Search

Rationale: Mutations in myosin heavy chain ( MYH11 ) cause autosomal dominant inheritance of thoracic aortic aneurysms and dissections. At the same time, rare, nonsynonymous variants in MYH11 that are predicted to disrupt protein function but do not cause inherited aortic disease are common in the general population and the vascular disease risk associated with these variants is unknown. Objective: To determine the consequences of the recurrent MYH11 rare variant, R247C, through functional studies in vitro and analysis of a knock-in mouse model with this specific variant, including assessment of aortic contraction, response to vascular injury, and phenotype of primary aortic smooth muscle cells (SMCs). Methods and Results: The steady state ATPase activity (actin-activated) and the rates of phosphate and ADP release were lower for the R247C mutant myosin than for the wild-type, as was the rate of actin filament sliding in an in vitro motility assay. Myh11 R247C/R247C mice exhibited normal growth, reproduction, and aortic histology but decreased aortic contraction. In response to vascular injury, Myh11 R247C/R247C mice showed significantly increased neointimal formation due to increased SMC proliferation when compared with the wild-type mice. Primary aortic SMCs explanted from the Myh11 R247C/R247C mice were dedifferentiated compared with wild-type SMCs based on increased proliferation and reduced expression of SMC contractile proteins. The mutant SMCs also displayed altered focal adhesions and decreased Rho activation, associated with decreased nuclear localization of myocardin-related transcription factor-A. Exposure of the Myh11 R247C/R247C SMCs to a Rho activator rescued the dedifferentiated phenotype of the SMCs. Conclusions: These results indicate that a rare variant in MYH11 , R247C, alters myosin contractile function and SMC phenotype, leading to increased proliferation in vitro and in response to vascular injury.

Targeting CAR T resistance due to CD19 loss with CD79b-specific CAR T cells in B-cell malignancies Fuliang Chu, JingJing Cao, Jingwei Liu, Xiaoyun Cheng, Swathi Karri, Adithi Reddy, Shao Qing Kuang, Jinsheng Weng, Sattva S. Neelapu Department of Lymphoma and Myeloma, The University of Texas M. D. Anderson Cancer Center. Houston, TX 77030 USA Chimeric antigen receptor (CAR) T cells targeting CD19 are highly effective in B-cell malignancies and two CD19-targteing CAR T-cell therapy products were recently approved by the US FDA for relapsed or refractory B-cell acute lymphoblastic leukemia and/or large B cell lymphoma. In pivotal trials, durable remissions lasting more than 1 year have been observed in ~40-50% of these patients. However, relapse or progression occurs in ~50-60% and a major cause of resistance appears to be due to CD19 antigen loss. Thus, there is an urgent need to develop CAR T-cell therapies against novel targets to further improve outcomes in these patients. CD79b is a pan B-cell linage marker and an important component of the B-cell receptor complex. CD79b is broadly expressed in normal B cells and B-cell malignancies and its expression is usually retained in CD19 negative tumors progressing after CD19-specific CAR T-cell therapy. Here, we report our results with a novel CD79b-specific CAR T cell product in in vitro and in vivo models. We generated five murine monoclonal antibodies against human CD79b by hybridoma technology and demonstrated that they bind specifically to recombinant human CD79b, have high affinity (Kd range of 1.44-18.1 nM), and stain multiple B-cell lymphoma cell lines comparable to the commercial CD79b fluorochrome-labeled antibodies. Next, we cloned the variable regions of the heavy and light chains of the CD79b antibodies, and developed lentiviral constructs for CD79b-specific CARs with CD3z and CD28 costimulatory domains. We demonstrated that the CD79b-CAR lentiviral constructs can be transduced into primary CD4+ and CD8+ T cells from healthy donors to >85% transduction efficiency. We observed that the CD79b-specific CAR T cells but not untransduced T cells had significant cytotoxic activity that was comparable to control CD19-specific CAR T cells against Daudi Burkitt lymphoma and Mino mantle cell lymphoma cell lines. More importantly, CD79b- but not CD19-specific CAR T cells lysed CD19-CD79b+ lymphoma cells. Significant CD107a/b degranulation was also observed in both CD4+ and CD8+ CD79b-specific CAR T cells when they were co-cultured with lymphoma cell lines. Multiplex cytokine analysis of co-culture supernatants revealed predominantly release of IFN-γ. The efficacy of CD79b-specific CAR T cells was also examined in vivo against Mino xenograft models in NSG mice. Luciferase-labeledMino mantle cell lymphoma cell line was injected IV into NSG mice at 2x106 tumor cells/mouse. After 18 days, mice were treated with untransduced primary T cells, CD19-specific CAR, or CD79b-specific CAR T cells via tail vein at 10x106 T cells/mouse. Bioluminescence imaging was used to assess tumor burden. Tumor growth was inhibited and survival was markedly improved in mice treated with CD19- and CD79b-specific CAR T cells but progressive tumor growth was observed in the control group treated with untransduced T cells. Additional studies using CD19-CD79b+ lymphoma cell line xenograft model are ongoing and will be presented at the meeting. In conclusion, these preclinical results indicate that CD79b is a novel target for CAR T-cell therapy and support its evaluation in patients with B-cell malignancies. Importantly, our results suggest that targeting CD79b could be a novel strategy to overcome resistance due to CD19 loss after CD19-specific CAR T-cell therapy. Disclosures No relevant conflicts of interest to declare.

