Search

The aim of this study was to isolate Aspergillus section Nigri from onion samples bought in supermarkets and to analyze the fungal isolates by means of molecular data in order to differentiate A. niger and A. welwitschiae species from the other non-toxigenic species of black aspergilli, and detect genes involved in the biosynthesis of ochratoxin A and fumonisin B2. Aspergillus section Nigri were found in 98% (94/96) of the onion samples. Based on the results of multiplex PCR (performed on 500 randomly selected strains), 97.4% of the Aspergillus section Nigri strains were recognized as A. niger/A. welwitschiae. Around half of them were subjected to partial sequencing of the CaM gene to distinguish one from the other.Atotal of 97.9% of the isolates were identified as A. welwitschiae and only 2.1% as A. niger. The fum8 gene, involved in fumonisin B2 biosynthesis, was found in 36% of A. welwitschiae isolates, but radH and pks genes, involved in ochratoxin A biosynthesis, were found in only 2.8%. The presence/absence of fum8 gene in the A. welwitschiae genome is closely associated with ability/inability of the isolates to produce fumonisin in vitro. Based on these results,we suggest that in-depth studies are conducted to investigate the presence of fumonisins in onion bulbs. FAPESP / CAPES / CNPq

The garlic contains sulfur bioactive compounds responsible for medicinal properties. The decrease of these compounds due to inadequate storage conditions reduces the beneficial properties and favors infection by microorganisms. Several studies have shown high frequency of garlic infected with Aspergillus section Nigri that potentially produce mycotoxin. Garlic samples were collected in markets of Brazil and a total of 32 samples (of 36) had the fungal infection with predominant genus Aspergillus (50.3%), Penicillium (34.7%), and Fusarium (11%). A total of 63% (649/1031) of infection with Aspergillus section Nigri, of which 60 isolates were selected for analysis of genetic variability that resulted in 4 clusters. Representatives of clusters were identified by the calmodulin gene. Isolates from cluster I were subdivided into A-I and identified as A. niger (16 isolates) and the isolates of clusters B-I, II, and III were identified as A. welwitschiae (43 isolates). Besides, an isolate of the IV-cluster was identified by A. luchuensis. Further, we used the multiplex PCR to verify genotypes of 59 isolates, and none of these had OTA production-associated genotype. Moreover, 19 A. welwitschiae and 15 A. niger were FB2 production-associated genotype. Our study is the first report to the incidence of garlic infection in Brazil and to show that A. welwitschiae causes most of these infections.

Made available in DSpace on 2021-06-25T11:43:25Z (GMT). No. of bitstreams: 0 Previous issue date: 2020-01-01. Added 1 bitstream(s) on 2021-07-15T15:05:47Z : No. of bitstreams: 1 S1516-89132020000100331.pdf: 533608 bytes, checksum: 8f247c86cd1b6e458914c584126394d0 (MD5) Fundacao de Apoio ao Desenvolvimento do Ensino, Ciencia e Tecnologia do Estado de Mato Grosso do Sul (FUNDECT) Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) The alpha-tomatine is a steroidal glycoalkaloid found in immature tomatoes (Lycopersicon esculentum) that has important biological functions including the inhibition of cancer cell growth and preventing metastasis. This study aimed to evaluate the effects of alpha-tomatine on cytotoxicity, cellular proliferation, apoptosis, and mRNA expression of APC, CCNA2, beta-catenin, CASP9, BAK, BAX and BCL-XL in colorectal adenocarcinoma cell line HT-29. HT29 cells were treated with three concentrations of alpha-tomatine (0.1, 1 and 10 mu g/mL), although only the 1 mu g/mL concentration of alpha-tomatine was used to evaluate genetic expression patterns by real time-PCR. Results showed that alpha-tomatine was cytotoxic only at the 10 mu g/mL concentration. Cell proliferation was significantly inhibited after the first 24 hours of treatment only with concentrations of 10 mu g/mL. In contrast, there were no significant differences in apoptosis for any treatment. In the gene expression studies, only APC expression was significantly altered by alpha-tomatine treatment. In conclusion, tomatine has antiproliferative activity in the first 24h of treatment, does not induce apoptosis in this cell line and causes disruption of cell membranes, thereby increasing the expression of APC gene related to cell cycle. Univ Estadual Paulista, Rio Claro, SP, Brazil Univ Fed Mato Grosso do Sul, Fac Med, Campo Grande, MS, Brazil Univ Estadual Londrina, Londrina, Parana, Brazil Univ Estadual Paulista, Rio Claro, SP, Brazil

Background: Genistein (5,7-Dihydroxy-3-(4-hydroxyphenyl)-4H-1-benzopyran-4-one) is the most abundant isoflavone in soybean, which has been associated with a lower risk of development of cancer and cardiovascular diseases. Of particular interest regarding cancer preventive properties of flavo-noids is their interaction with cytochrome P450 enzymes (CYPs). However, contradictory data report the effect of genistein on expression of СYPs enzymes. Objective: The aim of this study was to investigate the effects of genistein on cytochrome P450 (CYP) gene expression levels in human hepatocellular carcinoma (HepG2/C3A) and colon adenocarcinoma (HT29) cells. Methods: Real-time RT–PCR was used to examine the expression of genes families involved in xenobi-otic metabolism, such as CYP1 (CYP1A1, CYP1B1), CYP2 (CYP2E1, CYP2D6), CYP3 (CYP3A4); and of a family involved in the catabolism of the all-trans-retinoic acid (ATRA), CYP26 (CYP26A1, CYP26B1). Results: RT-qPCR data analysis showed that after 12 h of exposure of HepG2/C3A cells to genistein (5 and 50 µM) there was an upregulation of CYP1A1 and CYP1B1 and downregulation of CYP2D6, CYP26A1 and CYP26B1 mRNA levels. There was no change in the mRNA levels of CYP P450 genes in HT29 cells. Conclusion: Our results suggest that treatment with genistein in non-toxic concentrations may impact the expression level of CYPs involved in the biotransformation of xenobiotics and drug metabolizing en-zymes. Moreover, the downregulation of ATRA metabolism-related genes opens a new research path for the study of genistein as retinoic acid metabolism blocking agent for treating cancer and other patholo-gies.

