Search

ATP-binding cassette member B5 (ABCB5) identifies cancer-initiating cells (CICs) in multiple malignancies, including malignant melanoma, colorectal cancer, glioblastoma, and hepatocellular carcinoma (HCC). In human melanoma, ABCB5-positive CIC subpopulations have been shown to preferentially express the immune checkpoint molecules PD-1 and PD-L1, and tumor-intrinsic PD-1 receptor functions have been found to promote tumor growth, even in mice lacking adaptive immunity. In HCC, where ABCB5 mediates CIC chemoresistance, PD-1 expression has also recently been identified. However, whether ABCB5 regulates tumor-intrinsic PD-1 expression in HCC or other malignancies is currently unknown. Here, we employed RNA interference in Hep G2 HCC cells with high endogenous ABCB5 expression to study the potential role of ABCB5 in regulating PD-1 expression, utilizing the ABCB5 shRNA target sequence GCTGGAAAGATAGCAACTGAA for ABCB5 knockdown (KD) as described previously. Endogenous ABCB5 levels in ABCB5-KD cells were successfully reduced by 92.8% compared to controls. Investigation of the effects of ABCB5-KD on tumor-intrinsic immune checkpoint molecule expression and on expression of the HCC-CIC marker GRN revealed that ABCB5-KD significantly reduced PD-1 expression by 98.0%, and PD-L1 expression by 62.8% compared to controls. Expression of GRN was also significantly reduced in ABCB5-KD cells by 78.8% compared to controls, suggesting ABCB5 KD-dependent loss of CIC phenotype. Injection of ABCB5-KD cells in NSG mice showed 32.3% reduction in tumor size at endpoint (6 weeks) compared to controls (728.7 ± 199.3mm3 vs 1076.0 ± 450.9 mm3, mean ± SD; p Citation Format: Chun Philip Yeung, Brian J. Wilson, Yuzuru Sasamoto, Ana Maria Waaga-Gasser, Svetlana Karpova, Qin Guo, Natasha Y. Frank, Markus H. Frank. ABCB5 knockdown suppresses tumor-intrinsic expression of immune checkpoint regulators PD-1 and PD-L1 in hepatocellular carcinoma (HCC) [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 5862.

Background aim Mesenchymal stromal cells (MSCs) hold promise for the treatment of tissue damage and injury. However, MSCs comprise multiple subpopulations with diverse properties, which could explain inconsistent therapeutic outcomes seen among therapeutic attempts. Recently, the adenosine triphosphate-binding cassette transporter ABCB5 has been shown to identify a novel dermal immunomodulatory MSC subpopulation. Methods The authors have established a validated Good Manufacturing Practice (GMP)-compliant expansion and manufacturing process by which ABCB5+ MSCs can be isolated from skin tissue and processed to generate a highly functional homogeneous cell population manufactured as an advanced therapy medicinal product (ATMP). This product has been approved by the German competent regulatory authority to be tested in a clinical trial to treat therapy-resistant chronic venous ulcers. Results As of now, 12 wounds in nine patients have been treated with 5 × 105 autologous ABCB5+ MSCs per cm2 wound area, eliciting a median wound size reduction of 63% (range, 32–100%) at 12 weeks and early relief of pain. Conclusions The authors describe here their GMP- and European Pharmacopoeia-compliant production and quality control process, report on a pre-clinical dose selection study and present the first in-human results. Together, these data substantiate the idea that ABCB5+ MSCs manufactured as ATMPs could deliver a clinically relevant wound closure strategy for patients with chronic therapy-resistant wounds.

Clear cell renal cell carcinoma (ccRCC) is the most lethal form of kidney cancer and effective treatment regimens are yet to be established. Tyrosine kinase inhibitors (TKI) have widely been used as ccRCC therapeutics, but their efficacy is limited due to accompanying resistance mechanisms. Previous studies have provided substantial evidence for crosstalk between cAMP and the MAPK/ERK signaling pathway. Low levels of intracellular cAMP have been found in several human malignancies and some data suggest that elevation of cAMP expression can be achieved by phosphodiesterase 4 (PDE4) inhibition, resulting in cell growth arrest and/or cell death. The effects of crosstalk between cAMP and the MAPK/ERK pathway on the development progression in ccRCR, however, remain to be fully understood. In this study, we sought to explore the involvement of PDE4 in ccRCC and to assess its potential as a target for therapeutic intervention. We demonstrated that PDE4D is the predominant subtype of PDE4 expressed in healthy and cancerous renal cell lines, particularly in metastatic Caki-1 cells. We generated a CRISPR/Cas9-mediated PDE4D-KO Caki-1 cell model and showed that PDE4D depletion reduced cell proliferation and recovered cAMP expression in these cells. PDE4D-KO and/or PDE4 inhibition with the FDA approved PDE4 inhibitor, roflumilast, also attenuated MAPK/ERK signaling in a CRAF-dependent manner. Most interestingly, we showed that PDE4D-KO enhanced the effectiveness of the TKI, sorafenib, to stunt cell survival. In conclusion, we provide preliminary evidence of PDE4 involvement in ccRCC and suggest a rationale for dual tyrosine kinase/PDE4D targeting in patients with CRAF-dependent MAPK activation.