Activating signal cointegrator 2 (ASC-2) is a transcriptional coactivator of many nuclear receptors (NRs) and other transcription factors and contains two NR-interacting LXXLL motifs (NR boxes). In the pancreas, ASC-2 is expressed only in the endocrine cells of the islets of Langerhans, but not in the exocrine cells. Thus, we examined the potential role of ASC-2 in insulin secretion from pancreatic beta-cells. Overexpressed ASC-2 increased glucose-elicited insulin secretion, whereas insulin secretion was decreased in islets from ASC-2+/- mice. DN1 and DN2 are two dominant-negative fragments of ASC-2 that contain NR boxes 1 and 2, respectively, and block the interactions of cognate NRs with the endogenous ASC-2. Primary rat islets ectopically expressing DN1 or DN2 exhibited decreased insulin secretion. Furthermore, relative to the wild type, ASC-2+/- mice showed reduced islet mass and number, which correlated with increased apoptosis and decreased proliferation of ASC-2+/- islets. These results suggest that ASC-2 regulates insulin secretion and beta-cell survival and that the regulatory role of ASC-2 in insulin secretion appears to involve, at least in part, its interaction with NRs via its two NR boxes.

The amplified in breast cancer-3 (AIB3, ASC-2, RAP250, PRIP, TRBP, NRC, or NcoA6) gene is characterized as a cancer-amplified transcriptional coactivator for nuclear receptors, which include the peroxisome proliferator-activated receptor gamma (PPARgamma). To assess its biological function, we deleted the AIB3 gene in mice by homologous recombination. AIB3(+/-) mice are developmentally normal and fertile. AIB3(-/-) embryos exhibit growth restriction and lethality during 9.75-11.5 days postconception. The embryonic lethality is probably attributed to defects in the development of the placental vascular network and cardiac hypoplasia. These defects include the failure of labyrinthine development, the dilation of maternal blood sinuses, the massive erythrophagocytosis by trophoblasts, the alteration of trophoblast populations, and the lower proliferation of myocardium, which are similar to those encountered in mice lacking PPARgamma or the PPARgamma-binding protein (PBP, TRAP220, or DRIP205). In addition, the transcriptional activities of PPARgamma are significantly affected in mouse embryonic fibroblasts lacking AIB3. These results suggest that AIB3 is required for PPARgamma function in placental development and for normal heart development. These results also indicate that the biological function of AIB3 is not redundant with other classes of nuclear receptor coactivators such as PBP and members of the steroid receptor coactivator family.

A large east Texas family with autosomal dominant inheritance of a novel bleeding disorder has been identified. The disorder is characterized clinically by easy bruising, life-threatening bleeding with trauma or surgery, and menorrhagia in affected women. Laboratory studies demonstrated prolongation of the prothrombin time and activated partial thromboplastin time in affected individuals. Paradoxically, assays of known coagulation factors are all within normal limits. To determine the molecular basis of this disease, a candidate gene linkage analysis in this kindred was done. Initially it was hypothesized that the cause of the disease in this family could be an antithrombin III (AT3) mutation that resulted in a constitutively active AT3 in the absence of heparin binding. Linkage studies using DNA from the family and an intragenic polymorphic marker within the AT3 gene showed that the disease mapped to this locus. The coding region and intron/exon junctions of AT3were sequenced using the proband's DNA, but this analysis failed to identify a mutation. Additional family members were recruited for the study, and 16 polymorphic markers around the AT3 gene were analyzed. Using 2 recombinants, the critical interval for the defective gene was narrowed to approximately 1.5 Mb, centromeric toAT3. The factor V (FV) gene was mapped into the disease interval and sequenced; there were no mutations found. Elucidation of the genetic defect causing the bleeding disorder in this family may reveal a novel protein involved in the coagulation cascade.