Some species from Aspergillus section Nigri are morphologically very similar and altogether have been called A. niger aggregate. Although the species included in this group are morphologically very similar, they differ in their ability to produce mycotoxins and other metabolites and their taxonomical status has evolved continuously. Among them, A. niger and A. welwitschiae are ochratoxin A and fumonisin B2 producers and their detection and/or identification is of crucial importance for food safety. The aim of this study was the development of a real-time PCR-based method for simultaneous discrimination of A. niger and A. welwitschiae from other species of the A. niger aggregate isolated from coffee beans. One primer pair and a hybridization probe specific for detection of A. niger and A. welwitschiae strains were designed based on the BenA gene sequences, and used in a Real-time PCR assay for the rapid discrimination between both these species from all others of the A. niger aggregate. The Real-time PCR assay was shown to be 100% efficient in discriminating the 73 isolates of A. niger/A. welwitschiae from the other A. niger aggregate species analyzed as a negative control. This result testifies to the use of this technique as a good tool in the rapid detection of these important toxigenic species.

Made available in DSpace on 2018-12-11T17:22:02Z (GMT). No. of bitstreams: 0 Previous issue date: 2018-08-01 Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) Financiadora de Estudos e Projetos Background/Aims: Compared with non-obese individuals, obese individuals commonly store more vitamin D in adipose tissue. VDR expression in adipose tissue can influence adipogenesis and is therefore a target pathway deserving further study. This study aims to assess the role of 1,25(OH)2D3 in human preadipocyte proliferation and differentiation. Methods: RTCA, MTT, and trypan blue assays were used to assess the effects of 1,25(OH)2D3 on the viability, proliferation, and adipogenic differentiation of SGBS cells. Cell cycle and apoptosis analyses were performed with flow cytometry, triglycerides were quantified, and RT-qPCR was used to assess gene expression. Results: We confirmed that the SGBS cell model is suitable for studying adipogenesis and demonstrated that the differentiation protocol induces cell maturation, thereby increasing the lipid content of cells independently of treatment. 1,25(OH)2D3 treatment had different effects according to the cell stage, indicating different modes of action driving proliferation and differentiation. In preadipocytes, 1,25(OH)2D3 induced G1 growth arrest at both tested concentrations without altering CDKN1A gene expression. Treatment with 100 nM 1,25(OH)2D3 also decreased MTT absorbance and the lipid concentration. Moreover, increased normalized cell index values and decreased metabolic activity were not induced by proliferation or apoptosis. Exposure to 100 nM 1,25(OH)2D3 induced VDR, CEBPA, and CEBPB expression, even in the preadipocyte stage. During adipogenesis, 1,25(OH)2D3 had limited effects on processes such as VDR and PPARG gene expression, but it upregulated CEBPA expression. Conclusions: We demonstrated for the first time that 1,25(OH)2D3 induces changes in preadipocytes, including VDR expression and growth arrest, and increases the lipid content in adipocytes treated for 16 days. Preadipocytes are important cells in adipose tissue homeostasis, and understanding the role of 1,25(OH)2D3 in adipogenesis is a crucial step in ensuring adequate vitamin D supplementation, especially for obese individuals. São Paulo State University (UNESP) School of Medicine Department of Pathology Maastricht University Department of Bioinformatics - BiGCaT NUTRIM School for Nutrition and Translational Research in Metabolism State University of Londrina (UEL) Department of Biochemistry and Biotechnology State University of Londrina (UEL) Department of General Biology Maastricht University Maastricht Centre for Systems Biology (MaCSBio) Centro de Ciências Bio. Dept. de Bio. Geral Lab. de Genética Toxicológica Univ. Estadual de Londrina Rodovia Celso Garcia Cid, PR 445 Km 380, Campus Universitário São Paulo State University (UNESP) School of Medicine Department of Pathology CNPq: 150067/2017-8 CAPES: 9933/2014-00

The effect of low-level laser therapy (LLLT) on the healing of skin lesions has been evaluated in many studies; however, the molecular mechanisms involved in the biostimulatory effects resulting from this treatment need to be better understood. The paper aims to analyze the effects of LLLT (660 nm) at doses of 1 and 5 J/cm2 on cell viability and expression of vascular endothelial growth factor (VEGF) and interleukin (IL6) genes in L929 fibroblast cells. The dose-response curve was performed with the GaInAlAs (660 nm) laser-treated cells at energy rates of 1 and 5 J/cm2. Cell viability was quantified at 24, 48, and 72 h after irradiation and the effects of TLBP on the cytoskeleton and endoplasmic reticulum were evaluated by fluorescence microscopy and the RT-qPCR method was used for the analysis of gene expression. It was observed that the 72 h group had a statistically significant increase in cell viability compared to the 48 h group (p

Aims Fructooligosaccharides (FOSs) known for their health properties and β-(2→6)-levan-type FOSs have shown prebiotic and immunomodulatory activities that overcome those of commercial β-(2→1)-FOSs, but costs do not favour their use. Moreover, FOSs can reach the bloodstream through the diet, and little is known about their direct effect on cells. The aim of this work was to produce high-content FOSs by Bacillus subtilis natto CCT7712 in a bioreactor using commercial sucrose and to evaluate their antiproliferative effects in OVCAR-3 cells. Methods and results FOS production reached 173·60 g l-1 , 0·2 vvm aeration and uncontrolled pH. Levan-type FOSs, composed of β-(2 → 6) links and mainly GF3 (6-nystose), were identified using RMN spectroscopy, FT-IR and ESI-MS. FOSs decreased the viability and proliferation of OVCAR-3 cells, and the effects were associated with an increased pro-inflammatory response by the induction of IL-8 and TNF-α, and the repression of ER-β genes. The metabolic profiles showed disruption of cellular homeostasis that can be associated with a decrease in proliferation. Conclusions The high production of levan-type FOSs from B. subtilis natto CCT7712 in a bioreactor was achieved, and they showed antiproliferative potential in OVCAR-3 cells. Significance and impact of the study FOS could be a good target for future therapeutic studies and commercial use.

