site suggests that CRP acts as a primary activator at the pelB (via the CRP binding site 1), pelC, pelE, pelD, kdgTP1 and oglP2 promoters. In contrast, transcription at the kduI, oglP1 promoters seems to require another transcriptional activator in synergy with CRP. Investigation of the simultaneous binding of CRP and KdgR, the main repressor of pectinolysis genes, to the regulatory regions of pelB, pelC, pelD, pelE, ogl, kduI and kdgT genes showed that binding of KdgR is preferential and exclusive in the case of ogl and kdgT, whereas the binding of these two regulators is independent in the case of pelB, pelC, pelD, pelE and kduI. Taken together, our data suggest that the antagonistic effects of CRP and KdgR on the expression of the pectinolysis genes occur by different mechanisms, including direct competition between the two regulators or between the repressor and RNA polymerase for the occupation of a common DNA region on the target genes.

Summary The Erwinia chrysanthemi pecS gene encodes a repressor that negatively regulates the expression of virulence factors such as pectinases or cellulases. The cloned pecS gene was overexpressed using a phage T7 system. The purification of PecS involved DEAE-anion exchange and TSK-heparin columns and delivered the PecS protein that was purified to homogeneity. The purified repressor displayed an 18 kDa apparent molecular mass and an isoelectric point near to neutrality (PI = 6.5). Gel-filtration experiments revealed that the PecS protein is a dimer. Bandshift assays demonstrated that the PecS protein could specifically bind in vitro to the regulatory sites of the in vivo PecS-regulated genes. The interaction between the PecS protein and its DNA-binding site was characterized by a relatively low affinity (about 10−8 M). DNase I footprintings revealed short protected sequences only with the most in vivo PecS-regulated genes. Alignment of these PecS-binding sites did not show a well-conserved consensus sequence. lmmunoblotting demonstrated that the copy number of the PecS protein was approximately 50 dimers per cell. The low affinity of the PecS repressor for its DNA targets and the low cellular PecS content suggest the existence of E. chrysanthemi-specific factors able to potentiate PecS protein activity in vivo.

Erwinia chrysanthemi synthesizes and secretes a large number of pectinases. The major pectinases include a pectin methylesterase PemA and five isoenzymes of endo-pectate lyases PelA, PelB, PelC, PelD and PelE. In addition, secondary pectinases were identified: a pectin methylesterase PemB, two endopectate lyases PelL and PelZ, an exo-pectate lyase PelX and an exopolygalacturonase, PehX. The regulation of pectinase synthesis is very complex and dependent on many environmental conditions. It is induced by pectin catabolic products and affected by growth phase, catabolite repression, osmolarity, iron or oxygen starvation… Three regulators were identified by genetic analysis. The main repressor, KdgR, controls the transcription of pectinase genes, the intracellular catabolic pathway and the secretion machinery. The PecS repressor controls the production of pectate lyases and cellulases, the secretion machinery and the biosynthesis of a blue pigment. PecT acts as a repressor of the production of some pectate lyases. Other proteins are involved in the regulation of pectinase synthesis but their role is not well characterized.

We have solved the structure of the Bacillus subtilis pectate lyase (BsPel) in complex with calcium. The structure consists of a parallel beta-helix domain and a loop region. The alpha L-bounded beta-strand seen in BsPel is a new element of protein structure and its frequent occurrence suggests it is an important characteristic of the parallel beta-helix. A pronounced cleft is formed between the loops and the parallel beta-helix domain and we propose that this is the active site cleft. Calcium, essential for the activity of the enzyme, binds at the bottom of this cleft and an arginine residue close to the calcium, which is conserved across all pectin and pectate lyases, may be involved in catalysis.