SUMMARYSignal transducer and activator of transcription 3 (STAT3) is a key transcription factor implicated in the pathogenesis of kidney fibrosis. Although tubular Stat3 deletion in tubular epithelial cells is known to protect mice from kidney fibrosis, the exact function of STAT3 in stromal cells remains unknown. We utilized stromal-cell Stat3 knock-out (KO) mice, CRISPR and pharmacologic activators and inhibitors of STAT3 to investigate its function in pericyte-like cells. STAT3 is phosphorylated in tubular epithelial cells in acute kidney injury whereas its activation expanded to interstitial cells in chronic kidney disease in mice and humans. Stromal cell-specific deletion of Stat3 protects mice from folic acid- and aristolochic acid-induced kidney fibrosis. Mechanistically, STAT3 directly regulates the inflammatory pathway, differentiation of pericytes into myofibroblasts. Specifically, STAT3 activation leads to an increase in migration and profibrotic signaling in genome-edited pericyte-like cells, 10T1/2. Conversely, Stat3 KO or blocking STAT3 function inhibits detachment, spreading, migration, and profibrotic signaling. Furthermore, STAT3 binds to Collagen1a1 promoter of fibrotic mouse kidneys and in pericyte-like cells. Together, our study identifies a previously unknown function of STAT3 in stromal cells that promotes kidney fibrosis and may have therapeutic value in fibrotic kidney disease.Graphical Abstract

ABC member B5 (ABCB5) mediates multidrug resistance (MDR) in diverse malignancies and confers clinically relevant 5-fluorouracil resistance to CD133-expressing cancer stem cells in human colorectal cancer (CRC). Because of its recently identified roles in normal stem cell maintenance, we hypothesized that ABCB5 might also serve MDR-independent functions in CRC. Here, in a prospective clinical study of 142 CRC patients, we found that ABCB5 mRNA transcripts previously reported not to be significantly expressed in healthy peripheral blood mononuclear cells are significantly enriched in patient peripheral blood specimens compared with non-CRC controls and correlate with CRC disease progression. In human-to-mouse CRC tumor xenotransplantation models that exhibited circulating tumor mRNA, we observed that cancer-specific ABCB5 knockdown significantly reduced detection of these transcripts, suggesting that the knockdown inhibited tumor invasiveness. Mechanistically, this effect was associated with inhibition of expression and downstream signaling of AXL receptor tyrosine kinase (AXL), a proinvasive molecule herein shown to be produced by ABCB5-positive CRC cells. Importantly, rescue of AXL expression in ABCB5-knockdown CRC tumor cells restored tumor-specific transcript detection in the peripheral blood of xenograft recipients, indicating that ABCB5 regulates CRC invasiveness, at least in part, by enhancing AXL signaling. Our results implicate ABCB5 as a critical determinant of CRC invasiveness and suggest that ABCB5 blockade might represent a strategy in CRC therapy, even independently of ABCB5's function as an MDR mediator.

Clear cell renal cell carcinoma (ccRCC) is the most lethal form of kidney cancer. Small molecule Vascular Endothelial Growth Factor Receptor (VEGFR) inhibitors are widely used but are not curative and various resistant mechanisms have been described. Previous studies have indicated a crosstalk between the cAMP pathway and the MAPK pathway, and the elevation of cAMP levels by Phosphodiesterase 4 (PDE4) inhibition can result in growth arrest and/or cell death. In this study we focused on the effects of PDE4 in ccRCC. We showed for the first time that PDE4D is the dominant subtype of PDE4 in kidney. PDE4D depletion in ccRCC, Caki-1 cells, using CRISPR Knock Out (KO) enhanced sensitivity of Tyrosine Kinase Inhibitor (TKI), sorafenib and increased cytotoxicity. We also showed synergistic effects of PDE4 inhibitor, roflumilast and sorafenib, in increasing cytotoxicity of ccRCC in the absence of PDE4D. Our results further demonstrated that PDE4D deficiency increased intracellular cAMP levels and resulted in downregulation of MAPK but not PI3K/AKT signaling in a CRAF dependent manners. In conclusion, we provide a preclinical rationale for dual PDE4/VEGFR inhibition in patients with ccRCC. While the MAPK signaling pathway is activated in ccRCC, dual inhibitions may improve the anti-tumor effects in patients with proven CRAF signaling activation. Citation Format: Minghua Cao, Amrandra K. Ajay, Martin Gasser, Li-LI Hsiao, Ana Maria Waaga-Gasser. Phosphodiesterase 4D depletion enhances anti-tumor effects of tyrosine kinase inhibitor in renal cell carcinoma involving CRAF-ERK pathway [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2021; 2021 Apr 10-15 and May 17-21. Philadelphia (PA): AACR; Cancer Res 2021;81(13_Suppl):Abstract nr 967.