Eph receptors and their ephrin ligands are involved in normal hematopoietic development and tumorigenesis. Using methylated CpG island amplification/DNA promoter microarray, we identified several EPH receptor and EPHRIN genes as potential hypermethylation targets in acute lymphoblastic leukemia (ALL). We subsequently studied the DNA methylation status of the Eph/ephrin family by bisulfite pyrosequencing. Hypermethylation of EPHA2, -A4, -A5, -A6, -A7, -A10, EPHB1, -B2, -B3, -B4, EFNA1, -A3, -A5, and EFNB1 and -B2 genes was detected in leukemia cell lines and primary ALL bone marrow samples. Expression analysis of EPHB4, EFNB2, and EFNA5 genes demonstrated that DNA methylation was associated with gene silencing. We cloned the promoter region of EPHB4 and demonstrated that promoter hypermethylation can result in EPHB4 transcriptional silencing. Restoration of EPHB4 expression by lentiviral transduction resulted in reduced proliferation and apoptotic cell death in Raji cells in which EPHB4 is methylated and silenced. Finally, we demonstrated that phosphorylated Akt is down-regulated in Raji cells transduced with EPHB4. These results suggest that epigenetic silencing by hypermethylation of EPH/EPHRIN family genes contributes to ALL pathogenesis and that EPHB4 can function as a tumor suppressor in ALL.

Nuclear hormone receptors are ligand-dependent transcription factors that require coactivators to regulate target gene expression. The steroid receptor coactivator-3 (SRC-3), also known as p/CIP, RAC3, AIB1, ACTR and TRAM-1, is a cancer-amplified coactivator in the SRC gene family that also contains SRC-1 and TIF2/GRIP1. SRC-3 interacts with nuclear receptors and certain other transcription factors, recruits histone acetyltransferases and methyltransferases for chromatin remodeling and facilitates target gene transcription. Accumulated results from both ex vivo and animal model studies indicate that SRC-3 plays important roles in many biological processes involving cell proliferation, cell migration, cell differentiation, somatic growth, sexual maturation, female reproductive function, vasoprotection and breast cancer. This article summarizes our current knowledge about SRC-3 under the following topics: molecular cloning and characterization; molecular structure and functional mechanisms; SRC-3 as a molecular target of growth factors and cytokines; organization and expression of the SRC-3 gene; generation and characterization of SRC-3 knockout mice; role of SRC-3 in the vasoprotective effects of estrogen; role of SRC-3 in cell migration, proliferation and cancers.

