Search

This article belongs to the Special Issue New Insights into the Milk., This study describes chemical, physical, microbiological and technological characteristics of red deer milk and the effect of lactation on these parameters in order to know their potential aptitude to elaborate dairy products. During 18 weeks, milk from five hinds was monitored for composition, bacteriology, somatic cell count (SCC), physical properties and rennet coagulation. Mean values (g/100 g) for fat, protein, lactose and dry matter were 10.4, 7.1, 4.3 and 24.2, respectively, and for urea, 265 mg/100 mL. Except for lactose, a significant increase in these components was observed (p < 0.01) as lactation progressed. The average values for bacteriology and SCC were 5.3 log cfu/mL and 4.7 log cells/mL, respectively. Regarding physical properties, conductivity (mean: 2.8 ms/cm), viscosity (3.1 Cp), coordinates L* (89.9) and a* (−3.1) and milk fat globule diameter (D4,3: 6.1 µm) increased along with lactation while density (1.038 g/mL) decreased (p < 0.01). The pH (6.7), acidity (22.9° Dornic), coordinate b* (8.4) and ethanol stability (66.6% v/v) were stable during the study period. The stage of lactation also has a significant impact on milk coagulation properties and mean curd yield was 3.29 g/10 mL. These results suggest that red deer milk could be a potential innovative source of milk for the dairy industry., This work was supported by the Junta de Comunidades de Castilla-La Mancha and the European Union Fund for Regional Development (SBPLY/19/180501/000115 project and funds from the “Plan Propio” of the University of Castilla-La Mancha).

The chemokine (C-C motif) ligand 21 (CCL21) is a cytokine that attracts CCR7-positive cells to the T cell (paracortical) zone of lymph nodes by directional migration of these cells along the CCL21 gradient. In this article, we sought to mimic this chemotactic mechanism, by identifying a novel aptamer that binds CCL21 with high affinity. In vitro selection of DNA aptamers was performed by the Systematic Evolution of Ligands by Exponential Enrichment. Quantitative polymerase chain reaction (qPCR) and enzyme-linked oligonucleotide assay were used to screen for high-affinity aptamers against human and mouse CCL21 protein, respectively. Three such aptamers were identified. Surface plasmon resonance showed equilibrium dissociation constant (Kd) for these three aptamers in the nano to picomolar range. Cytotoxicity assays showed

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.

A synthetic strategy has been developed for the preparation of new peripheral amine- or ammonium-terminated carbosilane dendrimers of type nG-[Si(OCH2CH2NMe2)y]x or nG-[Si(OCH2CH2NMe3+I–)y]x, respectively. It consists of the alcoholysis of well-known chlorosilane-terminated dendrimers with N,N-dimethylethanolamine and the subsequent quaternization with MeI. All these systems are susceptible to hydrolysis, although the decomposition depends on concentration and dendrimer generation. Evaluation of dendrimer toxicities by phase-contrast light microscopy and MTT assay were carried out, and evidence of dendrimer/oligonucleotide complex formation was carried out by gel electrophoresis. (© Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, Germany, 2006)

Dendrimers have been proposed as new carriers for drug delivery. They have distinctive characteristics, such as uniform and controlled size, monodispersity and modifiable surface group functionality, which make them extremely useful for biomedical applications. In this study, the binding capacity of water-soluble carbosilane dendrimers was examined. A double fluorimetric titration method with 1-anilinonaphthalene-8-sulphonic acid (ANS) was used to estimate the binding constant and the number of binding centers per dendrimer molecule. The data obtained suggest that ANS interacts non-covalently with the dendrimers. Second generation dendrimers have an open, asymmetric structure that allows them to encapsulate ANS. The ability of the polymers to interact with DNA was assessed by an ethidium bromide (EB) displacement assay. All the dendrimers studied bound to DNA in competition with EB, though the strength of binding varied. Dendrimer interactions with a protein (BSA) were tested using fluorescence quenchers. The dendrimers caused no conformation change in the protein, indicating that interactions between carbosilane dendrimers and BSA are weak and occur preferentially at the protein surface.