CD137-targeting immune therapy, which activates anti-tumor T effector cell responses, seems to be an attractive concept in clinical oncology. Recent evidence has demonstrated that tumor cells besides T cells and antigen-presenting cells are able to express CD137 and CD137L. Here we aimed to identify CD137/CD137L expression in established colon cancer cell lines and primary tumors (UICC stages I-IV) from patients with documented long-term follow-up. CD137/CD137L expression was highly upregulated in early to late-stage tumors while the inverse was observed in patient-derived peripheral blood mononuclear cells. High CD137L expression within primary tumors was mediated by tumor cells and significantly correlated with the occurrence of distant metastases and shortened survival in advanced stages of disease (UICC stage IV). Interestingly, induced tumor cell signaling via CD137L on its surface in vitro resulted in dual effects: (i) reduced tumor cell proliferation suggesting inhibitory signaling in all investigated cancers and (ii) increased epithelial-to-mesenchymal transition signaling events. Taken together CD137/CD137L expression was stage-dependently upregulated with shortened survival in patients with highly CD137L-expressing tumors. Our clinical and experimental data suggest that colon cancer cells predominantly express CD137L and thereby have negative impact on overall survival through a process of reverse signaling. Beside agonistic CD137 antibody therapy to foster T effector cell responses, CD137L-mediated intervention strategies may become instrumental to circumvent relapsed tumor growth through induced epithelial-to-mesenchymal transition and consecutive metastases formation.

Background Cardiovascular fibrosis is a major contributor to cardiovascular disease, the primary cause of death in patients with chronic kidney disease (CKD). We previously reported expression of endogenous Klotho in human arteries, and that CKD is a state of Klotho deficiency, resulting in vascular calcification, but myocardial expression of Klotho is poorly understood. This study aimed to further clarify endogenous Klotho's functional roles in cardiac fibrosis in patients with underlying CKD. Methods and results Human atrial appendage specimens were collected during cardiac surgery from individuals with or without CKD. Cardiac fibrosis was quantified using trichrome staining. For endogenous Klotho functional studies, primary human cardiomyocytes (HCMs) were treated with uremic serum from CKD patients or recombinant human TGF-β1. The effects of endogenous Klotho in HCMs were studied using Klotho-siRNA and Klotho-plasmid transfection. Both gene and protein expression of endogenous Klotho are found in human heart, but decreased Klotho expression is clearly associated with the degree of cardiac fibrosis in CKD patients. Moreover, we show that endogenous Klotho is expressed by HCMs and cardiac fibroblasts (HCFs) but that HCM expression is suppressed by uremic serum or TGF-β1. Klotho knockdown or overexpression aggravates or mitigates TGF-β1-induced fibrosis and canonical Wnt signaling in HCMs, respectively. Furthermore, co-culture of HCMs with HCFs increases TGF-β1-induced fibrogenic proteins in HCFs, but overexpression of endogenous Klotho in HCMs mitigates this effect, suggesting functional crosstalk between HCMs and HCFs. Conclusions Our data from analysis of human hearts as well as functional in vitro studies strongly suggests that the loss of cardiac endogenous Klotho in CKD patients, specifically in cardiomyocytes, facilitates intensified TGF-β1 signaling which enables more vigorous cardiac fibrosis through upregulated Wnt signaling. Upregulation of endogenous Klotho inhibits pathogenic Wnt/β-catenin signaling and may offer a novel strategy for prevention and treatment of cardiac fibrosis in CKD patients.