Abstract 2030 Poster Board II-7 Aberrant DNA methylation of multiple promoter associated CpG islands is frequent in primary ALL and predicts for poor prognosis in adult and pediatric disease. Treatment of ALL cell lines with the hypomethylating agent decitabine results in induction of global and gene specific hypomethylation, reactivation of epigenetically silenced genes and induction of apoptosis at low concentrations and prolonged exposures (Leuk Res 2005;29:739-48). Prior studies of decitabine in myeloid leukemias indicated that induction of global and gene specific hypomethylation using a 5-day schedule of decitabine is transient peaking 7 to 10 days after initiation of therapy. In view of the proliferative nature of ALL and in vitro modeling results, we designed a phase 1 study of decitabine administered daily x 5 every other week in patients with relapsed or refractory ALL. The main objective of the study is to determine the safety, activity, pharmacodynamic effects and optimal dose (based on clinical activity, toxicity profile and hypomethylating properties) of decitabine in relapsed refractory ALL. The study design follows a standard “3+3” rule with an expansion cohort of N=10 patients at the optimal dose. Patients of any age with relapsed refractory ALL are elegible regardless of performance status or organ function. Initial dose level of decitabine was 10 mg/m2 IV infused over 1 hour daily x 5 days every other week with courses of therapy repeated every 28 days. Use of steroids was allowed during the first course of therapy at the discretion of treating physician. 23 patients have been treated in 7 dose levels (10, 20, 40, 60, 80, 100 and 120 mg/m2 IV QD x 5 every other week). Cumulative doses per course ranged from 100 to 1200 mg/m2. Patient characteristics are: median age 36 years (range 8-67), median WBC 5.3 (range 0.2 to 97), median % peripheral blasts 23% (0-97), cytogenetics diploid in 4 (17%), Ph + 2 (8%), complex 17 (73%), phenotype preB/B in 15 (65%). Median number of prior therapies was 3 (range 1 to 7). No severe drug related grade 3 or 4 toxicity was observed at any dose level. Frequent toxicities included diarrhea, fatigue and liver function abnormalities that were limited and probably related to disease. Overall response rate was 23% (6 pts) including 1 CRp (complete remission with incomplete platelet recovery) and 5 complete marrow responses (blasts less than 5%). All responses lasted at least 4 weeks. Responses were observed at multiple dose leves (#1, 2, 4, 5, 7). Global and gene specific methylation was analyzed on days 0, 2,5, 14,16,19 and 28 of cycle 1. Samples were collected from 18 consenting patients. Global methylation was analyzed using the LINE bisulfite pyrosequencing assay. Median day 0 methylation was 63%, declined to 55% (p=0.01) on day 14 and increased to 61% on day 28. The most effective dose in inducing global hypomethylation was 60 mg/m2 : 61% baseline to 21% on day 28. The following genes were analyzed for gene specific methylation: p73, p15, p15, HES5, Notch3 and Jag1. Induction of hypomethylation was observed in informative patients, a process associated with gene expression reactivation. The analysis is not powered to detect association between response and hypomethylating effect. Finally, depletion of DNMT1 was measured using a Western blot assay. Depletion was only observed in 1 patient treated at 60 mg/m2 that had achieved a response. In summary, single agent decitabine is safe at higher doses than used in myeloid leukemias with clinical activity in patients with advanced refractory relapsed ALL. Of importance, hypomethylating effect is observed at cumulative doses of up to 1200 mg/m2 with a maximal effect at 600 mg/m2, doses that are considered cytotoxic in myeloid leukemias. The study continues at the expansion cohort of 60 mg/m2 IV QD x 5 every other week, the dose considered to be optimal based on toxicity, response and hypomethylating effects. Two patients have been treated but are early for assessment. A parallel study of decitabine combined with hyperCVAD is ongoing in patients that do not respond or progress after single agent decitabine. The activity of decitabine should be tested in patients in first relapse ALL. Disclosures: Off Label Use: Decitabine is not approved for treatment of ALL.

Abstract 982 Poster Board I-4 Recently,Mulligan et al have reported on the strong relationship between deletion of IKZF1 and poor prognosis in pediatric acute lymphocytic leukemia (ALL) (NEJM 2009;360:470-80). This study is of significant importance as it may allow for the identification of children with poor prognosis disease not currently identifiable with standard clinical or molecular assays. Aberrant DNA methylation consists on the addition of a methyl group to a cytsosine (C) when it is followed by a guanine (G) in so-called CpG sites. Methylation of CpG rich areas (CpG islands) in the proximity of gene promoters is associated with gene silencing and is considered a functional equivalent to the physical inactivation of genes via deletions or inactivating mutations. Aberrant DNA methylation is very frequent in both adult and pediatric ALL. Indeed, CDKN2A and 2B, two genes known to be frequently methylated in ALL were also found to be deleted in Mullighan's study. Furthermore, CDKN2A has been shown to be both methylated and deleted in patients with hematological malignancies5. Therefore it is possible that aberrant methylation of IKZF1 could provide a functional alternative to its deletion in both adult and pediatric ALL. To study this issue, we analyzed the frequency of IKZF1 methylation in ALL. First using BLAT database (http://genome.brc.mcw.edu/cgi-bin/hgBlat), we established that IKZF1 contains a CpG island in the proximity of its promoter. Subsequently, we designed a set of primers for bisulfite pyrosequencing analysis of IKZF1 methylation (forward primer sequence was GTTATTGTGAAAGAAAGTTGGGAAGAG in positions -116 to -89 from the transcription start site; reverse primer was CCTCCCCCCCAAACTAAAATAC in position +29 to +7 from the start site; and the sequencing primer was AGTTAGTAGGATATTTTAATAAGTG from -78 to -53). Annealing temperature was 59 °C. Conditions for bisulfite conversion of DNA and pyrosequencing have been previously reported. Using these conditions and primers, we first analyzed a battery of 21 leukemia cell lines (Molt4, Jurkat, PEER, T-ALL1, CEM, J-TAG, B-JAB, RS4, ALL1, REH, Raji, Ramos, K562, BV173, HL60, NB4, THP1, U937, OCI-AML3, HEL, KBM5R) of different origins. As negative controls, we used DNA extracted from peripheral blood mononuclear cells from healthy donors and as positive controls SssI treated DNA. None of the cell lines or controls had evidence of DNA methylation of IKZF1 (median 1.53%, range 0.94 to 1.76). By convention, a sample is considered to be methylated if the percent of methylation is above 10 to 15%. Despite the fact that it is extremely unlikely to find DNA methylation in absence of evidence of methylation in cell lines, we decided to analyze the methylation status of IKZF1 in two different cohorts of patients with ALL. The first cohort consisted of a group of pediatric patients (N=20) previously reported by us (Leuk Res 2005;29:881-5). Median methylation was 2.8% (range 1.5 to 11.4). The second cohort of consisted of 17 patients. Median age was 33 years (range 8 to 66); 12 patients (70%) had pre-B/B phenotype, 4 (23%) were female and 14 (82%) had complex cytogenetics. Median methylation was 1.3%, range 0.38 to 2.3%. Our data indicates that functional inactivation of IKZF1 via aberrant DNA methylation is probably a very rare phenomenon in ALL. This data has implications for our understanding of the prognostic role of IZFZ1 in ALL and for future testing of IKZF1 inactivation in this disease. Disclosures: No relevant conflicts of interest to declare.

