Search

Cell-free DNA (cfDNA) analysis, specifically circulating tumor DNA (ctDNA) analysis, provides enormous opportunities for noninvasive early assessment of cancers. To date, PCR-based methods have led this field. However, the limited sensitivity/specificity of PCR-based methods necessitates the search for new methods. Here, we describe a direct approach to detect KRAS G12D mutated genes in clinical ctDNA samples with the utmost LOD and sensitivity/specificity. In this study, MutS protein was immobilized on the tip of an atomic force microscope (AFM), and the protein sensed the mismatched sites of the duplex formed between the capture probe on the surface and mutated DNA. A noteworthy LOD (3 copies, 0.006% allele frequency) was achieved, along with superb sensitivity/specificity (100%/100%). These observations demonstrate that force-based AFM, in combination with the protein found in nature and properly designed capture probes/blockers, represents an exciting new avenue for ctDNA analysis.

We demonstrate for the first time a fast aptamer generation method based on the screen-printed electrodynamic microfluidic channel device, where a specific aptamer selectively binds to a target protein on channel walls, following recovery and separation. A malaria protein as a model target, Plasmodium vivax lactate dehydrogenase (PvLDH) was covalently bonded to the conductive polymer layer formed on the carbon channel walls to react with the DNA library in a fluid. Then, the AC electric field was symmetrically applied on the channel walls for inducing the specific binding of the target protein to DNA library molecules. In this case, the partitioning efficiency between PvLDH and DNA library in the channel was attained to be 1.67 × 107 with the background of 5.56 × 10-6, which was confirmed using the quantitative polymerase chain reaction (qPCR). The selectively captured DNAs were isolated from the protein and separated in situ to give five aptamers with different sequences by one round cycle. The dissociation constants (Kd) of the selected aptamers were determined employing both electrochemical impedance spectroscopy (EIS) and the fluorescence method. The sensing performance of each aptamer was evaluated for the PvLDH detection after individual immobilization on the screen-printed array electrodes. The most sensitive aptamer revealed a detection limit of 7.8 ± 0.4 fM. The sensor reliability was evaluated by comparing it with other malaria sensors.

The benzocoumarin dyes fluoresce negligibly in aqueous media but very strongly in cells, whereas representative conventional dyes display contrasting behaviour; the distinct emission behaviour of the fluorophores in organic solutions, in aqueous media, and in cell convinces the uniqueness of the cellular environment. The in cellulo superbright benzocoumarins also reveal an environment-insensitive emission behaviour, which is required for the reliable analysis via ratiometric imaging.

The soluble interleukin-2 receptor α (sIL-2Rα) is a broad indicator of clinical disease activity in various inflammatory diseases. Here we have developed, for the first time, a rapid, washing-free colorimetric aptasensor based on a sIL-2Rα aptamer (Kd =1.33 nm). The aptasensor was fabricated with Au nanoparticles (AuNPs) adsorbing sIL-2Rα aptamers. On addition of sIL-2Rα, the aptamers become desorbed from the AuNPs, and this in turn weakens the absorption corresponding to AuNP-catalyzed oxidation of ortho-phenylenediamine (oPD) with H2 O2 . The aptasensor was characterized by TEM imaging, ζ potential measurements, dynamic light scattering (DLS) analysis, and UV/Vis spectrometry, followed by further optimization. The fabricated sensor exhibited great analytical performance, with a linear range of 1 to 100 nm and a detection limit of 1 nm both in buffer and in spiked human serum within 25 min. Other proteins, such as bovine serum albumin (BSA), IL-17Rα, IL-5Rα, IL-13Rα2 , and CD166, showed negligible effects on the aptasensor. Thanks to the great advantages of the aptamers and AuNPs, this aptasensor provides a rapid, simple, and inexpensive process that might offer insights into various diagnostic applications of sIL-2Rα.

The development of a multiplexed sensing platform is necessary for highly selective, sensitive, and rapid screening of specific antibiotics. In this study, we designed a novel multiplex aptasensor for antibiotics by fluorescence resonance energy transfer (FRET) strategy using DNase I-assisted cyclic enzymatic signal amplification (CESA) method combined with aptamer/graphene oxide complex. The aptamers specific for sulfadimethoxine, kanamycin, and ampicillin were conjugated with Cyanine 3 (Cy3), 6-Carboxyfluorescein (FAM), and Cyanine 5 (Cy5), respectively, and graphene oxide (GO) was adopted to quench the fluorescence of the three different fluorophores with the efficiencies of 94.36%, 93.94%, and 96.97% for Cy3, FAM, and Cy5, respectively. CESA method was used for sensitive detection, resulting in a 2.1-fold increased signal compared to those of unamplified method. The aptasensor rapidly detected antibiotics in solution with limit of detection of 1.997, 2.664, and 2.337 ng/mL for sulfadimethoxine, kanamycin, and ampicillin, respectively. In addition, antibiotics dissolved in milk were efficiently detected with similar sensitivities. Multiplexed detection test proved that the fluorescently modified aptamers could work separately from each other. The results indicate that the aptasensor offers high specificity for each antibiotic and enables simultaneous and multicolor sensing for rapid screening of multiple antibiotics at the same time.

Well-ordered bioreceptors on atomically flat Au surfaces can be a high-performance biosensor. Cardiac troponin I proteins (cTnIs) have been regarded as a specific biomarker for acute myocardial infarction (AMI). Here, we report the accurate detection of cTnIs using an aptamer-immobilized Au nanoplate platform. The single-crystalline and atomically flat Au nanoplate was characterized by atomic force microscopy. For the precise detection of cTnI, we immobilized an aptamer that can strongly bind to cTnI onto an atomically flat Au nanoplate. Using the aptamer-immobilized Au nanoplate, cTnIs were successfully detected at a concentration of 100 aM (2.4 fg/mL) in buffer solution. Furthermore, cTnIs in serum could be identified at a concentration of 100 fM (2.4 pg/mL). The total assay time was ~7 h. Importantly, the aptamer-immobilized Au nanoplate enabled us to diagnose AMI patients accurately, suggesting the potential of the present method in the diagnosis of AMI.