Introduction: The purpose of this study was to determine the efficacy of an immunoglobulin concentrate on dysregulated inflammatory responses in patients with colorectal cancer (CRC). Recent findings have shown that CRC is associated with dysbiosis of the gut microbiome and frequently a compromised gut barrier, resulting in prolonged and smoldering endotoxin leakage into the circulation. Subclinical local and systemic microinflammation is suggested to facilitate metastasis formation. Previous studies have pointed to the capacity of polyvalent immunoglobulins to neutralize endotoxins and pathogens on gut epithelial surfaces to abrogate inflammatory responses and thereby tumor recurrence. The effects of KMP01D, a colostrum preparation with a multitude of immunoglobulins against gram-negative/positive bacteria and viruses, on pro-/anti-inflammatory cytokine responses and apoptosis were determined ex vivo. Methods: Peripheral blood and tumor-derived mononuclear cells (MNC) from CRC patients at UICC stages I–IV (n=48) operated at our Center for Operative Medicine/Comprehensive Cancer Center and treated under current guidelines for (neo-)adjuvant therapy were further investigated. Expression of CD14, CD68, Toll-like receptor(TLR) 4, and insulin-like growth factor (IGF)-1 with/without co-incubation of KMP01D as well as immune cell apoptosis was analyzed by flow cytometry, RT PCR, immunohistochemistry, and Elisa in each patient. Results: KMP01D increased interleukin (IL)-10 and IL-13 anti-inflammatory cytokine expression in peripheral blood MNCs (UICC I-III). More interestingly, it likewise decreased secretion of IL-1β, IL-6, IFN-γ, TNF-α, and IL-12 driven inflammation as well as IGF-1. Moreover, CD14/CD68 and TLR4 expression critically involved in endotoxin signaling was downregulated in PBMCs and tumor-infiltrating MNCs. CD14+Fas+/TUNEL+ PBMCs and tumor-derived MNCs indicating apoptosis were likewise enhanced under KMP01D co-incubation. Addition of vitamin D3 known as a regulatory factor in immune responses demonstrated additive anti-inflammatory effects in vitro. Conclusions: Inflammatory immune responses are significantly and stage-dependently upregulated which negatively impacts anti-tumor-specific immune reactivity, immune cell apoptosis and prognosis in CRC patients despite modern adjuvant treatment protocols. KMP01D produced from natural bovine sources and composed of a multitude of immunoglobulin activity (IgG1/2 and Lactoferrin) demonstrates highly ex vivo efficacy on downregulation of inflammatory cytokine responses in PBMCs and normalized immune cell apoptosis in CRC patients. Together with previous clinical data our results strongly suggest that KMP01-mediated endotoxin and pathogen neutralization and thereby mitigated chronic inflammation can be a highly valuable add-on instrument in the treatment of CRC patients to downregulate stage-dependently their local and systemic inflammation and risk for metastasis formation. Citation Format: Martin Gasser, Reinhard Lissner, Li-Li Hsiao, Ana Maria Waaga-Gasser. Results from a preclinical study to evaluate the efficacy of polyvalent immunoglobulins on the imbalance of (anti-)inflammatory immune cell responses in clinical colorectal cancer [abstract]. In: Abstracts: AACR Virtual Special Conference: Tumor Immunology and Immunotherapy; 2020 Oct 19-20. Philadelphia (PA): AACR; Cancer Immunol Res 2021;9(2 Suppl):Abstract nr PO001.

// Romana Moench 1 , Tanja Grimmig 1 , Vinicius Kannen 2 , Sudipta Tripathi 3 , Marc Faber 1 , Eva-Maria Moll 1, † , Anil Chandraker 3 , Reinhard Lissner 1 , Christoph-Thomas Germer 4 , Ana Maria Waaga-Gasser 1, 3, * , Martin Gasser 4, * 1 Department of Surgery I, Molecular Oncology and Immunology, University of Wuerzburg, Wuerzburg, Germany 2 Ribeirao Preto Pharmaceutical Sciences School, Department of Toxicology, Bromatology, and Clinical Analysis, University of Sao Paulo, Sao Paulo, Brazil 3 Brigham and Women’s Hospital, Transplant Research Center, Harvard Medical School, Boston, MA, USA 4 Department of Surgery I, University of Wuerzburg, Wuerzburg, Germany † Post mortem * These authors have contributed equally to this work and shared senior authorship Correspondence to: Ana Maria Waaga-Gasser, email: waaga_a@ukw.de Keywords: PDGF, colorectal cancer, PI3K/Akt/mTOR, MAPK pathway, glucose metabolism Received: January 21, 2016 Accepted: August 08, 2016 Published: September 08, 2016 ABSTRACT Platelet-derived growth factor (PDGF) and signaling via its receptors plays a crucial role in tumor cell proliferation and thus may represent an attractive target besides VEGF/EGFR-based antibody therapies. In this study we analyzed the influence of PDGF in colorectal cancer. PDGF was expressed intensively in early and even more intensively in late stage primary CRCs. Like VEGF, PDGF enhanced human colon cancer proliferation, and increased oxidative glycolytic activity, and activated HIF1α and c-Myc in vitro . PDGF activated the PI3K/Akt/mTOR pathway while leaving MAPK signaling untouched. Further dissection showed that inhibition of Akt strongly impeded cancer cell growth while inhibition of PI3K did not. MAPK analysis suggested an inhibitory crosstalk between both pathways, thus explaining the different effects of the Akt and PI3K inhibitors on cancer cell proliferation. PDGF stimulates colon cancer cell proliferation, and prevents inhibitor induced apoptosis, resulting in tumor growth. Therefore inhibition of PDGF signaling seems to be a promising target in colorectal cancer therapy. However, due to the multifaceted nature of the intracellular PDGF signaling, careful intervention strategies are needed when looking into specific signaling pathways like PI3K/Akt/mTOR and MAPK.