The Notch signaling pathway has been implicated in multiple functions during normal hemato-lymphoid development. It also plays critical roles in T-cell leukemogenesis through influencing T-cell proliferation, differentiation and survival. In contrast, we have previously reported a tumor suppressor role in B-cell leukemias, where Notch signaling leads to growth inhibition and apoptosis. The Notch target genes Hairy/Enhancer of Split (HES1-7) encode transcriptional repressors with basic helix-loop-helix (bHLH) domains. Functional and phenotypic analyses of some of the HES family members have been reported, however, expression and epigenetic regulation of the HES family in leukemia is largely unknown. Using Methylated CpG Island Amplification (MCA) / DNA promoter microarray, we identified several HES family genes as hypermethylated in B cell acute lymphoblastic leukemia (B ALL). We further investigated the comprehensive methylation profiles of HES family genes in a panel of leukemia cell lines and ALL patient samples by bisulfite pyrosequencing. Aberrant DNA methylation of HES2, HES4, HES5 and HES6 was detected in most B ALL cell lines including B-JAB, RS4:11, REH, Raji and Ramos but not in normal B cell controls. In contrast, in T cell leukemia cell lines such as Molt4, PEER, T-ALL1 and J-TAG, these genes were generally unmethylated. In B ALL patient samples, the frequencies of DNA methylation in the promoter regions of these genes were 25% for HES2, 50% for HES4, 76% for HES5 and 71% for HES6. Expression analysis of HES4, HES5 and HES6 in leukemia cell lines by real-time PCR further confirmed methylation associated gene silencing. Treatment of methylated/silenced cell lines with DNA methyltransferase inhibitor 5’-aza-2’-deoxycytidine resulted in HES gene re-expression. Finally, forced re-expression of HES5 and HES6 in methylation silenced Rs4 and REH cell lines inhibited cell growth. These results suggest that the Notch/HES signaling pathway is epigenetically-inactivated in B ALL. These data support the role of the HES family as tumor suppressors in pre-B ALL and establish epigenetic modulation as a novel mechanism of Notch pathway regulation. We anticipate that therapies capable of activating Notch/HES signaling may have therapeutic potential in B cell leukemias.