Propionibacterium acnes is a lipophilic commensal bacterium mainly found on the skin and in the gastrointestinal tract. Pathophysiological effects of P. acnes have recently been reported not only in acne progression but in various diseases. As an emerging mode of bacterial communication, extracellular vesicles (EVs) have been demonstrated to conduct critical pathophysiological functions. To provide information on P. acnes lipid composition for the first time, we conducted a comparative lipidomic analysis of P. acnes and P. acnes EVs and identified 214 lipids with high confidence using triplicated liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS) analyses. P. acnes EVs contained substantially more PCs, DGs, PAs, PEs, LPAs, LPCs, and MGs than P. acnes, and contained fewer PSs, SO1Ps, SA1Ps, LPGs, LPIs, and LPSs. Distinctively, P. acnes EVs possessed a markedly reduced amount of TG. These findings will provide useful clues for understanding the biological and pathophysiological mechanisms of P. acnes and for clinical applications such as vaccine development, diagnostics and therapeutics.

In this study, we proposed a new G-quadruplex (GQ)-based fluorescent aptasensor using one-shot detection of NS1 for dengue fever diagnosis. To design the aptasensor, Dengue virus-derived NS1-binding aptamer (DBA) that forms a GQ structure was developed. The DBA underwent structural destruction induced by nonstructural protein 1 (NS1), then we aimed to utilize it for optical sensing. Fluorescent detection of the NS1-dependent structural change was performed by applying a fluorescent dye; 6-carboxyfluorescein (FAM) was attached to the 5' end of DBA (5' FAM-DBA). The 5' FAM-DBA could quantitatively detect the fluorescence quenching caused by guanines upon NS1 binding, which was feasible for dengue fever diagnosis. We analyzed to understand the structural and fluorescent characteristics that are involved in the interaction between NS1 and DBA. The results suggested that the central G-tracts were rearranged to adjacent toward the FAM, and that the structure of 5' FAM-DBA bound to NS1 was expected to form base-pairing. Finally, the aptasensor with 5’ FAM-DBA was established after optimization, which contributed to the effective and rapid detection. The aptasensor achieved low detection limits of 2.51 nM in buffer and 8.13 nM in serum. Additionally, it was verified the high specificity using other proteins including yellow fever proteins, and it has the potential to overcome the cross-reactivity with other flaviviruses. Also, the stability of the DF aptasensor was confirmed to give practical usability. Here, we developed a novel GQ-based fluorescent aptasensor for rapid and simple dengue fever diagnosis, which could provide the possibility for use in practical applications.

Patients with pancreatic and colorectal cancers have elevated levels of activated leukocyte cell adhesion molecule (ALCAM) in their blood compared to healthy individuals. To this end, sensitive detection of soluble fraction of ALCAM (sALCAM), also called CD166, was performed using enzyme-linked antibody aptamer (ELAA) assay. For the assay, aptamer specific for sALCAM was used as a capturing probe and polyclonal antibody modified with an enzyme was used as a detecting probe for colorimetric visualization. The ELAA assay was able to detect sALCAM as low as 0.31 ng/mL. In addition, the assay enabled the differentiation of sALCAM from other proteins in buffer as well as in human serum. The ELAA assay provides cost-effective, highly sensitive, and reproducible detection of sALCAM.

In this study, we developed a sandwich aptamer-based screen-printed carbon electrode (SPCE) using chronoamperometry for the detection of cardiac troponin I (cTnI), one of the promising biomarkers for acute myocardial infarction (AMI). Disposable three-electrode SPCEs were manufactured using a screen printer, and various modifications such as electrodeposition of gold nanoparticles and electropolymerization of conductive polymers were performed. From the bare electrode to the aptamer-immobilized SPCE, all processes were monitored and analyzed via various techniques such as cyclic voltammetry, electrochemical impedance spectroscopy, and X-ray photoelectron spectroscopy. The quantification of cTnI was conducted based on amperometric signals from the catalytic reaction between hydrazine and H 2 O 2 . The fabricated aptasensor in a buffer, as well as in a serum-added solution, exhibited great analytical performance with a dynamic range of 1–100 pM (0.024–2.4 ng/mL) and a detection limit of 1.0 pM (24 pg/mL), which is lower than the existing cutoff values (40–700 pg/mL). Furthermore, the developed sensor showed high sensitivity to cTnI over other proteins. It is anticipated that this potable SPCE aptasensor for cTnI will become an innovative diagnostic tool for AMI.

Electrochemical biosensors using five anticancer drug and lipid molecules attached on the conducting polymer layer to obtain the orientation of drug molecules toward cancer cells, were evaluated as sensing materials and their performances were compared. Conjugation of the drug molecules with a lipid, phosphatidylcholine (PC) has enhanced the sensitivity towards leukemia cells and differentiates cancer cells from normal cells. The composition of each layer of sensor probe was confirmed by electrochemical and surface characterization experiments. Both impedance spectroscopy and voltammetry show the enhanced interaction of leukemia cells using the drug/lipid modified sensor probe. As the number of leukemia cells increased, the charge transfer resistance (R ct ) in impedance spectra increased and the amine oxidation peak current of drug molecules in voltammograms decreased at around 0.7–1.0 V. Of test drug molecules, raltitrexed (Rtx) showed the best performance for the cancer cells detection. Cancer and normal cell lines from different origins were examined to evaluate the degree of expression of folate receptors (FR) on cells surface, where cervical HeLa cell line was found to be shown the highest expression of the receptor. Impedance and chronoamperometric experiments for leukemia cell line (Jurkat E6-1) showed linear dynamic ranges of 1.0×10 3 –2.5×10 5 cells/mL and 1.0×10 3 –8.0×10 3 cells/mL with detection limits of 68±5 cells/mL and 21±3 cells/mL, respectively.

Interleukin-17 receptor A (IL-17RA) has been recognized as a valuable biomarker for diverse diseases, including autoimmune diseases. In this work, an electrochemical biosensor with great sensitivity and selectivity toward IL-17RA was fabricated using an IL-17RA aptamer (Kd=14.00nM) for the first time. The aptasensor was manufactured using electrodeposition of gold nanoparticles, and then quantitative detection of IL-17RA was performed based on impedimetry. The developed sensor exhibited a superior analytical performance for IL-17RA with a wide dynamic range of 10-10,000pg/mL in buffer and a detection limit of 2.13pg/mL, which is lower than that of commercially available ELISA kits. In addition, we validated the high specificity of the designed aptasensor to only IL-17RA, which showed good sensitivity even in human serum solution. Furthermore, the detection of the differentiated HL-60 cells expressing IL-17RA was successfully performed. Clinical applicability of the sensor was also demonstrated utilizing neutrophils separated from asthma patients. It is expected that the fabricated aptasensor will become an excellent diagnostic platform for IL-17RA-mediated diseases.