Made available in DSpace on 2018-11-26T15:37:23Z (GMT). No. of bitstreams: 0 Previous issue date: 2016-12-01 Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) Fundacao Araucaria, Brazil Monastrol is an allosteric inhibitor of the mitotic kinesin Eg5 that exhibits an antiproliferative effect against several cell lines. We investigated the antiproliferative effect of monastrol on human breast adenocarcinoma cells (MCF-7) and mammary epithelial cells (HB4a, non-tumoral). Monastrol treatment decreased cell viability only in MCF-7 tumor cells. Real-time cell growth kinetic analysis showed a decrease in the proliferation of MCF-7 cells exposed to monastrol, while in the HB4a cells, only a concentration of 100 mu M was able to induce this effect. In a cell cycle analysis, exposure of MCF-7 cells to monastrol led to an increased population of cells in both the G1 and G2/M phases. In HB4a cells, the proportion of cells in the G2/M phase was increased. Monastrol led to an increased mitotic index in both cell lines. Monastrol was not able to induce cell death by apoptosis in any of the cell lines studied. Gene expression analysis was performed to measure the mRNA levels of cell cycle genes, DNA damage indicator gene, and apoptotic related genes. Treatment with monastrol induced in MCF-7 cells a 5-fold increase in the mRNA levels of the CDKN1A gene, an inhibitor of CDKs related with cell cycle arrest in response a stress stimulus, and a 2-fold decrease in CDKN1C mRNA levels in HB4a cells. These results provide evidence that monastrol has a greater antiproliferative effect on MCF-7 tumor cells compared with non-tumor HB4a cells; however, no selective is observed. Univ Estadual Londrina, Dept Biol Geral, Rodovia Celso Garcia CID,PR 445,Km380,Caixa Posta, BR-86057970 Londrina, Parana, Brazil Univ Fed Minas Gerais, Dept Quim, Belo Horizonte, MG, Brazil Univ Estadual Paulista, Dept Patol, Sao Paulo, Brazil Univ Estadual Paulista, Dept Patol, Sao Paulo, Brazil

Made available in DSpace on 2018-11-26T16:33:04Z (GMT). No. of bitstreams: 0 Previous issue date: 2016-06-01 Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) Fundacao Araucaria, Brazil The search for anticancer drugs has led researchers to study salinomycin, an ionophore antibiotic that selectively destroys cancer stem cells. In this study, salinomycin was assessed in two human cell lines, a breast adenocarcinoma (MCF-7) and a non-tumor breast cell line (HB4a), to verify its selective action against tumor cells. Real-time assessment of cell proliferation showed that HB4a cells are more resistant to salinomycin than MCF-7 tumor cell line, and these data were confirmed in a cytotoxicity assay. The half maximal inhibitory concentration (IC50) values show the increased sensitivity of MCF-7 cells to salinomycin. In the comet assay, only MCF-7 cells showed the induction of DNA damage. Flow cytometric analysis showed that cell death by apoptosis/necrosis was only induced in the MCF-7 cells. The increased expression of GADD45A and CDKN1A genes was observed in all cell lines. Decreased expression of CCNA2 and CCNB1 genes occurred only in tumor cells, suggesting G2/M cell cycle arrest. Consequently, cell death was activated in tumor cells through strong inhibition of the antiapoptotic genes BCL-2, BCL-XL, and BIRC5 genes in MCF-7 cells. These data demonstrate the selectivity of salinomycin in killing human mammary tumor cells. The cell death observed only in MCF-7 tumor cells was confirmed by gene expression analysis, where there was downregulation of antiapoptotic genes. These data contribute to clarifying the mechanism of action of salinomycin as a promising antitumor drug and, for the first time, we observed the higher resistance of HB4a non-tumor breast cells to salinomycin. Univ Estadual Londrina CCB BIO, Lab Genet Toxicol, Campus Univ Caixa Postal 10011, BR-86057970 Londrina, Parana, Brazil Univ Estadual Paulista, Dept Patol, Botucatu, SP, Brazil Univ Estadual Paulista, Dept Patol, Botucatu, SP, Brazil