The phytopathogenicity of the enterobacterium Erwinia chrysanthemi chiefly results from its capacity to degrade pectin, which is the major component of plant cell walls. This degradation requires the product of 12 genes which constitute independent transcriptional units. All these genes, including kdgT which encodes the 2-keto-3-deoxygluconate (KDG) transport system, are negatively regulated by the KdgR protein. The E. chrysanthemi kdgR gene was cloned into an expression vector and overexpressed in Escherichia coli. KdgR was then purified to homogeneity by two chromatographic steps as a dimer of approximately 62 kDa. Using gel retardation assays, we demonstrated that this purified repressor binds to the 25bp oligonucleotide (AAAAAAGAAACATTGTTTCATTTGT) present in the kdgT regulatory region. Dimethyl sulphate interference experiments revealed that the repressor interacts with four guanine bases and 10 adenine bases in the two strands of this KdgR box. KDG, an actual inducer of pectinolysis, releases the repressor from the operator complexes, whereas galacturonate, which is the precursor of the actual inducer, does not. These results suggest the existence of a specific interaction between KDG and KdgR protein. This study opens discussion on the relative affinity of the KdgR protein for the different operators of pectinolysis genes which are interpreted in terms of differential regulation.

In Erwinia chrysanthemi, all the genes involved in pectin degradation are controlled by the negative regulatory gene kdgR. 2-keto-3-deoxygluconate (KDG) is the inducing molecule that interacts with KdgR to allow the expression of all the genes of the kdg regulon. The inducing properties on the expression of genes regulated by kdgR of various analogs and derivatives of KDG were tested. All the inducers share the common moiety COOHCOCH2CHOHCC included in a pyranic cycle. Our results show that esterification of C1 prevents induction. Presence of a ketone function on C2 and absence of hydroxyl on C3 are necessary for induction. The nature and the configuration of substituent on C5 has no influence on induction. Two compounds have interesting properties: 5-O-methyl-KDG is a gratuitous inducer and gluconic acid can prevent induction.

Bacillus subtilis strain SO113 secretes a pectate lyase which is produced during the exponential death phase of growth, just before sporulation. This extracellular pectate lyase, which produces unsaturated products from polygalacturonate, was purified 35-fold from the culture supernatant of Bacillus subtilis by a CM Sephadex chromatography. It has an isoelectric point of about 9.6 and an Mr of 42,000. Optimum activity occurred at pH 8.4 and at 42 degrees C. Calcium has a stimulative effect on the enzyme activity while EDTA leads to enzyme inactivation. The pectate lyase has a specific activity of 131 mumol of aldehyde groups per min and per mg of protein. The Km of the purified enzyme for polygalacturonic acid was 0.862 g.l-1 and the Vmax for polygalacturonic acid hydrolysis was 1.475 mumol of unsaturated products per min and per mg of protein. By using monoclonal antibodies raised against Erwinia chrysanthemi 3937 pectate lyases, it was shown that pectate lyases b and c of this strain are immunologically closely related to the Bacillus subtilis pectate lyase.

Eight pathogenesis-related proteins extractable at pH 2.8 were found to accumulate in maize leaves after mercuric chloride treatment or brome mosaic virus infection. These proteins were called PRm (pathogenesis-related maize) proteins. Seven PRm proteins were purified to homogeneity by preparative polyacrylamide gel electrophoresis and their amino acid compositions determined. Estimated molecular weights in SDS-containing gels were: PRm 1 14.2 kDa; Prm 2 16.5 kDa; PRm 3 and PRm 4 25 kDa; PRm 6b 30.5 kDa; PRm 6a 32 kDa; PRm 7 34.5 kDa. Antisera raised against either PRm 3 or PRm 4 reacted specifically each with PRm 3 or PRm 4. Antisera raised against PRm 6b reacted with PRm 6b as well as with PRm 6a and antisera against PRm 7 reacted with PRm 7 and PRm 5. Tobacco anti-PR 1b antisera reacted with maize PRm 2. Chitinase (poly[1,4-(N-acetyl-β-D-glucosamide)]glycanhydrolase, EC 3.2.1.14) activity was found for PRm 3, PRm 4, PRm 5, and PRm 7.