Background: Aberrant DNA methylation of multiple promoter associated CpG islands is very prevalent phenomenon in human leukemias. Data from several laboratories indicate that methylation profiling allows the identification of leukemia patients with different prognosis. It is now accepted that human leukemias are characterized by the methylation of multiple promoter CpG islands involving multiple epigenetically dyregulated molecular pathways. Little is known in terms of the molecular epigenetic heterogeneity of different lymphoid malignancies. The identification of specific molecular pathways shared by phenotypic/genetic distinct types of leukemias may provide important understanding of critical molecular pathways in leukemia. Aims: To compare the genome-wide methylation profiles of ALL and CLL. To do so, we have used a genome wide methylation assay combining MCA (Methylated CpG island Amplification) with the Agilent promoter CpG array. This allows the identification simultaneously of hundreds of abnormally methylated CpG islands. The aim was to identify common epigenetically regulated pathways shared by both disorders. Results: We identified 280 promoter CpG islands differentially methylated in CLL and 405 protomer CpG island differentially methylated in ALL. Of all these genes, 47 (7.4%) of them were commonly methylated in both ALL and CLL. We then characterized the methylation profiles of these 47 genes in a cohort of ALL (N=24) and CLL (N=78) patient samples and tried to identify common molecular pathway(s) that are epigenetically deregulated in ALL and CLL. We also performed interaction pathway and functional analysis of these 47 genes using the online Ingenuity Pathway Analysis tools. The initial analysis divided these genes into 8 functional networks, with major functions involving cancer, cell growth and differentiation, and tissue development. We validated 18 of these 47 genes (NR2F2, SOX14, SOX11, DLX1, DLX4, FAM62C, BLC11B, KLK10, PRIMA1, HAND2, BNC1, SPOCK, COL2A, GPC6, SSTR1, PEG10, BASP1, CYP1B1) in human leukemia cell lines (N=22), CLL patient samples (N=78), ALL patient samples (N=24) and normal CD19+ B-cells (NBCs) from healthy controls (N=10). All of the 18 genes with the exception of BNC1 have higher level of methylation in leukemia cell lines, CLL and ALL patients than NBCs. For some of these genes, the level of methyation was usually higher in ALL than CLL patients (NR2F2, p=0.03; SOX14, p=0.0005; DLX4, p=0.0001; FAM62C, p=0.0003; KLK10, p=0.039; PRIMA1, p=0.0001; HAND2, p=0.0001; BNC1, p=0.003; BASP1, p=0.0001; CYP1B1, p=0.0001). Conclusions: The current study identified 47 promoter CpG islands that are commonly methylated in both ALL and CLL using MCA-microarray technique. This information will help target on common molecular pathway(s) that are epigenetically deregulated in the pathogenesis of ALL and CLL. The correlation between methylation profile of these genes and prognosis, survival in lymphoid leukemia needs to be further evaluated in a larger number of patients.

Histone deacetylase (HDAC) inhibitors are being developed clinically for the treatment of leukemia. Because HDACs are composed of a large number of different proteins, and substrate specificity may differ among different HDAC inhibitors, it is important to understand if human leukemias are characterized by specific HDAC expression patterns. To study this, we have analyzed using real-time PCR and Western blots, all major class I and II HDACs in normal marrow controls (N=13, including 10 CD19+ B cell specimens), leukemia cell lines (N=25), samples from patients with AML (N=6), MDS (N=12), CLL (N=10) and human samples (N=6) obtained pretreatment and sequentially from patients with leukemia treated with two different phase I clinical trials of HDAC inhibitors: MGCD0103 and vorinostat. In general, normal controls were characterized by low levels of HDACs 1 to 10, although normal CD19+ B cells exhibited a significant increased expression of HDAC1 and 5. In leukemia cell lines, HDAC 1, 2 and 3 were expressed at higher levels than 4 to 10 but there were no differences between leukemia cell lines and normal controls or B cells. HDAC mRNA expression was not modified by cell proliferation or treatment with HDAC inhibitors. No specific HDAC expression profiles were detected in primary human AML or MDS samples. In contrast, CLL primary samples were characterized by an overexpression of HDAC 1,3,5 and 10, although this pattern was not significantly different than that of normal CD19+ B cells. Sequential analysis of human samples obtained from patients treated with two different HDAC inhibitors, vorinostat or MGCD0103 on two different clinical trials, did not affect expression profiles in patients with MDS or AML. Overall, mRNA expression results correlated with protein levels. In summary, our results indicate that AML or MDS are not characterized by a leukemia specific HDAC expression profile but that B cells and B cell leukemia are characterized by a significant overexpression of HDAC 1. This could explain the activity observed with HDAC inhibitors in B cell malignancies and serve as the bases for clinical studies of HDAC inhibitors in CLL.