Aspergillus niger "aggregate" is an informal taxonomic rank that represents a group of species from the section Nigri. Among A. niger "aggregate" species Aspergillus niger sensu stricto and its cryptic species Aspergillus welwitschiae (=Aspergillus awamori sensu Perrone) are proven as ochratoxin A and fumonisin B2 producing species. A. niger has been frequently found in tropical and subtropical foods. A. welwitschiae is a new species, which was recently dismembered from the A. niger taxon. These species are morphologically very similar and molecular data are indispensable for their identification. A total of 175 Brazilian isolates previously identified as A. niger collected from dried fruits, Brazil nuts, coffee beans, grapes, cocoa and onions were investigated in this study. Based on partial calmodulin gene sequences about one-half of our isolates were identified as A. welwitschiae. This new species was the predominant species in onions analyzed in Brazil. A. niger and A. welwitschiae differ in their ability to produce ochratoxin A and fumonisin B2. Among A. niger isolates, approximately 32% were OTA producers, but in contrast only 1% of the A. welwitschiae isolates revealed the ability to produce ochratoxin A. Regarding fumonisin B2 production, there was a higher frequency of FB2 producing isolates in A. niger (74%) compared to A. welwitschiae (34%). Because not all A. niger and A. welwitschiae strains produce ochratoxin A and fumonisin B2, in this study a multiplex PCR was developed for detecting the presence of essential genes involved in ochratoxin (polyketide synthase and radHflavin-dependent halogenase) and fumonisin (α-oxoamine synthase) biosynthesis in the genome of A. niger and A. welwitschiae isolates. The frequency of strains harboring the mycotoxin genes was markedly different between A. niger and A. welwitschiae. All OTA producing isolates of A. niger and A. welwitschiae showed in their genome the pks and radH genes, and 95.2% of the nonproducing isolates did not contain these genes. The α-oxoamine synthase gene was detected in 100% and 36% of the A. niger and A. welwitschiae isolates, respectively. The loss of ochratoxin A production in A. niger and A. welwitschiae is highly associated with gene deletions within the ochratoxin biosynthetic gene cluster. The loss of fumonisin production in A. welwitschiae is associated with gene deletions within the fumonisin biosynthetic gene cluster, but this is not the case with A. niger.

The presence of Aspergillus section Flavi and aflatoxins in sugarcane as well as in by-products, such as molasses, sugar, yeast cream and dried yeast, collected from different fields and processing plants in Sao Paulo state, were investigated throughout the sugarcane production chain. A total of 246 samples was collected and analyzed and 226 isolates of Aspergillus section Flavi were isolated. Aspergillus section Flavi strains were found in sugarcane juice, milled sugarcane, stalk, soil and dried yeast samples. Among the isolates of Aspergillus section Flavi submitted to polyphasic identification (n = 57), Aspergillus novoparasiticus and Aspergillus arachidicola were predominantly found. A significant proportion of the isolates (84.5%) were found to have morphological and physiological characteristics of A. novoparasiticus. Most samples, with the exception of sugar, showed some aflatoxin contamination. The highest level was in dried yeast with an average of 2.55 μg/kg and maximum value of 10.19 μg/kg. This is the first report of contamination of sugarcane by A. novoparasiticus.

Monastrol and its analog oxomonastrol differ by replacement of the sulfur atom present in monastrol to an oxygen atom in oxomonastrol. Monastrol inhibits the mitotic kinesin family member 11 (EG5), which has been studied for its potential use in cancer therapy. The aim of this study was to investigate the effect of monastrol and oxomonastrol on HepG2/C3A cells. Our results showed that monastrol induced DNA damage, reduced cell proliferation, and up-regulated the cytochrome P450 family 1 subfamily A member 1 (CYP1A1) mRNA levels. However, oxomonastrol was cytotoxic only at the highest concentrations used, without reducing cell proliferation and viability. Moreover, no genotoxic damage or alteration of levels of mRNA were found. Our results suggest that monastrol has greater antiproliferative activity compared to oxomonastrol, and this effect is probably related to the DNA damage induced by monastrol and its possible bioactivation demonstrated by the increase in CYP1A1 mRNA expression. Moreover, these effects appear to be related to the presence of the sulfur atom in its structure.

The exploitation of the Brazil nut is one of the most important activities of the extractive communities of the Amazon rainforest. However, its commercialization can be affected by the presence of aflatoxins produced by fungi, namely Aspergillus section Flavi. In the present study, we investigated a collection of Aspergillus nomius strains isolated from Brazil nuts using different approaches, including morphological characters, RAPD and AFLP profiles, partial β-tubulin and calmodulin nucleotide sequences, aflatoxin patterns, as well as tolerance to low water activity in cultured media. Results showed that most of the isolates do belong to A. nomius species, but a few were re-identified as Aspergillus pseudonomius, a very recently described species. The results of the analyses of molecular variance, as well as the high pairwise FST values between A. nomius and A. pseudonomius suggested the isolation between these two species and the inexistence of gene flow. Fixed interspecific nucleotide polymorphisms at β-tubulin and calmodulin loci are presented. All A. pseudonomius strains analyzed produced aflatoxins AFB1, AFB2, AFG1 and AFG2. This study contains the first-ever report on the occurrence in Brazil nuts of A. pseudonomius. The G-type aflatoxins and the mycotoxin tenuazonic acid are reported here for the first time in A. pseudonomius.

Soybean isoflavonoids have received significant attention due to their potential anticarcinogenic and antiproliferative effects and possible role in many signal transduction pathways. However, their mechanisms of action and their molecular targets remain to be further elucidated. In this paper, we demonstrated that two soybean isoflavones (genistein and daidzein) reduced the proliferation of the human colon adenocarcinoma grade II cell line (HT-29) at concentrations of 25 and 50-100 μM, respectively. We then investigated the effects of genistein and daidzein by RT-PCR on molecules that involved in tumor development and progression by their regulation of cell proliferation. At a concentration of 50 μM genistein, there was suppressed expression of β-catenin (CTNNBIP1). Neither genistein nor daidzein affected APC (adenomatous polyposis coli) or survivin (BIRC5) expression when cells were treated with concentrations of 10 or 50 μM. These data suggest that the down-regulation of β-catenin by genistein may constitute an important determinant of the suppression of HT-29 cell growth and may be exploited for the prevention and treatment of colon cancer.