The simple, economical, and accurate diagnosis of tuberculosis (TB) is essential for high TB-burden countries with limited resources. Here, we propose a novel approach based on TB7.7-responsive aptamer beacon with graphene oxide (GO) for the diagnosis of active TB by the direct detection of circulating TB7.7 in serum. A TB7.7-specific aptamer (Kd = 5.3 nM) was developed to design the aptamer beacon responsive to TB7.7 by forming a hairpin structure labeled with 5′-FAM and 3′-BHQ1, which produces a fluorescence signal only in the presence of TB7.7. Additionally, GO was introduced to improve the sensitivity of the aptasensor by enhancing the signal-to-background ratio. After the optimization process, the established aptasensor performed the highly sensitive and specific detection of TB7.7 in buffer and serum with a low detection limit of 0.8779 nM and 0.7089 nM, respectively. The clinical application of serum samples from active TB patients demonstrated that the diagnostic performance of the aptasensor offered 41.67 % sensitivity and 92.86 % specificity with 78.87 % accuracy based on receiver operator curve (ROC) analysis. Taken together, this study demonstrated that circulating TB7.7 is an effective biomarker for active TB diagnosis. The proposed aptasensor accurately diagnosed active TB using a simple and cost-effective process (

Cardiac troponin I (cTnI) is well-known as a promising biomarker for the early diagnosis of acute myocardial infarction (AMI). In this work, single-stranded DNA aptamers against cTnI were identified by the Systematic Evolution of Ligands by Exponential enrichment (SELEX) method. The aptamer candidates exhibited a high selectivity and sensitivity toward both cTnI and the cardiac Troponin complex. The binding affinities of each aptamer were evaluated based on their dissociation constants (Kd) by surface plasma resonance. The Tro4 aptamer that had the highest binding capacity to cTnI showed a very low Kd value (270 pM) compared with that of a cTnI antibody (20.8 nM). Furthermore, we designed a new electrochemical aptasensor based on square wave voltammetry using ferrocene-modified silica nanoparticles. The developed aptasensor demonstrated an excellent analytical performance for cTnI with a wide linear range of 1-10 000 pM in a buffer and a detection limit of 1.0 pM (24 pg/mL; S/N = 3), which was noticeably lower than the cutoff values (70-400 pg/mL). The specificity of the aptamers was also examined using nontarget proteins, demonstrating that the proposed sensor responded to only cTnI. In addition, cTnI was successfully detected in a human serum albumin solution. On the basis of the calibration curve that was constructed, the concentrations of cTnI in a solution supplemented with human serum were effectively measured. The calculated values correlated well with the actual concentrations of cTnI. It is anticipated that the highly sensitive and selective aptasensor for cTnI could be readily applicable for the accurate diagnosis of AMI.

In this study, we synthesized dual aptamer-modified silica nanoparticles that simultaneously target two types of breast cancer cells: the mucin 1 (MUC1)(+) and human epidermal growth factor receptor 2 (HER2)(+) cell lines. Dual aptamer system enables a broad diagnosis for breast cancer in comparison with the single aptamer system. The dye-doped silica nanoparticles offer great stability with respect to photobleaching and enable the accurate quantification of breast cancer cells. The morphological and spectroscopic characteristics of the designed Dual-SiNPs were demonstrated via diverse methods such as DLS, zeta potential measurements, UV-vis spectroscopy, and fluorescence spectroscopy. Negatively charged Dual-SiNPs with a homogeneous size distribution showed robust and strong fluorescence. In addition, Dual-SiNPs did not affect cell viability, implying that this probe might be readily available for use in an in vivo system. Through ratio optimization of the MUC1 and HER2 aptamers, the binding capacities of the Dual-SiNPs to both cell lines were maximized. Based on Dual-SiNPs, a highly sensitive quantification of breast cancer cells was performed, resulting in a detection limit of 1 cell/100 μL, which is significantly lower compared with those reported in other studies. Moreover, the developed detection platform displayed high selectivity for only the MUC1(+) and HER2(+) cell lines. It is expected that this valuable diagnostic probe will be a noteworthy platform for the diagnosis and prognosis of breast cancer.

α-Synuclein (α-Syn) is an intrinsically disordered protein, whose fibrillar aggregates are associated with the pathogenesis of Parkinson's disease. α-Syn associates with lipid membranes and forms helical structures upon membrane binding. In this study, we explored the helix formation of α-Syn in solution containing trifluoroethanol using small-angle X-ray scattering and electrospray ionization ion mobility mass spectrometry. We then investigated the structural transitions of α-Syn to helical structures via association with large unilamellar vesicles as model lipid membrane systems. Hydrogen-deuterium exchange combined with electrospray ionization mass spectrometry was further utilized to understand the details of the regional interaction mechanisms of α-Syn with lipid vesicles based on the polarity of the lipid head groups. The characteristics of the helical structures were observed with α-Syn by adsorption onto the anionic phospholipid vesicles via electrostatic interactions between the N-terminal region of the protein and the anionic head groups of the lipids. α-Syn also associates with zwitterionic lipid vesicles and forms helical structures via hydrophobic interactions. These experimental observations provide an improved understanding of the distinct structural change mechanisms of α-Syn that originate from different regional interactions of the protein with lipid membranes and subsequently provide implications regarding diverse protein-membrane interactions related to their fibrillation kinetics.

Structural elements are key elements for understanding single-stranded nucleic acid folding. Although various RNA structural elements have been documented, structural elements of single-stranded DNA (ssDNA) have rarely been reported. Herein, we determined a crystal structure of PvLDH in complex with a DNA aptamer called pL1. This aptamer folds into a hairpin-bulge contact by adopting three novel structural elements, viz, DNA T-loop-like motif, base–phosphate zipper, and DNA G·G metal ion zipper. Moreover, the pL1:PvLDH complex shows unique properties compared with other protein:nucleic acid complexes. Generally, extensive intermolecular hydrogen bonds occur between unpaired nucleotides and proteins for specific recognitions. Although most protein-interacting nucleotides of pL1 are unpaired nucleotides, pL1 recognizes PvLDH by predominant shape complementarity with many bridging water molecules owing to the combination of three novel structural elements making protein-binding unpaired nucleotides stable. Moreover, the additional set of Plasmodium LDH residues which were shown to form extensive hydrogen bonds with unpaired nucleotides of 2008s does not participate in the recognition of pL1. Superimposition of the pL1:PvLDH complex with hLDH reveals steric clashes between pL1 and hLDH in contrast with no steric clashes between 2008s and hLDH. Therefore, specific protein recognition mode of pL1 is totally different from that of 2008s.