The Eph (erythroprotein-producing hepatoma amplified sequence) family receptor tyrosine kinases and their ephrin ligands (ephrins) are involved in a variety of functions in normal cell development and cancer. We have identified several members of this family as potential targets of aberrant DNA methylation using Methylated CpG Island Amplification (MCA) / DNA promoter microarray technology. This is of importance as there are no prior reports of potential Eph receptor or Ephrin epigenetic inactivation in human leukemia. To further investigate the role of Eph receptor and ephrin family genes in leukemia, we have analyzed their DNA methylation status in a panel of 23 leukemia cell lines and 65 primary ALL patient samples. Aberrant DNA methylation of 9 of these genes (EPHA4, EPHA5, EPHA6, EPHB2, EPHB3, EPHB4, EphrinA5, Ephrin B2, and EphrinB3) was detected in multiple leukemia cell lines but not in normal samples by bisulfite pyrosequencing. In ALL patient samples, the frequencies of DNA methylation detected in the promoter regions of these genes ranged from 23% to 87% for EPHA4, EPHA5, EPHA6, EPHB2, EPHB3, EPHB4, EphrinA5, Ephrin B2, and EphrinB3. Expression analysis of 3 of these genes (EPHA5, EPHB4 and Ephrin B2) in leukemia cell lines by real-time PCR further confirmed methylation associated gene silencing. Treatment of methylated/silenced cell lines with DNA methyltransferase inhibitor 5′-aza-2′-deoxycytidine resulted in gene re-expression. Forced overexpression of EPHB4 using a lentivirus transduction system in Raji cell lines resulted in decreased cell proliferation and adhesion-independent cell growth, as well as in an increase in staurosporine induction of apoptosis. In addition, EPHB4 overexpression resulted in a significant downregulation of phosphorylated Akt pathway but had no effect on mitogen-activated protein kinase pathway. In summary, we describe for the first time the epigenetic suppression of Ephrin receptors and their ligands in human leukemia, indicating that these genes may be potential tumor suppressors in leukemia. Targeting of these pathways may result in the development of new potential therapies and biomarkers for patients with ALL.

Aberrant DNA methylation is a common molecular feature of both pediatric and adult ALL. Specific methylation patterns predict for poor prognosis (Shen et al Blood 2004), and reactivation of epigenetically inactivated molecular pathways results in induction of leukemia cell death (Kuang et al. Oncogene 2007). Until now most studies of methylation in ALL have been based on arbitrary gene selection methods. To overcome this limitation and to study hundreds of promoter CpG islands simultaneously, we have developed a method that combines MCA (Methylated CpG Island Amplification) with either RDA (Representational Difference Analysis) or the Agilent Promoter Microarray platform. With these methods differentially methylated DNA treated with bisulfite is generated after mixing tester DNA (in our case DNA from de novo refractory Ph negative and MLL negative ALL patients) with driver DNA (normal B cell controls) and using specific restriction enzymes and several rounds of PCR. DNA fragments thus generated are either cloned (RDA) or labeled and spotted on the Agilent Array. Using this technology, that can potentially interrogate up to 17K promoters, we have identified 932 promoters targets of aberrant DNA methylation in poor risk ALL from patients that cannot be currently identified by standard molecular methods (Ph and MLL negative). The genes associated with these promoters are distributed through the human genome but an overrepresentation of methylated promoters located in chromosomes 3, 9, 11 and 19 was detected. Using molecular pathway clustering analysis, 404 of these genes are grouped together in 29 specific functional pathways. We have validated the methylation of 31 of these 923 genes by bisulfite pyrosequencing. Of these, 27 (87%) were confirmed to be hypermethylated in 23 human leukemia cell lines but not in normal controls (N=15). Methylation status analysis of these 27 genes allowed for the segregation of T cell versus B cell leukemia cell lines. Fifteen of these genes (GIPC2, RSPO1, MAGI1, CAST1, ADCY5, HSPA4L, OCLN, EFNA5, MSX2, GFPT2, GNA14, SALL1, MYO5B, ZNF382 and MN1) were also frequently hypermethylated in primary ALL samples. Expression analysis of 6 of these genes (GIPC2, MAGI1, ADCY5, HSPA4L, OCLN and GNA14) in leukemia cell lines further confirmed methylation associated gene silencing. Treatment of methylated/silenced cell lines with 5′-aza-2′-deoxycytidine and trichostatin A resulted in gene re-expression, further confirming the role of DNA methylation in their silencing. In summary, we have identified in excess of 900 targets of aberrant DNA methylation in ALL. The study of the epigenetically suppressed pathways represented by these genes should allow us to further understand the molecular pathogenesis of ALL and develop new prognostic biomarkers for patients with Ph and MLL negative disease.