Cardiovascular diseases associated with thrombosis are one of the main causes of death all around the world. Urokinase, streptokinase, and tissue plasminogen activator are the major thrombolytic agents used to treat thrombosis. However, the fact that these agents have several side effects and high prices has driven the search for safer and more economically viable compounds for the treatment of cardiovascular diseases. Thus, the aim of this study was to evaluate the potential of fungi isolated from industrial effluents to produce fibrino(geno)lytic enzymes. The selection of the protease-producing strains showed that only the BF20 strain was able to produce proteolytic halos in milk agar. This strain identified as belonging to the genus Penicillium was cultivated in submerged fermentation. Different media composition were tested to evaluate proteolytic activity, and the results showed that the medium containing 0.1% yeast extract and 1% skim milk, pH 5.0, present higher azocaseinolytic activity (0.24 U mL-1 min.-1). This sample also showed the ability to degrade fibrinogen and fibrin after 15 and 120 min. of incubation, respectively. These results indicate that the BF20 strain has a thrombolytic potential, effectively degrading fibrinogen and fibrin, having great application in the health area.

Approximately 70 % of Aspergillus westerdijkiae strains are able to produce ochratoxin A (OTA), a nephrotoxic and carcinogenic mycotoxin which have been found in cereal and food commodities. Despite of its importance there is, up to now, no information available about which genes are differentially expressed between A. westerdijkiae ochratoxin-producing and non-producing strains. Using cDNA RDA approach we successfully sequenced 231 raw ESTs expected to be enriched in the ochratoxin-producing strain. BLASTX searches against the public databases showed that of these, 205 ESTs (79 %) exhibited significant similarities with proteins of known functions, 28 ESTs (11 %) had matches to hypothetical proteins, and the remaining 27 ESTs (10 %) had no significant hits. EST alignment resulted in a total of 14 non-redundant consensus sequences. Three putative genes encoding oxidoreductases were validated as up-expressed in the OTA producer strain using RT-qPCR approach. The expression of the putative genes encoding a cytochrome P450 family protein, 3-hydroxyphenylacetate-6-hydroxylase, and endoplasmic reticulum oxidoreductin were higher (32-, 2.8- and 20-fold respectively) in the OTA producer strain compared to the non-producer strain.

The identification of antitumoral substances is the focus of intense biomedical research. Two structural analogues of thalidomide, LNO3 and L3, are two synthetic compounds that might possess such antitumor properties. We evaluated the toxicological effects of these substances, including cytotoxicity, genotoxicity and induction of apoptosis in HTC cells. Additionally, the production of free radicals (nitric oxide and superoxide) was investigated, and the expression of caspases genes 3, 8, and 9 were determined by RT-qPCR. The compounds exhibited cytotoxic effects that resulted in inhibited cell proliferation. LNO3 showed to be more effective and toxic than L3 in all assays. LNO3 stimulated the release of NO and superoxide, which was accompanied by the formation of peroxynitrite. Apoptosis was induced in a dose-dependent manner by both compounds; however, the expression of caspases 3, 8 and 9 was unchanged. These results suggested that L3 and LNO3 possess antiproliferative and pro-apoptotic effects in HTC cells. Additionally, although they exhibited cytotoxicity, L3 and LNO3 might be useful coadjuvants in tumor treatment studies.

Made available in DSpace on 2018-11-27T10:20:24Z (GMT). No. of bitstreams: 0 Previous issue date: 2016-01-17 Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) Fundacao Araucaria, Brazil The dibenzylbutyrolactone lignan (-)-cubebin, which is extracted from the seeds of the pepper Piper cubeba, has shown promise as an anti-inflammatory, analgesic, leishmanicidal, antiproliferative, and trypanocidal compound. Given the therapeutic potential of (-)-cubebin, this study aimed to investigate its safety profile by analyzing cytotoxicity, mutagenicity, cell proliferation kinetics, induction of apoptosis, and expression of pro-apoptotic genes in human colon adenocarcinoma cells (HT29) exposed to (-)-cubebin. MTT cytotoxicity assays demonstrated that (-)-cubebin was cytotoxic only at 280 mu M, whereas it was not cytotoxic at 2.8, 14, or 28 mu M. Data demonstrated that (-)-cubebin was not mutagenic as evidenced by a micronucleus (MN) assay, did not alter cell-growth kinetics over 4 d, and showed absence of induced apoptosis after 24 h. Further, CASP8 and CASP9 gene expression was not markedly changed in HT29 cells exposed to 28 mu M or 70 mu M (-)-cubebin for 12 h. Based on our observations, (-)-cubebin was cytotoxic at a concentration of 280 mu M, suggesting that the use of this concentration should be avoided. However, lower concentrations exerted no apparent damaging effects, indicating that this lignan is safe to use for pharmacological purposes at certain concentrations. Univ Estadual Londrina, BR-86057970 Londrina, Parana, Brazil Univ Estadual Paulista, Marilia, SP, Brazil Univ Estadual Paulista, Botucatu, SP, Brazil Univ Estadual Paulista, Marilia, SP, Brazil Univ Estadual Paulista, Botucatu, SP, Brazil

Aspergillus westerdijkiae is a new species of fungus that was recently dismembered from Aspergillus ochraceus taxon. Most isolates of A. westerdijkiae are able to produce large amounts of a mycotoxin called ochratoxin A (OA). OA has been found in food and beverages, such as coffee. A. westerdijkiae is very similar to A. ochraceus , and several isolates previously identified as A. ochraceus are now identified as A. westerdijkiae . By using sequences of the β-tubulin gene, we analyzed several isolates from Brazilian coffee bean samples, previously identified as A. ochraceus , to compare with those of A. westerdijkiae . In fact, most (84%) were identified as A. westerdijkiae . Since this species consistently produces large amounts of OA, we developed a specific primer-pair for detecting and quantifying it in coffee beans by using real-time PCR. The primers Bt2Aw-F 5′TGATACCTTGGCGCTTGTGACG and Bt2Aw-R 5′CGGAAGCCTAAAAAATGAAGAG provided an amplicon of 347 bp in all A. westerdijkiae isolates, and no cross-reaction was observed using DNA from A . ochraceus . The sensitivity of real-time PCR was more than 100 times higher than the cfu technique.