SummaryThe mismatch repair (MMR) initiation protein MutS forms at least two types of sliding clamps on DNA: a transient mismatch searching clamp (∼1 s) and an unusually stable (∼600 s) ATP-bound clamp that recruits downstream MMR components. Remarkably, direct visualization of single MutS particles on mismatched DNA has not been reported. We have combined real-time particle tracking with fluorescence resonance energy transfer (FRET) to image MutS diffusion dynamics on DNA containing a single mismatch. We show searching MutS rotates during diffusion independent of ionic strength or flow rate, suggesting continuous contact with the DNA backbone. In contrast, ATP-bound MutS clamps that are visually and successively released from the mismatch spin freely around the DNA, and their diffusion is affected by ionic strength and flow rate. These observations show that ATP binding alters the MutS diffusion mechanics on DNA, which has a number of implications for the mechanism of MMR.

Finding a highly sensitive diagnostic technique for malaria has challenged scientists for the last century. In the present study, we identified versatile single-strand DNA aptamers for Plasmodium lactate dehydrogenase (pLDH), a biomarker for malaria, via the Systematic Evolution of Ligands by EXponential enrichment (SELEX). The pLDH aptamers selectively bound to the target proteins with high sensitivity (K(d)=16.8-49.6 nM). The selected aptamers were characterized using an electrophoretic mobility shift assay, a quartz crystal microbalance, a fluorescence assay, and circular dichroism spectroscopy. We also designed a simple aptasensor using electrochemical impedance spectroscopy; both Plasmodium vivax LDH and Plasmodium falciparum LDH were selectively detected with a detection limit of 1 pM. Furthermore, the pLDH aptasensor clearly distinguished between malaria-positive blood samples of two major species (P. vivax and P. falciparum) and a negative control, indicating that it may be a useful tool for the diagnosis, monitoring, and surveillance of malaria.

Simultaneous evaluation of the binding affinity of a series of aptamers toward a target molecule was investigated using an electrochemical microarray chip. The chip was modified by immobilizing seven aptamers obtained from the SELEX process and a control sequence onto gold nanoparticle-comprised conducting polymer-coated microarray electrodes. The chip was then incubated with the target molecule, kanamycin. The electrochemical response of the captured kanamycin was studied to evaluate the binding affinity of the aptamers, which showed the same trend with the fluorescence spectroscopic results. The lowest dissociation constant between a selected aptamer and kanamycin was determined to be 38.06 � 0.73 nM.

A polymer-based aptasensor, which consisted of fluorescein amidite (FAM)-modified aptamers and coordination polymer nanobelts (CPNBs), was developed utilizing the fluorescence quenching effect to detect sulfadimethoxine residue in food products. A single-stranded DNA (ssDNA) aptamer, which was a specific bio-probe for sulfadimethoxine (Su13; 5'-GAGGGCAACGAGTGTTTATAGA-3'), was discovered by a magnetic bead-based systematic evolution of ligands by exponential enrichment (SELEX) technique, and the fluorescent quenchers CPNBs were produced by mixing AgNO(3) and 4,4'-bipyridine. This aptasensor easily and sensitively detected sulfadimethoxine in solution with a limit of detection (LOD) of 10ng/mL. Furthermore, the antibiotic dissolved in milk was also effectively detected with the same LOD value. In addition, this aptamer probe offered high specificity for sulfadimethoxine compared to other antibiotics. These valuable results provide ample evidence that the CPNB-based aptasensor can be used to quantify sulfadimethoxine residue in food products.

We have designed a dual-aptamer complex specific to both prostate-specific membrane antigens (PSMA) (+) and (-) prostate cancer cells. In the complex, an A10 RNA aptamer targeting PSMA (+) cells and a DUP-1 peptide aptamer specific to PSMA (-) cells were conjugated through streptavidin. Doxorubicin-loaded onto the stem region of the A10 aptamer was delivered not only to PSMA (+) cells but to PSMA (-) cells, and eventually induced apoptosis in both types of prostate cancer cells. Cell death was monitored by measuring guanine concentration in cells using differential pulse voltammetry (DPV), a simple and rapid electrochemical method, and was further confirmed by directly observing cell morphologies cultured on the transparent indium tin oxide (ITO) glass electrode and checking their viabilities using a trypan blue assay. To investigate the in vivo application of the dual-aptamer system, both A10 and DUP-1 aptamers were immobilized on the surface of thermally cross-linked superparamagnetic iron oxide nanoparticles (TCL-SPION). Selective cell uptakes and effective drug delivery action of these probes were verified by Prussian blue staining and trypan blue staining, respectively.

Single-molecule trajectory analysis has suggested DNA repair proteins may carry out a one-dimensional (1D) search on naked DNA encompassing >10,000 nucleotides. Organized cellular DNA (chromatin) presents substantial barriers to such lengthy searches. Using dynamic single-molecule fluorescence resonance energy transfer, we determined that the mismatch repair (MMR) initiation protein MutS forms a transient clamp that scans duplex DNA for mismatched nucleotides by 1D diffusion for 1 s (~700 base pairs) while in continuous rotational contact with the DNA. Mismatch identification provokes ATP binding (3 s) that induces distinctly different MutS sliding clamps with unusual stability on DNA (~600 s), which may be released by adjacent single-stranded DNA (ssDNA). These observations suggest that ATP transforms short-lived MutS lesion scanning clamps into highly stable MMR signaling clamps that are capable of competing with chromatin and recruiting MMR machinery, yet are recycled by ssDNA excision tracts.

We designed an effective screening method for double strand DNA (dsDNA) binders using DNA-modified magnetic particles. Hairpin DNA was immobilized on the surface of magnetic particle for a simple screening of dsDNA binding materials in a solution containing various compounds. Through several magnetic separation and incubation processes, four DNA-binding materials, DAPI, 9AA, AQ2A, and DNR, were successfully screened from among five candidates. Efficiency of screening was demonstrated by HPLC analysis using a C2/18 reverse-phase column. In addition, their relative binding strengths were verified by measuring the melting temperature (). If hairpin DNA sequence is modified for other uses, this magnetic bead-based approach can be applied as a high-throughput screening method for various functional materials such as anti-cancer drugs.

The ability of MutS to recognize mismatched DNA is required to initiate a mismatch repair (MMR) system. ATP binding and hydrolysis are essential in this process, but their role in MMR is still not fully understood. In this study, steady-state ATPase activities of MutS from Escherichia coli were investigated using the spectrophotometric method with a double end-blocked heteroduplex containing gapped bases. The ATPase activities of MutS increased as the number of gapped bases increased in a double end-blocked heteroduplex with 2-8 gapped bases in the chain, indicating that MutS dissociates from DNA when it reaches a scission during movement along the DNA. Since movement of MutS along the chain does not require extensive ATP hydrolysis and the ATPase activity is only enhanced when MutS dissociates from a heteroduplex, these results support the sliding clamp model in which ATP binding by MutS induces the formation of a hydrolysis-independent sliding clamp.