8 pages, 10 figures.-- PMID: 17551637 [PubMed].-- Printed version published Jun 21, 2007., Treatment of dendriplexes formed between water-soluble carbosilane dendrimers and phosphorothioate oligodeoxynucleotides (ODN) with the anionic detergent sodium dodecyl sulfate disrupted the complexes indicating that the nature of the union in such dendriplexes is merely electrostatic. However, dendriplexes were not dissociated by serum proteins like bovine or human serum albumins, as assessed by gel electrophoresis and fluorescence experiments. This would imply a dendrimer-mediated protective effect able to prevent ODN interactions with serum proteins and additionally could translate into a reduction of the ODN doses needed to achieve the biological effects. The employment of carbosilane dendrimers as carriers may solve the problem of ODN kidnapping by plasmatic proteins as a key drawback for therapeutics involving ODNs. As examples, transfection processes on normal primary peripheral blood cells and diagnosis of HIV infection in the presence of serum have been assayed., We thank the Ministerio de Ciencia y Tecnología (project CTQ2005-00795/BQU), the Plan Nacional de Salud (grant SAF- 2004-06778, SAF-2003-09209), Red temática de Investigación Cooperativa Sanitaria ISCIII(REDRISRD06/0006),Fundación Caja Navarra, FIPSE (36514/05), the Dirección General de Investigación Científica y T´ecnica (grant BQU2004-02048), and Fundació LA CAIXA (BM04-52-0) for financial support. J. F. B.-M. is supported by a grant of Fondos de Investigación Sanitaria (CD05/00153). Dr Dzmitry Shcharbin is a beneficiary of a Marie Curie International Incoming Fellowship within the 6th EU Framework Programme (grant 510018).

Novel amine- or ammonium-terminated carbosilane dendrimers of type nG-[Si{OCH2(C6H3)-3,5-(OCH2CH2NMe2)2}]x, nG-[Si{O(CH2)2N(Me)(CH2)2NMe2}]x and nG-[Si{(CH2)3NH2}]x or nG-[Si{OCH2(C6H3)-3,5-(OCH2CH2NMe3 +I-)2}]x, nG-[Si{O(CH2)2N(Me)(CH2)2NMe3 +I-}]x, and nG-[Si{(CH2)3NH3 +Cl-}]x have been synthesized and characterized up to the third generation by two strategies: 1) alcoholysis of Si--Cl bonds with amino alcohols and subsequent quaternization with MeI, and 2) hydrosilylation of allylamine with Si--H bonds of the dendritic systems and subsequent quaternization with HCl. Quaternized carbosilane dendrimers are soluble in water, although degradation is apparent due to hydrolysis of Si--O bonds. However, dendrimers containing Si--C bonds are water-stable. The biocompatibility of the second-generation dendrimers in primary cell cultures of peripheral blood mononuclear cells (PBMCs) and erythrocytes have been analyzed, and they show good toxicity profiles over extended periods. In addition, we describe a study on the interactions between the different carbosilane dendrimers and DNA oligodeoxynucleotides (ODNs) and plasmids along with a comparative analysis of their toxicity. They can form complexes with DNA ODNs and plasmids at biocompatible doses via electrostatic interaction. Also a preliminary transfection assay has been accomplished. These results demonstrate that the new ammonium-terminated carbosilane dendrimers are good base molecules to be considered for biomedical applications.

Anionic carbosilane dendrimers of generations 1-3 have been synthesized containing carboxylate G(n)X(C(2)H(4)CO(2)Na)(m) and sulfonate G(n)X(C(2)H(4)SO(3)Na)(m) peripheral groups and derived from two different cores, 1,3,5-(HO)(3)C(6)H(3) (X = O(3)) and Si(C(3)H(5))(4) (X = Si). The peripheral anionic groups make these dendrimers water soluble, despite their highly hydrophobic framework. These dendrimers present a net negative charge in water, which was influenced by the pH of the medium. This characteristic was studied by pH titration. Also molecular modeling calculations have been performed to study differences in an aqueous medium between carboxylate and sulfonate dendrimers of different cores. The results obtained were also compared with those obtained from DOSY NMR experiments and zeta-potential measurements.