Aspergillus westerdijkiae is a potent ochratoxin A (OTA) producer that has been found in coffee beans. OTA is known to have nephrotoxic effects and carcinogenic potential in animal species. Here we report for the first time the Agrobacterium-mediated transformation for Aspergillus westerdijkiae and the generation of ochratoxin-defective mutants. Conidia were transformed to hygromycin B resistance using strain AGL-1 of Agrobacterium tumefaciens. The obtained transformation frequency was up to 47 transformants per 106 target conidia. Among 600 transformants, approximately 5% showed morphological variations. Eight transformants with consistently reduced OTA production were obtained. Two of these transformants did not produce OTA (detection limit: 0.1 µg/kg); the other six mutants produced lower amounts of OTA (1%–32%) compared with the wild-type strain. By using thermal asymmetric interlaced polymerase chain reaction, we successfully identified a putative flavin adenine dinucleotide monooxygenase gene.Key words: Aspergillus ochraceus, Aspergillus westerdijkiae, Agrobacterium-mediated transformation, Agrobacterium-mediated insertional mutagenesis, ochratoxin A.

Ochratoxin A (OA) is a nephrotoxic and carcinogenic mycotoxin that has been found in cereal and food commodities. Currently, Aspergillus carbonarius, A. niger and A. ochraceus have been recognized as the species responsible for OA in coffee beans. With the aim of developing multiplex-PCR for detection of these species in coffee bean samples, we first developed specific primers for A. niger detection. The primer designed (OPX7(372)) provided an amplicon of 372 pb in all A. niger stricto sensu isolates. The PCR assay developed for A. niger identification in pure culture was also successfully used for detecting this species in coffee beans. No cross-reaction was observed using DNA from coffee beans inoculated with closely related black aspergilli species. A multiplex-PCR method for detection of A. carbonarius, A. niger and A. ochraceus species in coffee beans was developed. From a single assay this method detected the amplicons of 809, 372, and 260 pb that represent the three most ochratoxigenic species found in coffee bean samples, i.e., A. carbonarius, A. niger and A. ochraceus, respectively.

Some species belonging to the genus Aspergillus are potential producers of ochratoxin A (OA), a mycotoxin with nephrotoxic, immunosuppressive, teratogenic and carcinogenic effects. The aim of the present study was to identify the species of Aspergillus that contaminate the inside of coffee beans collected in the stage of maturation and drying, from 16 producing areas located in the northern region of the State of Paraná, in the South of Brazil. A total of 108 isolates of Aspergillus spp. was identified at the species level, by sequencing the internal transcribed spacer (ITS1-5.8S-ITS2) of ribosomal DNA (rDNA). The results revealed the presence of potentially ochratoxigenic species in 82% of the geographic regions studied, among which Aspergillus niger was the species most frequently detected, followed by A. ochraceus and A. carbonarius. The presence of A. carbonarius in immature coffee fruits harvested from trees is reported for the first time. Algumas espécies pertencentes ao gênero Aspergillus possuem potencial para produção de Ocratoxina A (OA), uma micotoxina de efeitos nefrotóxicos, imunossupressivos, teratogênicos e carcinogênicos. Com o objetivo de identificar as espécies de Aspergillus que contaminam o interior de grãos de café, foram coletadas amostras em diferentes estádios de maturação do produto, em 16 propriedades produtoras do norte do estado do Paraná. Um total de 108 isolados de Aspergillus spp. foram identificados ao nível de espécie, pelo sequenciamento dos espaços internos transcritos (ITS1-5,8S-ITS2) do DNA ribossomal (rDNA). Os resultados revelaram a presença de espécies potencialmente ocratoxigênicas em 82% das regiões analisadas, sendo dentre estas, Aspergillus niger a espécie mais freqüentemente detectada,seguida por A. ochraceus, e A. carbonarius. É relatada pela primeira vez a presença de A. carbonarius em frutos de café coletados na árvore.

Submitted by Vitor Silverio Rodrigues (vitorsrodrigues@reitoria.unesp.br) on 2014-05-27T11:29:01Z No. of bitstreams: 0 Made available in DSpace on 2014-05-27T11:29:01Z (GMT). No. of bitstreams: 0 Previous issue date: 2013-05-01 (-)-Cubebin is a lignan extracted from the seeds of the pepper Piper cubeba, a commonly eaten spice with beneficial properties, including trypanocidal, anti-inflammatory, analgesic, anti-proliferative and leishmanicidal activities. Because of its therapeutic potential, we investigated the effects of (-)-cubebin on the cytotoxicity, cell proliferation kinetics, mutagenicity and expression of p38 MAP kinase and glutathione S-transferase a2 (GSTa2) using real-time RT-PCR in Rattus norvegicus hepatoma cells. We found that 280 μM (-)-cubebin was cytotoxic after 24, 48 and 72. h of exposure, but not mutagenic at 0.28 μM, 2.8 μM and 28 μM after 26. h. Similarly, exposure to 0.28 μM, 2.8 μM and 28 μM (-)-cubebin for 24, 48, 72 and 96. h did not alter the cell proliferation kinetics. Cells exposed to 28 μM (-)-cubebin for 24. h did not exhibit changes in p38 MAP kinase and GSTa2 expression, indicating that cellular changes were not induced by extracellular stimuli and that (-)-cubebin is likely not metabolized via this pathway. Our results suggest that high levels of (-)-cubebin should be consumed with caution due to the cytotoxic effect observed at the highest concentration. However, at lower concentrations, no cytotoxic, mutagenic or proliferative effects were observed, providing further evidence of the safety of consuming (-)-cubebin. © 2013 Elsevier Inc. Departamento de Biologia Geral Universidade Estadual de Londrina (UEL), Londrina (PR) Instituto de Biociências Universidade Estadual Paulista - UNESP, Rio Claro, São Paulo Departamento de Fonoaudiologia Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Marília, São Paulo Instituto de Biociências Universidade Estadual Paulista - UNESP, Rio Claro, São Paulo Departamento de Fonoaudiologia Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Marília, São Paulo