Tumor models based on cancer cell lines cultured two-dimensionally (2D) on plastic lack histological complexity and functionality compared to the native microenvironment. Xenogenic mouse tumor models display higher complexity but often do not predict human drug responses accurately due to species-specific differences. We present here a three-dimensional (3D) in vitro colon cancer model based on a biological scaffold derived from decellularized porcine jejunum (small intestine submucosa+mucosa, SISmuc). Two different cell lines were used in monoculture or in coculture with primary fibroblasts. After 14 days of culture, we demonstrated a close contact of human Caco2 colon cancer cells with the preserved basement membrane on an ultrastructural level as well as morphological characteristics of a well-differentiated epithelium. To generate a tissue-engineered tumor model, we chose human SW480 colon cancer cells, a reportedly malignant cell line. Malignant characteristics were confirmed in 2D cell culture: SW480 cells showed higher vimentin and lower E-cadherin expression than Caco2 cells. In contrast to Caco2, SW480 cells displayed cancerous characteristics such as delocalized E-cadherin and nuclear location of beta-catenin in a subset of cells. One central drawback of 2D cultures-especially in consideration of drug testing-is their artificially high proliferation. In our 3D tissue-engineered tumor model, both cell lines showed decreased numbers of proliferating cells, thus correlating more precisely with observations of primary colon cancer in all stages (UICC I-IV). Moreover, vimentin decreased in SW480 colon cancer cells, indicating a mesenchymal to epithelial transition process, attributed to metastasis formation. Only SW480 cells cocultured with fibroblasts induced the formation of tumor-like aggregates surrounded by fibroblasts, whereas in Caco2 cocultures, a separate Caco2 cell layer was formed separated from the fibroblast compartment beneath. To foster tissue generation, a bioreactor was constructed for dynamic culture approaches. This induced a close tissue-like association of cultured tumor cells with fibroblasts reflecting tumor biopsies. Therapy with 5-fluorouracil (5-FU) was effective only in 3D coculture. In conclusion, our 3D tumor model reflects human tissue-related tumor characteristics, including lower tumor cell proliferation. It is now available for drug testing in metastatic context-especially for substances targeting tumor-stroma interactions.

Anti-Epithelial/Vascular Endothelial Growth Factor (EGF/VEGF)-targeted therapy plays important roles in advanced stage colorectal cancer (CRC) patients but fails to show clinical efficacy in specific subgroups which lack of clear underlying mechanisms. In vitro studies indicated that cross-talk or alternative receptor/ligand activities can bypass anti-growth factor signaling arrest and therefore may explain failure of monoclonal antibody (mAb) targeted therapy. In this study we analyzed effects of Platelet Derived Growth Factor (PDGF)-mediated bypassed signaling in CRC. We first investigated human UICC (Union for International Cancer Control ) stage I-IV tumors (n=46) from our Center and found increased PDGFRβ and VEGFR1/2 gene expression (p Citation Format: Romana Moench, Martin Gasser, Karol Nawalaniec, Tanja Grimmig, Minghua Cao, Yueming Luo, Li-Li Hsiao, Ana Maria Waaga-Gasser. PDGF-induced tumor cell growth despite VEGF/EGF inhibition and absence of PDGF receptor expression in colon cancer [abstract]. In: Proceedings of the Annual Meeting of the American Association for Cancer Research 2020; 2020 Apr 27-28 and Jun 22-24. Philadelphia (PA): AACR; Cancer Res 2020;80(16 Suppl):Abstract nr 3755.

Colon cancer is one of the most common tumors in the human population. Recent studies have shown a reduced risk for colon cancer in patients given the antidepressant fluoxetine (FLX). The exact mechanism by which FLX might protect from colon cancer remains however controversial. Here, FLX reduced the development of different colon tumor xenografts, as well as proliferation in hypoxic tumor areas within them. FLX treatment also decreased microvessel numbers in tumors. Although FLX did not increase serum and tumor glucose levels as much as the colon chemotherapy gold standard Fluorouracil did, lactate levels were significantly augmented within tumors by FLX treatment. The gene expression of the MCT4 lactate transporter was significantly downregulated. Total protein amounts from the third and fifth mitochondrial complexes were significantly decreased by FLX in tumors. Cell culture experiments revealed that FLX reduced the mitochondrial membrane potential significantly and disabled the reactive oxygen species production of the third mitochondrial complex. Furthermore, FLX arrested hypoxic colon tumor cells in the G0/G1 phase of the cell-cycle. The expression of key cell-cycle-related checkpoint proteins was enhanced in cell culture and in vivo experiments. Therefore, we suggest FLX impairs energy generation, cell cycle progression and proliferation in tumor cells, especially under condition of hypoxia. This then leads to reduced microvessel formation and tumor shrinkage in xenograft models.

The plasma protein osteopontin (OPN) is considered to be a tumor biomarker, where elevated plasma levels are associated with poor prognosis. Additionally, OPN is expressed in the presence of tumor hypoxia, which is an adverse prognostic factor in radiation oncology. One of its receptors, the proposed tumor stem cell marker CD44, is also associated with aggressive tumors, shown for example in colon cancer. The expression of CD44 and its splice variants (particularly CD44v6) can be upregulated by OPN itself. In the present study, we aimed to investigate the influence of hypoxia on the expression of OPN and its binding partners CD44 and CD44v6 in colon carcinoma cell lines in vitro, using SW480, SW620, HT29 and HCT116 cells. Additionally, we investigated the effect of irradiation on the expression pattern of OPN and its ligands, and the influence of hypoxia on the clonogenic survival of the cells after irradiation. While the expression patterns were nearly unaltered by irradiation, hypoxia led to an upregulation of OPN protein expression and an increase in the radioresistance in all tested colorectal carcinoma cell lines. However, a similar clear statement with regard to the expression of CD44 and CD44v6 is not possible. We hypothesize that the OPN receptors differ in their expression pattern between cell lines depending on the degree of their malignancy.