A fluorescent method was developed for the detection of unpaired and mismatched DNAs using a MutS-fluorophore conjugate. The fluorophore, 2-(4'-(iodoacetoamido)anilino) naphthalene-6-sulfonic acid (IAANS), was site-specifically attached to the 469 position of Thermus aquaticus (Taq.) MutS mutant (C42A/T469C). The fluorophore labeled residue located at the dimer interface of the protein undergoes a drastic conformational change upon binding with mismatched DNA. The close proximity of the two identical fluorescent molecules presumably causes the self-quenching of the fluorophore, since fluorescence emission of the biosensor decreases with increasing concentrations of mismatched DNA. The order of binding affinity for each unpaired and mismatched DNA obtained by this method was DeltaT (Kd=52 nM)>GT (62 nM)>DeltaC (130 nM)>CT (160 nM)>DeltaG (170 nM)>DeltaA (250 nM)>CC (720 nM)>AT (950 nM). This order is comparable to the previous results of the gel mobility shift assay. Thus, this method can be a simple, useful tool for elucidating the mechanism of DNA mismatch repair as well as a novel probe for detecting of genetic mutation.

To study the effect of sequence on DNA structure, the two decamer crystal structures one alternating, d(GTACGCGTAC), and the other non-alternating, d(GGCCGCGGCC), were solved. Crystals of both decamers belong to the hexagonal space group P6 1 22, with one strand in the asymmetric unit. The unit cell constants of the alternating decamer are a = b = 39.26 A, c = 77.70 A. The structure was refined with 1,828 reflections from 8.0 to 2.0 A resolution to an R value of 21.3% with all DNA atoms and 63 water molecules. The isomorphous non-alternating decamer had unit cell dimensions of a = b = 39.05 A, c = 82.15 A. The structure was refined with 2,423 reflections from 8.0 to 2.0 A resolution to a final R value of 22.2% for all DNA atoms and 65 water molecules. Although the average helical parameters of the decamers are typical of A-DNAs, there are some minor differences between them. The helical twist, rise, x-displacement, inclination and roll alternate in the alternating decamer, but do not in the non-alternating decamer. The backbone conformations in both structures show some differences; the residue G(7) of the alternating decamer is trans for a and ywhile the trans conformations are observed at the residue G(8) of the non-alternating decamer.

Polymyxin B, a cationic antimicrobial peptide has been isolated from Paenibacillus polymyxa. The cationic peptide has polycationic, amphipathic and cyclic unique features. These characteristics of the cationic antimicrobial peptide are thought to contribute to the destruction of gram-negative bacteria by through an initial interaction with the negatively charged surface molecule lipopolysaccharide (LPS), which leads to self promoted uptake across the outer membrane into the negatively charged cytoplasmic membrane of the bacterium. This leads to membrane perturbation and probably translocation of the peptide across the membrane. Some gram-negative bacteria resistant to polymyxin B possess mechanism that modify the LPS through neutralization of its negative charge, which decreases the binding affinity of polymyxin B. Several of the genes regulated by PhoP/PhoQ and PmrA/ PmrB encode enzymes that modify either the acyl chain region or the phosphate group of LPS. In Salmonella, polymyxin B resistance is mainly controlled by the PmrA/PmrB two-component system (Figure 1). PmrA-activated genes encode periplasmic and cause the modification of the LPS. Transcription of PmrA-activated genes is not only promoted by high levels of extra-cytoplasmic Fe, which is sensed by the PmrB protein, also it is activated by the PhoP/PhoQ system in response to low levels of extra-cytoplasmic Mg. For activation of PmrA at the low level Mg condition not only requires the noncognate sensor PhoQ protein but also its cognate regulator PhoP, and the PhoP activated PmrD gene. The PmrD protein appears to control the PmrA/PmrB system at a post-transcriptional level. The PmrD protein activates the PmrA/PmrB system via a protection mechanism through dephosphorylation of PmrA. The protective activity of PmrD protein is suggestive of the behavior displayed by certain members of the 14-3-3 protein family in eukaryotes to prevent the phosphorylated state of CDC25. It has recently been reported that the differential regulation of homologous genes is the mechanism responsible for the divergence of Salmonella enterica and E. coli in their ability to make LPS modifications and mediate resistance to polymyxin B. In contrast to Salmonella, E. coli K-12 induces PmrA-activated gene transcription and polymyxin B resistance in response to Fe, but it makes no response to low levels of Mg. This discrepancy suggests that the structure of E.coli PmrD differs from Salmonella PmrD. In particular, the N-terminal region of PmrD, which differs between the E.coli and Salmonella proteins, is in part responsible for the distinct behaviors of the PmrD proteins (Figure 2). In the present report, we describe the crystallization and preliminary X-ray analysis of E. coli PmrD.

To develop a general method for the detection of histidine-tagged proteins, the interactions of the histidine epitope tag of MutH and MutL proteins with the epitope specific monoclonal anti-His6 antibody were monitored by a label-free direct method using impedance spectroscopy. The immunosensor was fabricated by covalent coupling of the antibody on a conducting polymer coated electrode surface. The impedance of the antibody modified electrode was decreased after binding to the histidine-tagged proteins. The specificity of the sensor was demonstrated by showing that no impedance change was occurred when the sensor was exposed to both of non-tagged MutH and MutL proteins. The specific interaction was further characterized using quartz crystal microbalance studies. Based on impedance measurements, the linear ranges were obtained from 50.0 to 125.0 and 50.0 to 250.0 micorg/ml, for His-tag MutH and His-tag MutL proteins, respectively. The detection limits were determined to be 37.8 and 59.1 microg/ml, for His-tag MutH and His-tag MutL proteins, respectively.