The polysaccharide β-glucan has biological properties that stimulate the immune system and can prevent chronic pathologies, including cancer. It has been shown to prevent damage to DNA caused by the chemical and physical agents to which humans are exposed. However, the mechanism of β-glucan remains poorly understood. The objective of the present study was to verify the protective effect of β-glucan on the expression of the genes ERCC5 (involved in excision repair of DNA damage), CASP9 (involved in apoptosis), and CYP1A1 (involved in the metabolism of xenobiotics) using real-time polymerase chain reaction and perform metabolic profile measurements on the HepG2 cells. Cells were exposed to only benzo[a]pyrene (B[a]P), β-glucan, or a combination of B[a]P with β-glucan. The results demonstrated that 50 µg/mL β-glucan significantly repressed the expression of the ERCC5 gene when compared with the untreated control cells in these conditions. No change was found in the CASP9 transcript level. However, the CYP1A1 gene expression was also induced by HepG2 cells exposed to B[a]P only or in association with β-glucan, showing its effective protector against damage caused by B[a]P, while HepG2 cells exposed to only β-glucan did not show CYP1A1 modulation. The metabolic profiles showed moderate bioenergetic metabolism with an increase in the metabolites involved in bioenergetic metabolism (alanine, glutamate, creatine and phosphocholine) in cells treated with β-glucan and to a lesser extent treated with B[a]P. Thus, these results demonstrate that the chemopreventive activity of β-glucan may modulate bioenergetic metabolism and gene expression.

Isoflavones are phenolic compounds widely distributed in plants and found in a high percentage in soybeans. They have important biological properties and are regarded as potential chemopreventive agents. The aim of this study was to verify the preventive effect of two soy isoflavones (genistein and daidzein) by a micronucleus assay, analysis of GST activity, and real-time RT-PCR analysis of GSTa2 gene expression. Mutagens of direct (doxorubicin) and indirect (2-aminoanthracene) DNA damage were used. Hepatoma cells (HTC) were treated with genistein or daidzein for 26 h at noncytotoxic concentrations; 10 μM when alone, and 0.1, 1.0 and 10 μM when combined with genotoxic agents. The micronucleus test demonstrated that both isoflavones alone had no genotoxic effect. Genistein showed antimutagenic effects at 10 μM with both direct and indirect DNA damage agents. On phase II enzyme regulation, the current study indicated an increase in total cytoplasmic GST activity in response to genistein and daidzein at 10 μM supplementation. However, the mRNA levels of GSTa2 isozymes were not differentially modulated by genistein or daidzein. The results point to an in vitro antimutagenic activity of genistein against direct and indirect DNA damage-induced mutagenicity.

Intestinal cancers are correlated with diet. Thus, determining and understanding nutrient-genome interactions is important. The present work assessed the action of the oligoelement selenium on cell proliferation, cytotoxicity, and in situ apoptosis induction and on the expression CASP9, BCL-XL and APC genes in intestinal adenocarcinoma cells (HT29). HT29 cells were cultured and treated with selenium at concentrations of 5, 50 and 500ng/mL with or without the damage-inducing agent doxorubicin. These cells were then evaluated for cytotoxicity (MTT), cell proliferation and in situ apoptosis induction. To evaluate gene expression, only the cells treated with 500ng/mL of selenium were used. RNA was extracted from these cells, and the expressions of CASP9, BCL-XL and APC were analyzed by the RT-PCR method. The GAPDH gene was used as a reference gene. The MTT assay showed that selenium was not cytotoxic at any of the concentrations tested. The cell proliferation assay showed that selenium did not interfere with cell proliferation at the three concentrations tested. In contrast, when the three concentrations were combined with doxorubicin, a significant decrease in the proliferation rate was observed. The apoptosis rate was significantly increased in the selenium (500ng/mL) and doxorubicin group. CASP9 expression was increased and BCL-XL expression decreased in the selenium (500ng/mL) and doxorubicin group. APC was significantly increased in the selenium group alone. These results show that selenium increases apoptosis, especially when it is associated with a damage-inducing agent. Also, selenium has an important role in the expression of the APC gene, which is related to cell cycle regulation.

Ochratoxin A (OTA) is one of the most abundant food-contaminating mycotoxins. Its presence in several agricultural commodities has been considered a problem worldwide. This toxin is mainly produced by two genera of fungi: Aspergillus and Penicillium. Ochratoxin A has nephrotoxic, immunosuppressive, and carcinogenic effects; consequently, contamination with OTA presents a major risk for human and animal health. Over the last 5 years, several studies have developed PCR-based assays for identifying and quantifying OTA-producing fungi in food samples. The main objective of these assays is to allow the detection of microorganisms capable of producing OTA, prior to ochratoxin production and accumulation. Several of these attempts will be reviewed and discussed in this chapter.