Purpose: The programmed death-1/programmed death ligand (PD-1/PD-L) pathway in T cell activation has been shown to play an important role in tumor evasion from host immunity. The predictive value of PD-L1 and PDL2 expression in colorectal cancer (CRC) remains still under discussion. We analyzed whether negative signaling of infiltrating PD-1-positive T cells through PD-L1 and PD-L2 within the tumor could promote further tumor progression through downregulation of anti-tumor immunity. Methods: We investigated PD-L1 and PD-L2 expression in tumors from patients with CRC and analyzed its prognostic significance with respect to outcome analysis. Results: T cell infiltration was observed in 90.5% of the tumors, with 58% of the patients demonstrating PD-1- positive T cells in their tumors. Patients who developed PD-1-positive T cell infiltration showed increased PD-L1- expression within their tumors than PD-1-T cell negative individuals. Presence of tumor infiltrating PD-1-positive T cells was more pronounced in advanced stage cancers than in early cancers. Ligand expression (PD-L1/PD-L2) in the tumors combined with dense PD-1-positive T cell infiltration was associated with poor prognosis. Multivariate analysis demonstrated that PD-L expression in the tumors was an independent prognostic factor in CRC. Conclusion: The presented results from primary tumors and CRC patient outcome analysis suggest that negative signaling of infiltrating PD-1-positive T cells through PD-L1 expression within the tumor may promote further tumor progression through downregulation of anti-tumor immunity. Co-expression of PD-1 on CD4/Foxp3- positive T cells was found indicating T regulatory cell-mediated mechanisms by which tumor cells can evade immune recognition and destruction. This study demonstrates the importance of strategies inhibiting negative PD-1/ PD-L1 signaling in CRC.

Purpose: Disseminated tumor cells (DTCs) are critically involved in tumor relapse and survival in several invasive tumors. We previously showed that the ATP-binding cassette (ABC) transporter, ABCB5, is a chemoresistance mediator expressed on specific cell subsets in colorectal cancer (CRC) and other malignancies. This study evaluated the molecular signature expression and its clinical relevance of DTCs in bone marrow from patients with colon cancer. Methods: This study included 49 consecutive patients (UICC stage I-IV) that underwent curatively intended or palliative surgery for CRC. We analyzed cells from bone marrow aspirates obtained before surgery and derived from patients that had completed minimally a 5-year follow-up. The gene expression of ABCB5 in comparison to CD133 (molecule for identifying cancer initiating cells), Lgr5 (an intestinal stem cell marker) as well as Cytokeratin (CK) 20 (terminally differentiated tumor cells of epithelial origin) in these cells was evaluated. Results: Bone marrow analysis showed differential expression between the analyzed genes. ABCB5 and Lgr5 and to lesser extent CD133 and CK20 genes were significantly expressed in the analyzed cells from bone marrow aspirates while only ABCB5 and Lgr5 were significantly negative associated with tumor progress and overall survival. Conclusion: Overexpression of ABCB5 and Lgr5 in bone marrow negatively influenced patient survival pointing to a specific chemo resistant and pluripotent cell subgroup of DTCs in the bone marrow. ABCB5 like Lgr5 positive cells seem to be involved in limited tumor related patient survival, suggesting that ABCB5- and Lgr5-positive cells may be relevant for specific clinical intervention strategies.

The role of glucagon-like peptide 2 (GLP2) in colon tissue has been studied extensively, from the time it was discovered that GLP2 promotes intestinal growth. A large number of studies have shown potential applications for GLP2 in human therapy. However, recent data have suggested the notion that GLP2 plays a key role in colon carcinogenesis. Questions have been arisen regarding the pro-proliferative effects of GLP2 and whether they might promote intestinal healing or advance colon tumor growth. Here, we provide striking evidence to show that the physiological activities of GLP2 are closely related to cancer-related molecular pathways that have been shown to circumvent drug desensitization. We further explore the different pathways of GLP2-signaling to suggest suitable GLP2-based therapeutic strategies in colon cancer.

Calcineurin inhibitors (CNIs) may promote post-transplantation cancer through altered expression of cytokines and chemokines in tumor cells. We found that there is a potential cross-talk among CNI-induced signaling molecules and mTOR. Here, we utilized a murine model of post-transplantation cancer to examine the effect of a combination therapy (CNI + mTOR-inhibitor rapamycin) on allograft survival and renal cancer progression. The therapy prolonged allograft survival; and significantly attenuated CNI-induced post-transplantation cancer progression, with down-regulation of mTOR and S6-kinase phosphorylation. Also, rapamycin inhibited CNI-induced over-expression of the angiogenic cytokine VEGF, and the chemokine receptor CXCR3 and its ligands in post-transplantation tumor tissues.