Background and objectives Information about the role of the stromal cell-derived factor-1α (SDF-1α)/chemokine receptor type 4 (CXCR4) axis in ischemic postconditioning (IPOC) is currently limited. We hypothesized that the SDF-1α/CXCR4 signaling pathway is directly involved in the cardioprotective effect of IPOC. Methods Isolated rat hearts were divided into four groups. The control group was subjected to 30-min of regional ischemia and 2-hour of reperfusion (n=12). The IPOC group was induced with 6 cycles of 10-second reperfusion and 10-second global ischemia (n=8) in each cycle. The CXCR4 antagonist, AMD3100, was applied before reperfusion in the IPOC group (AMD+IPOC group, n=11) and control group (AMD group, n=9). Hemodynamic changes with electrocardiography were monitored and infarct size was measured. The SDF-1α, lactate dehydrogenase (LDH) and creatine kinase (CK) concentrations in perfusate were measured. We also analyzed extracellular signal-regulated kinase 1/2 (ERK1/2) and Akt phosphorylation state expression. Results IPOC significantly reduced infarct size, but AMD3100 attenuated the infarct reducing effect of IPOC. IPOC significantly decreased LDH and CK, but these effects were reversed by AMD3100. ERK1/2 and Akt phosphorylation increased with IPOC and these effects were blocked by AMD3100. Conclusion Based on the results of this study, SDF-1α/CXCR4 signaling may be involved in IPOC cardioprotection and this signaling pathway couples to the ERK1/2 and Akt pathways.

A simple, sensitive, and selective colorimetric biosensor for the detection of the malarial biomarkers Plasmodium vivax lactate dehydrogenase (PvLDH) and Plasmodium falciparum LDH (PfLDH) was demonstrated using the pL1 aptamer as the recognition element and gold nanoparticles (AuNPs) as probes. The proposed method is based on the aggregation of AuNPs using hexadecyltrimethylammonium bromide (CTAB). The AuNPs exhibited a sensitive color change from red to blue, which could be seen directly with the naked eye and was monitored using UV-visible absorption spectroscopy and transmission electron microscopy (TEM). The reaction conditions were optimized to obtain the maximum color intensity. PvLDH and PfLDH were discernible with a detection limit of 1.25 pM and 2.94 pM, respectively. The applicability of the proposed biosensor was also examined in commercially available human serum.

DNA mismatch repair is critical for increasing replication fidelity in organisms ranging from bacteria to humans. MutS protein, a member of the ABC ATPase superfamily, recognizes mispaired and unpaired bases in duplex DNA and initiates mismatch repair. Mutations in human MutS genes cause a predisposition to hereditary nonpolyposis colorectal cancer as well as sporadic tumours. Here we report the crystal structures of a MutS protein and a complex of MutS with a heteroduplex DNA containing an unpaired base. The structures reveal the general architecture of members of the MutS family, an induced-fit mechanism of recognition between four domains of a MutS dimer and a heteroduplex kinked at the mismatch, a composite ATPase active site composed of residues from both MutS subunits, and a transmitter region connecting the mismatch-binding and ATPase domains. The crystal structures also provide a molecular framework for understanding hereditary nonpolyposis colorectal cancer mutations and for postulating testable roles of MutS.

The crystal structure of the RNA duplex, r(GUAUGUA)dC, with a 3'-terminal deoxy C residue, has been determined at 1.38 A resolution. The r(GUAUGU) hexameric consensus sequence is present at the exon-intron junction in pre-mRNAs of yeast and higher eukaryotic organisms. The crystal belongs to the rhombohedral space group R3. The hexagonal unit cell dimensions are a = b = 39.71 A, c = 68.15 A and gamma = 120 degrees with one duplex in the asymmetric unit. The structure was solved using the molecular replacement method. The final model contains 332 atoms of the duplex and 67 solvent molecules. The R-factor is 17.6% (Rfree of 23.1%) for 4035 reflections with For = 1.5sigma(F) in the resolution range 10.0 to 1.38 A. The duplex is of the A-type with a pseudodyad relating the two strands. The RNA helix is slightly distorted, in spite of the presence of two adjacent G x U wobble base-pairs located at the center of the helix. The twist angle between the wobble pairs, 38.1 degrees, is above the average value and those between the wobble base-pairs and the flanking Watson-Crick base-pairs, 26.7 degrees and 26.3 degrees, respectively, are lower than the average values. The twist between the junction base-pairs are about 24 degrees. The G x U wobble pairs are bridged by water molecules and solvated in the grooves. G x U base-pairs are as stable as the Watson-Crick A x U pairs and only slightly less stable than the G x C pairs accounting for their frequent occurrence in RNA.

Malaria, a major burden of disease caused by parasites of the genus Plasmodium, is widely spread in tropical and subtropical regions. Here, we have successfully developed a diagnostic technique for malaria. The proposed method is based on the interaction among the Plasmodium lactate dehydrogenase (pLDH), which is a biomarker for malaria, and pL1 aptamer against Plasmodium vivax lactate dehydrogenase (PvLDH) and Plasmodium falciparum lactate dehydrogenase (PfLDH). In addition, the cationic polymers, poly(diallyldimethylammonium chloride) (PDDA) and poly(allylamine hydrochloride) (PAH), aggregate gold nanoparticles (AuNPs) that should be possible to observe the change in color from red to blue, which depends on the concentration of pLDH. Using this aptasensor, pLDH proteins were successfully detected with low detection limits. Moreover, the specificity test proved that the aptasenor is very specific in targeting proteins over other interfering proteins. In addition, the pLDH from infected blood samples of the two main species of malaria were also detected. The limits of detection for P. vivax were determined as 80 parasites/μl for PDDA and 74 parasites/μl for PAH. The aptasenor has great advantages that can simply and rapidly diagnose malaria. Thus, the developed aptasensor for detection of pLDH can offer an effective and sensitive diagnosis of malaria.

Protocols for the routine chemical synthesis and purification of milligram quantities of RNA and DNA-RNA chimeras meeting the demands of X-ray crystallography are described. An efficient screening protocol to test the crystallizability of the molecules and the optimization of the crystallization conditions are presented, so as to allow reproduction by others. Essentially the same crystallization conditions as for DNA oligomers can be employed for RNA crystallization. Specific examples involving alternating octamers, G/C-rich decamers, sequences with overhangs, and drug complexes of chimeras are discussed. Success of the methods is attested by the crystals obtained which diffract to high resolution.

A rapid, homogeneous, and in-situ labelable format designed to detect single nucleotide polymorphism (SNP) is presented. Fluorescent silver nanoclusters produced following hydride-mediated reduction of Ag(+) bound to a partial double-stranded oligodeoxynucleotide were employed as probes for SNPs. The sensing mechanism is based on the fluorescence enhancement of silver nanoclusters through an irreversible cluster transfer upon hybridization. The key element of our design is modulating the "turn on" mechanism by introducing a competitor that can be displaced in response to a target DNA. In a controlled model system, the fluorescence intensity of silver nanoclusters is approximately 3-fold enhanced upon hybridization with a perfectly matched target DNA, and single-base mismatch detection is achieved within 5min, regardless of the position of mismatches. Human aldehyde dehydrogenase 2 (ALDH2), which is responsible for the oxidation of aldehydes to carboxylic acids, is then utilized as a target for SNP. Upon addition of a perfectly matched sequence, dramatically enhanced fluorescence intensity is observed (ca. 48-fold), and prompt SNP genotyping is accomplished.