Aberrant DNA methylation of multiple promoter associated CpG islands is a very prevalent phenomenon in human leukemias. Data from our laboratory indicates that methylation profiling allows the identification of leukemia patients with different risk and prognosis. Despite the advances in the understanding of the molecular biology of CLL, few studies of DNA methylation have been performed in CLL. In the current study, we have developed a new assay combining MCA (Methylated CpG island Amplification) with the Agilent promoter CpG array to identify simultaneously hundreds of abnormally methylated CpG islands in CLL. To perform this, we compared DNA from two CLL patients with 17p del (tester) with that of CD19+ B cells from two age-matched controls (driver). We identified 280 promoter CpG islands differentially methylated in CLL compared to normal controls. Most of these genes are located on chromosomes 19 (16%), 16 (11%), 17 (10%) and 11 (9%). We also performed interaction pathway and functional analysis of these 280 genes using the online Ingenuity Pathway Analysis tools. The initial analysis divided these genes into 25 functional networks, with the majority of genes fall into top 10 networks. The major functions of genes in these interaction networks involve cancer, organ development, cell death, drug metabolism, DNA replication and repair. We validated 22 of these genes (ADCY5, R-spondin1, LHX1, GALGT2, TFAP2C, ING1, SOX11, SOX14, SALL1, LTBP2, APP, DXL1, DLX4, KLK10, BCL11B, NR2F2, FAM62T, HAND2, BNC1, SPOCK, Prima1 and MLL1) in samples from 78 CLL patients and 10 age-matched normal controls. The characteristics of the 78 patients are: median age 59 (range 39–79), male 70%, Rai stage 0–II/III–IV (83%/17%), IgVH unmutated 49%, ZAP-70 positive 33%. Our results indicate that most of the genes identified by the array are frequently hypermethylated in CLL patients compared with healthy controls. Methylation frequency ranged from 20%–100% in CLL patients. Expression analysis of four selected genes (LHX1, GALGT2, TFAP2C and Prima1) in human leukemia cell lines and CLL patient samples by real-time PCR further confirmed methylation associated gene silencing, and treatment of these cell lines with hypomethylating agent 5-aza-2′-deoxycitidine with or without the HDAC inhibitor Trichostatin A resulted in gene re-expression and induction of DNA hypomethylation. We also analyzed the association of methylation status of these genes with IgVH mutation status, ZAP70 expression and patient survival. Unmutated IgVH was associated with increased methylation levels of LINE (p20%) was associated with increased methylation levels of LINE (p

p57KIP2 is a cyclin-dependent kinase inhibitor with a role in the regulation of cell cycle progression, proliferation, differentiation, and development. Disruption any of these biological processes could result in malignant transformation. We have previously reported that epigenetic inactivation of p57KIP2 by aberrant DNA methylation is associated with a worse prognosis in patients with adult acute lymphocytic leukemia (Blood2003;101:4131–6 and JCO2005;23:3932–9). To further study the role of p57KIP2 in human leukemia we have developed several knock-in and knock-down cellular models of p57KIP2 in human leukemia cell lines. First, we established the methylation/expression patterns of p57KIP2 in 21 leukemia cell lines of both myeloid and lymphoid origin and of different phenotypes. We found that p57KIP2 was methylated and silenced in all except 6 (28%) cell lines. Methylation of the p57KIP2 promoter region correlated with gene silencing, and lack of protein expression, and treatment of methylated/silenced cell lines with a 5-aza-2′-deoxycytidine (DAC), a demethylating agent, resulted in p57KIP2 gene and protein re-expression. In unmethylated p57KIP2 cell lines, p57KIP2 mRNA was rapidly up-regulated by stimulation by growth-inhibitory signals such as TNF alpha, LPS and TGF beta, and when cell-cycle progression was arrested. In contrast, treatment with dexamethasone, DAC or the histone deacetylase inhibitor SAHA did not have such an effect. The reverse was observed in methylated cell lines. Transient transfection of p57KIP2 in silenced cell lines resulted in cell-cycle arrest at the G0/G1 phase. Stable transfection of p57KIP2 using a lentivirus system in Raji cells, in which p57kip2 is methylated and silenced, resulted in the induction of apoptosis and the suppression of cell growth in soft agar. Stable transfection of p57KIP2 in Jurkat cells, in which p57KIP2 is unmethylated and expressed, resulted in partial inhibition of cell growth, and increased susceptibility to the induction of apoptosis by staurosporine. Knock-down of p57KIP2 using an shRNA lentivirus in K562 cells, in which p57kip2 is not methylated and is expressed, promoted cell growth and proliferation in soft agar. These studies provide evidence that p57KIP2 has the properties of a bona fide tumor suppressor gene in human leukemia and provide further weight to the notion that p57KIP2 has an important role in human leukomogenesis.