Background Chemokines play a critical role in tumor initiation, progression, and metastasis and have been associated with poor prognosis in diverse malignancies. The prognostic impact of chemokines for renal cell cancer (RCC) remains to be defined. Methods Patients diagnosed with RCC and operated between 07/07 and 05/11 were differentially assessed for expression profiles of a series of chemokines and their receptors by RT-qPCR and Western Blot analysis (tumor and adjacent normal tissue, n=37) and by Luminex for corresponding serum expression levels. Results were statistically correlated with clinicopathologic parameters. Results Gene expression of CCL2, CCR7, CXCL12, CXCR3, CXCR5 and CX3CL1 chemokines was significantly down-regulated in tumor compared to normal tissue. The gene profile for CCR6 was positively correlated with tumor size and stage. A positive linear correlation was found between CXCL12 and tumor stage as well as between CX3CR1 and C-reactive protein. In contrast to clear cell RCCs those of a chromophobe type showed a significantly down-regulated gene expression for CCR6, CCL20, and CXCL12. The CXCR7 serum level was significantly increased in patients with tumor-related mortality during postoperative follow-up. Conclusions Chemokines may serve as novel diagnostic and prognostic biomarkers for RCC. Studies on larger collectives are required for further assessment of potential clinical application.

Identification and reversal of treatment resistance mechanisms of clinically refractory tumor cells is critical for successful cancer therapy. Here we show that ATP-binding cassette member B5 (ABCB5) identifies therapy-refractory tumor cells in colorectal cancer patients following fluorouracil (5-FU)–based chemoradiation therapy and provide evidence for a functional role of ABCB5 in colorectal cancer 5-FU resistance. Examination of human colon and colorectal cancer specimens revealed ABCB5 to be expressed only on rare cells within healthy intestinal tissue, whereas clinical colorectal cancers exhibited substantially increased levels of ABCB5 expression. Analysis of successive, patient-matched biopsy specimens obtained prior to and following neoadjuvant 5-FU–based chemoradiation therapy in a series of colorectal cancer patients revealed markedly enhanced abundance of ABCB5-positive tumor cells when residual disease was detected. Consistent with this finding, the ABCB5-expressing tumor cell population was also treatment refractory and exhibited resistance to 5-FU–induced apoptosis in a colorectal cancer xenograft model of 5-FU monotherapy. Mechanistically, short hairpin RNA–mediated ABCB5 knockdown significantly inhibited tumorigenic xenograft growth and sensitized colorectal cancer cells to 5-FU–induced cell killing. Our results identify ABCB5 as a novel molecular marker of therapy-refractory tumor cells in colorectal cancer patients and point to a need for consistent eradication of ABCB5-positive resistant tumor cell populations for more effective colorectal cancer therapy. Cancer Res; 71(15); 5307–16. ©2011 AACR.

Circulating tumor cells (CTC) have been identified in several human malignancies, including malignant melanoma. However, whether melanoma CTC are tumorigenic and cause metastatic progression is currently unknown. Here, we isolate for the first time viable tumorigenic melanoma CTC and demonstrate that this cell population is capable of metastasis formation in human-to-mouse xenotransplantation experiments. The presence of CTC among peripheral blood mononuclear cells (PBMC) of murine recipients of subcutaneous (s.c.) human melanoma xenografts could be detected based on mRNA expression for human GAPDH and/or ATP-binding cassette subfamily B member 5 (ABCB5), a marker of malignant melanoma-initiating cells previously shown to be associated with metastatic disease progression in human patients. ABCB5 expression could also be detected in PBMC preparations from human stage IV melanoma patients but not healthy controls. The detection of melanoma CTC in human-to-mouse s.c. tumor xenotransplantation models correlated significantly with pulmonary metastasis formation. Moreover, prospectively isolated CTC from murine recipients of s.c. melanoma xenografts were capable of primary tumor initiation and caused metastasis formation upon xenotransplantation to secondary murine NOD-scid IL2Rγ(null) recipients. Our results provide initial evidence that melanoma CTC are tumorigenic and demonstrate that CTC are capable of causing metastatic tumor progression. These findings suggest a need for CTC eradication to inhibit metastatic progression and provide a rationale for assessment of therapeutic responses of this tumorigenic cell population to promising emerging melanoma treatment modalities.