An acedan derivative containing Zn(II)–DPA has been developed as a two-photon probe for nucleoside phosphates, which shows enhanced fluorescence toward ATP and ADP at physiological pH 7.4 among other competing anions including AMP; the probe is permeable to cell membranes and thus can be directly used for two-photon imaging of ATP and ADP in live cells.

The MutS2 homologues have received attention because of their unusual activities that differ from those of MutS. In this work, we report on the functional characteristics and conformational diversities of Thermotoga maritima MutS2 (TmMutS2). Various biochemical features of the protein were demonstrated via diverse techniques such as scanning probe microscopy (SPM), ATPase assays, analytical ultracentrifugation, DNA binding assays, size chromatography, and limited proteolytic analysis. Dimeric TmMutS2 showed the temperature-dependent ATPase activity. The non-specific nicking endonuclease activities of TmMutS2 were inactivated in the presence of nonhydrolytic ATP (ADPnP) and enhanced by the addition of TmMutL. In addition, TmMutS2 suppressed the TmRecA-mediated DNA strand exchange reaction in a TmMutL-dependent manner. We also demonstrated that small-angle X-ray scattering (SAXS) analysis of dimeric TmMutS2 exhibited nucleotide- and DNA-dependent conformational transitions. Particularly, TmMutS2-ADPnP showed the most compressed form rather than apo-TmMutS2 and the TmMutS2-ADP complex, in accordance with the results of biochemical assays. In the case of the DNA-binding complexes, the stretched conformation appeared in the TmMutS2-four-way junction (FWJ)-DNA complex. Convergences of biochemical- and SAXS analysis provided abundant information for TmMutS2 and clarified ambiguous experimental results.

We have found that the introduction of a single 2'-hydroxyl group on the sugar-phosphate backbone of the B-DNA decamer d(CCGGCGCCGG) transforms it to A-DNA. Thus, for the first time the X-ray structures of the same sequence have been observed in both the A and B-DNA conformations, permitting a comparison. Crystals of the DNA-RNA chimeric decamer d(CCGGC)r(G)d(CCGG) belong to the orthorhombic space group P2(1)2(1)2(1) with unit cell dimensions a = 25.63 A, b = 45.24 A and c = 47.99 A, and one decamer duplex in the asymmetric unit. The structure was solved by a rigid body search using the coordinates of the isomorphous structure d(CCCGGCCGGG) and refined to an R value of 0.136 using 2753 unique reflections at 1.9 A resolution. The final model contains 406 nucleotide atoms and 61 water molecules. The chimeric duplex exhibits typical A-DNA geometry, with all the sugars in the C(3')-endo puckering and the base-pairs inclined and displaced from the helix axis. The 2'-hydroxyl groups on rG6 and rG16 protrude into the minor groove surface and form different types of hydrogen bonds; that on strand 1 forms an intermolecular hydrogen bond with the furanose ring O(4') of a symmetry-related C1 residue, while that on strand 2 is involved in two water bridges. Crystal packing forces the G4-G17 base-pair in the top half of the duplex to slide significantly into the minor groove compared to the corresponding G7-G14 base-pair in the bottom half, resulting in these base-pairs exhibiting different base stacking and intermolecular interactions. The base G4 of the G4-G17 base-pair forms an unorthodox base "triple", G4*(G10-C11), hydrogen-bonding through its minor groove sites N(2) and N(3) to the minor groove atoms N(2) and O(2) of both bases of the G10-C11 base-pair of a symmetry-related molecule. The base G10 of this triple in turn forms a second similar unorthodox base triple, G10*(G3*C18), with the adjacent base-pair G3-C18 of the duplex, thus G10 is involved in a double triple. On the other hand, in the bottom half of the duplex, the C7-G14 base-pair is involved only in a single similar unorthodox base triple with G20, (C7-G14)*G20, while the adjacent base-pair rG6-C15 is involved in a novel quadruple with C1-G20, (rG6-C15) *(C1-G20), where the latter base-pairs are hydrogen-bonded to each other via the minor groove sites G(N(2))...C(O(2)).(ABSTRACT TRUNCATED AT 400 WORDS)

The crystal structure of the recombinant calmodulin from Paramecium tetraurelia (rPCaM, M(r) = 16 700, 148 residues) has been determined at 1.68 A resolution. X-ray intensity data were collected at 263 K using a Siemens-Nicolet area detector and Cu Kalpha radiation from a rotating-anode source. A total of 35 936 observations were processed with XENGEN1.3 and scaled to yield 16 255 unique reflections with R(symm)(I) of 4.1%. The crystals are triclinic, with unit-cell dimensions a = 29.89, b = 53.42, c = 25.35 A, alpha = 93.67, beta = 96.88, gamma = 89.24 degrees, space group P1, with one molecule in the unit cell. The atomic coordinates of the wild-type Paramecium calmodulin (PCaM) studied in our laboratory provided the starting model. Refinement of the structure by X-PLOR and refitting it into omit maps yielded an R value of 0.194 for 15 965 reflections greater than 3sigma(F) in the 6.0-1.68 A resolution range. The final model contained 1165 protein atoms for all of the 148 residues, four Ca(2+) ions, and 172 water molecules. The dumbbell structure has seven alpha-helices including a long 7.8 turn central helix connecting the two terminal domains each containing two EF-hand (helix-loop-helix motif) calcium-binding sites. The loops within each pair of EF-hand motifs in the N- and C-terminal domains are brought into juxtaposition to form a pair of hydrogen-bonded antiparallel beta-sheets which are extended at either ends by water bridges. The four calcium-binding EF-hands are superposable with r.m.s. deviations of 0.31-0.79 A. The best agreement is between site 1 and site 3 and the worst agreement is between site 1 and 4. The largest differences are in the ninth and tenth residues of the calcium-binding loops probably because of their involvement in the mini beta-sheets. The calcium coordination distances vary between 2.04 and 2.69 A, average 2.34 A. The rPCaM and wild-type PCaM have an r.m.s. deviation of 0.36 A for equivalent C(alpha) atoms. The side chains of Lys13 and Lys115 are more extended in rPCaM compared to the wild type where the post-translational modified di- and tri-methylated lysine residues are more folded. The sequence of PCaM differs from those of mammalian (MCaM) and Drosophila calmodulin (DCaM), but the overall structures are very similar, with r.m.s,. deviations of 0.44 and 1.68 A for equivalent C(alpha) atoms, respectively. However, in rPCaM, the first four N-terminal residues stretch out and make intermolecular crystal contacts, in contrast to those in recombinant Drosophila calmodulin (rDCaM), they stretch out in the opposite direction and towards the second calcium-binding site (see note below), while in MCaM and wild-type PCaM, the N-terminal residues are not visible. The central helix in rPCaM has all its backbone hydrogen bonds intact with no unusually long separation between the carbonyl and amide groups as found in MCaM and rDCaM.