Ochratoxin A is a mycotoxin produced by some fungi species. Among them, Aspergillus carbonarius is considered a powerful producer. Genes involved in the ochratoxin A biosynthesis pathway have been identified in some producer species. However, there are few studies that purpose to identify these genes in A. carbonarius. The use of insertion mutants to identify genes associated with certain properties has been increased in the literature. In this work, the region of T-DNA integration was investigated in one A. carbonarius ochratoxin-defective mutant previously obtained by Agrobacterium tumefaciens-mediated transformation, in order to find an association between interrupted gene and the biosynthesis of ochratoxin A. The integration occurred in a gene that possibly encodes a splicing coactivator protein. The analysis of the relative expression of the splicing coativator gene from A. carbonarius wild type strain in four different media showed high correlation between the transcript levels and the ochratoxin A production.A ocratoxina A é uma micotoxina frequentemente encontrada em uma grande variedade de produtos alimentares e apresenta efeitos nefrotóxicos e potencial carcinogênico para animais e humanos. É naturalmente produzida por algumas espécies fúngicas, como Aspergillus carbonarius, que é considerado um potente produtor. Apesar disso, o número de estudos que visam identificar genes que são essenciais para a biossíntese de ocratoxina em A. carbonarius é ainda reduzido. Um mutante de A. carbonarius com baixa produção de ocratoxina A previamente obtido por transformação mediada por Agrobacterium tumefaciens foi investigado com o objetivo de encontrar uma associação entre o gene interrompido e a biossíntese desta micotoxina. Os resultados mostraram a ocorrência de uma junção não exata entre o T-DNA e o DNA genômico do fungo durante o evento de integração. A integração do T-DNA no genoma do mutante T188 provocou deleção de 727 nucleotídeos. Esta deleção inclui uma porção final do gene coativador de splicing e uma região não-codificante entre este gene e o gene F-actina. A expressão relativa do gene coativador de splicing na linhagem selvagem cultivada em quatro diferentes meios mostrou associação entre a quantidade de ocratoxina A e os níveis dos transcritos.

Ochratoxin A (OTA) is one of the most abundant food-contaminating mycotoxins. Its occurrence in several agricultural commodities has been considered a worldwide problem. This toxin is mainly produced by Aspergillus species. OTA has nephrotoxic, immunosuppressive, and carcinogenic effects and consequently the contamination with this toxin represents a high risk for human and animal health. In the last 5 years, several investigators have applied molecular methods in order to develop PCR assays for identifying and quantifying OTA-producing fungi in coffee beans samples. The main objective is to allow the detection of microorganisms capable of producing OTA, preferentially prior to ochratoxin production and accumulation. In this contribution several of these attempts will be reviewed and discussed.Dentre as micotoxinas que contaminam produtos destinados à alimentação humana e animal, a ocratoxina A (OTA) é uma das mais freqüentemente encontrada. A sua ocorrência em vários produtos agrícolas tem sido considerada um problema de amplitude mundial. Esta toxina é produzida principalmente por fungos do gênero Aspergillus. A OTA tem efeitos nefrotóxico, imunossupressor e carcinogênico. A contaminação de alimentos com esta toxina representa risco para a saúde animal e humana. Nos últimos cinco anos, vários investigadores têm desenvolvido métodos moleculares para identificação e quantificação de fungos produtores de OTA em amostras de grãos de café. O objetivo desta revisão é apresentar e discutir as várias estratégias desenvolvidas recentemente para a detecção de fungos potencialmente produtores de OTA.

We analyzed the genetic relationships between 51 fungal isolates previously identified as A. niger aggregate, obtained from dried fruit samples from worldwide origin and 7 A. tubingensis obtained from Brazilian coffee beans samples. Greater fungal diversity was found in black sultanas. Aspergillus niger sensu stricto was the most prevalent species. It was found in all fruit substrates of all geographical origins. Based on Random Amplification of Polymorphic DNA (RAPD) and β-tubulin sequences data two groups of A. niger were found. In spite of the small number of isolates from Group IV an association between extrolite patterns and molecular clustering is speculated. A. tubingensis were the second most frequent species and this species were clearly subdivided into two groups. The finding of two groups for A. tubingensis strains could not yet explain the contradictions found in the literature about the capability this species for ochratoxin production, because both of them were formed by only non-ochratoxin-producing strains.Neste trabalho foi analisada a relação genética entre 51 isolados obtidos de amostras de frutas secas provenientes de diferentes regiões do previamente identificados como pertencentes ao agregado A. niger e 7 isolados de Aspergillus tubingensis obtidos de amostras de café do Brasil. Maior diversidade fúngica foi encontrada em uvas passas escuras. Aspergillus niger sensu stricto foi a espécie mais frequente. Esta espécie foi encontrada em todos os substratos e origens geográficas analisadas. Baseando-se nos dados de Polimorfismo de DNA Amplificado ao Acaso (RAPD) e sequências de nucleotídeos do gene da β-tubulina, dois grupos de A. niger foram observados. Apesar do pequeno número de isolados do grupo IV uma associação entre padrão de extrólitos e agrupamento molecular foi encontrada. A. tubingensis foi a segunda espécie mais frequente e foi claramente subdivida em dois grupos. Como os grupos de A. tubingensis são formados somente por linhagens não produtoras de ocratoxina A, a identificação destes grupos não explica a controvérsia encontrada na literatura sobre a capacidade desta espécie em produzir a referida toxina.

We present the multiplex PCR data for the presence/absence of genes involved in OTA and FB2 biosynthesis in Aspergillus niger/Aspergillus welwitschiae strains isolated from different food substrates in Brazil. Among the 175 strains analyzed, four mPCR profiles were found: Profile 1 (17%) highlights strains harboring in their genome the pks, radH and the fum8 genes. Profile 2 (3.5%) highlights strains harboring genes involved in OTA biosynthesis i.e. radH and pks. Profile 3 (51.5%) highlights strains harboring the fum8 gene. Profile 4 (28%) highlights strains not carrying the genes studied herein. This research content is supplemental to our original research article, “Prospecting for the incidence of genes involved in ochratoxin and fumonisin biosynthesis in Brazilian strains of A. niger and A. welwitschiae” [1]. Keywords: Ochratoxin, Fumonisin, High-resolution capillary electrophoresis