The crystal structure of the self-complementary chimeric decamer duplex r(C)d(CGGCGCCG)r(G), with RNA base pairs at both termini, has been solved at 1.9 A resolution by the molecular replacement method and refined to an R value of 0.145 for 2,314 reflections. The C3'-endo sugar puckers of the terminal riboses apparently drive the entire chimeric duplex into an A-DNA conformation, in contrast to the B-DNA conformation adopted by the all-deoxy decamer of the same sequence. Five symmetry related duplexes encapsulate a spermine molecule which interacts with ten phosphate groups, both directly and through water molecules to form multiple ionic and hydrogen bonding interactions. The spermine interaction severely bends the duplexes by 31 degrees into the major groove at the fourth base pair G(4).C(17), jolts it and slides the 'base plate' into the minor groove. This base pair, together with the adjacent base pair in the top half and the corresponding pseudo two-fold related base pairs in the bottom half, form four minor groove base-paired multiples with the terminal base pairs of two neighboring duplexes.

A gold nanoparticle based dual fluorescence–colorimetric method was developed as an aptasensor to detect ampicillin using its single-stranded DNA (ssDNA) aptamer, which was discovered by a magnetic bead-based SELEX technique. The selected aptamers, AMP4 (5′-CACGGCATGGTGGGCGTCGTG-3′), AMP17 (5′-GCGGGCGGTTGTATAGCGG-3′), and AMP18 (5′-TTAGTTGGGGTTCAGTTGG-3′), were confirmed to have high sensitivity and specificity to ampicillin (K d, AMP7 = 9.4 nM, AMP17 = 13.4 nM, and AMP18 = 9.8 nM, respectively). The 5′-fluorescein amidite (FAM)-modified aptamer was used as a dual probe for observing fluorescence differences and color changes simultaneously. The lower limits of detection for this dual method were a 2 ng/mL by fluorescence and a 10 ng/mL by colorimetry for ampicillin in the milk as well as in distilled water. Because these detection limits were below the maximum residue limit of ampicillin, this aptasensor was sensitive enough to detect antibiotics in food products, such as milk and animal tissues. In addition, this dual aptasensor will be a more accurate method for antibiotics in food products as it concurrently uses two detection methods: fluorescence and colorimetry.

We have designed multiple detection systems for the DNA strand exchange process. Thermostable Thermotoga maritima recombinase A (TmRecA), a core protein in homologous recombination, and DNAzyme, a catalytic DNA that can cleave a specific DNA sequence, are introduced in this work. In a colorimetric method, gold nanoparticles (AuNPs) modified with complementary DNAs (cDNAs) were assembled by annealing. Aggregated AuNPs were then separated irreversibly by TmRecA and DNAzyme, leading to a distinct color change in the particles from purple to red. For the case of fluorometric detection, fluorescein isothiocyanate (FITC)-labeled DNA as a fluorophore and black hole quencher 1 (BHQ1)-labeled DNA as a quencher were used; successful strand exchange was clearly detected by variations in fluorescence intensity. In addition, alterations in the impedance of a gold electrode with immobilized DNA were employed to monitor the regular exchange of DNA strands. All three methods provided sufficient evidence of efficient strand exchange reactions and have great potential for applications in the monitoring of recombination, discovery of new DNAzymes, detection of DNAzymes, and measurement of other protein activities.

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

DNA binding by MutL homologs (MLH/PMS) during mismatch repair (MMR) has been considered based on biochemical and genetic studies. Bulk studies with MutL and its yeast homologs Mlh1-Pms1 have suggested an integral role for a single-stranded DNA (ssDNA) binding activity during MMR. We have developed single-molecule Förster resonance energy transfer (smFRET) and a single-molecule DNA flow-extension assays to examine MutL interaction with ssDNA in real time. The smFRET assay allowed us to observe MutL-ssDNA association and dissociation. We determined that MutL-ssDNA binding required ATP and was the greatest at ionic strength below 25 mM (K(D) = 29 nM) while it dramatically decreases above 100 mM (K(D)>2 µM). Single-molecule DNA flow-extension analysis suggests that multiple MutL proteins may bind ssDNA at low ionic strength but this activity does not enhance stability at elevated ionic strengths. These studies are consistent with the conclusion that a stable MutL-ssDNA interaction is unlikely to occur at physiological salt eliminating a number of MMR models. However, the activity may infer some related dynamic DNA transaction process during MMR.

Using an RNA/peptide dual-aptamer probe, both PSMA (+) and PSMA (−) prostate cancer cells were simultaneously detected by electrochemical impedance spectroscopy. This approach can be applied as a general tool for early diagnosis of prostate cancer.

An amperometric chloramphenicol (CAP) immunosensor was fabricated by covalently immobilizing anti-chloramphenicol acetyl transferase (anti-CAT) antibody on cadmium sulfide nanoparticles (CdS) modified-dendrimer that was bonded to the conducting polymer (poly 5, 2′: 5′, 2″-terthiophene-3′-carboxyl acid (poly-TTCA)) layer. The AuNPs, dendrimers, and CdS nanoparticles were deposited onto the polymer layer in order to enhance the sensitivity of the sensor probes. The particle sizes were determined using scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The immobilization of dendrimers, CdS, and anti-CAT were confirmed using energy disruptive spectroscopy (EDS), X-ray photoelectron spectroscopy (XPS), and quartz crystal microbalance (QCM) techniques. The detection of CAP was based on the competitive immuno-interaction between the free- and labeled-CAP for active sites of the anti-CAT. Hydrazine was used as the label for CAP, and it electrochemically catalyzed the reduction of H2O2 at −0.35 V vs. Ag/AgCl. Under optimized conditions, the proposed immunosensor exhibited a linear range of CAP detection between 50 pg/mL and 950 pg/mL, and the detection limit was 45 pg/mL. The immunosensor was examined in real meat samples for the analysis of CAP.