Toll-like receptor (TLR) stimulation results in activation of NF-κB, a key modulator in driving inflammation to cancer and mitogen-activated protein kinases that have been shown to recruit mitotic and cyclooxygenase-2 (COX-2) induced pathways in carcinogenesis. Here we asked whether different TLR, COX-2 and stem cell marker expression profiles in colorectal cancer (CRC) provide further evidence for this hypothesis from a clinical perspective. We analysed gene and protein expression of TLR7-TLR10, COX-2 and CD133 as a marker for colon-initiating cells in CRC patients (n=65). Gene analysis demonstrated significantly upregulated TLR7-TLR10 and COX-2 expression in CRC tumour tissues. Analysis of isolated tumour cells from primary tumours showed co-expression of TLR7 and TLR8 with CD133 and gave evidence for a subpopulation of colon cancer-initiating cells. In multivariate analyses TLR8 expression was found to be an independent prognostic factor. Persistent TLR-specific activation of NF-κB in CRC and particularly in tumour-initiating cells may thus sustain further tumour growth and progression through perpetuated signalling known from inflammatory and tissue repair mechanisms with consecutive self-renewal in pluripotent tumour cells. Activation through self-ligands or viral RNA fragments may putatively maintain this inflammatory process, suggesting a key role in cancer progression.

Expression of apoptosis-related proteins on tumour cells has been shown in several experimental models to be an efficient mechanism for a counterattack against host anti-tumour immune responses in solid tumours. Here we provide a clinical evidence for such a tumour immune escape mechanism by demonstrating tumour to T cell-directed death receptor signalling (TRAIL/TRAIL-Receptor (TRAIL-R)) in colorectal cancer (CRC). In a series of patients with CRC and completed 5-year follow up, we investigated apoptosis and expression levels of apoptosis-related proteins. Gene and protein profiles in the tumours demonstrated intratumoural upregulated gene expression for Fas, Fas-L, TRAIL, TRAIL-R and TNF-alpha (RT-qPCR). Levels of terminaldeoxynucleotidyl transferase-mediated deoxyuridinetriphosphate nick-end labelling (TUNEL)-positive events were positively correlated with TRAIL-R1-expression on tumour infiltrating immune cells. Among the immune cells, preferentially CD8+ T cells were found to express TRAIL-R1 while serial immunostaining in the same patient tumours showed abundant apoptotic (TUNEL-positive) immune cells. In conclusion, our results in tumour samples from CRC patients suggest TRAIL-R1-mediated apoptotic depletion of infiltrating immune cells (CD8+) in response to TRAIL expression by the tumour itself. This supports the notion of an efficient escape from tumour immune response and thus evasion from the attack of activated CD8+ T cells. These findings may enhance our understanding of tumour progression in CRC and might be helpful for the development of TRAIL and its death receptor-based therapy.

Calcineurin inhibitors (CNI) are used to prevent inflammatory diseases and allograft rejection. However, little is known about the mechanism(s) underlying their ability to promote the development and recurrence of cancer. Recent studies suggested that the chemokine receptor CXCR3 may play important roles in tumorigenesis. CXCR3 has two splice variants with opposite functions: CXCR3-A promotes cell proliferation, and CXCR3-B inhibits cell growth. Here, we explored the effects of CNI on the expression and function of CXCR3 splice variants. Compared with normal renal tissues and renal epithelial cells, human renal cancer tissues and renal cancer cell lines demonstrated higher expression of CXCR3-A and markedly lower expression of CXCR3-B. In human renal cancer cells (786-0 and Caki-1) and renal epithelial cells, CNI markedly downregulated the expression of CXCR3-B, whereas expression of CXCR3-A was unchanged. This CNI-mediated downregulation of CXCR3-B resulted in increased proliferation and migration of renal cancer cells; CNI-mediated cell proliferation involved signaling through G(i) proteins, perhaps via CXCR3-A. Finally, it was observed that CNI treatment increased the growth of human renal tumors in vivo, and the expression of CXCR3-B was significantly decreased in these tumors. In summary, these observations suggest that CNI may mediate the progression of human renal cancer by downregulating CXCR3-B and by promoting proliferative signals, likely through CXCR3-A. Targeting CXCR3 splice variants or the signaling pathways downstream of CXCR3 receptors may provide a therapeutic strategy for the prevention of CNI-mediated renal cancer progression.

The therapeutic arsenal in solid tumors comprises different anticancer strategies with diverse chemotherapeutic agents and a growing number of biological substances. Large clinical study-based chemotherapeutic protocols combined with biologicals have become an important component in (neo-) adjuvant therapy alongside surgery in solid cancers as well as radiation therapy in some instances. In recent years, monoclonal antibodies have entered the mainstream of cancer therapy. Their first use was as antagonists of oncogenic receptor tyrosine kinases, but today monoclonal antibodies have emerged as long-sought vehicles for the targeted delivery of potent chemotherapeutic agents and as powerful tools to manipulate anticancer immune responses. There is a growing number of FDA approved monoclonal antibodies and small molecules targeting specific types of cancer suggestive of the clinical relevance of this approach.Targeted cancer therapies , also referred to as personalized medicine, are being studied for use alone, in combination with other targeted therapies, and in combination with chemotherapy. The use of monoclonal antibodies in colorectal and gastric cancer for example have shown best outcome when combined with chemotherapy, even though single agent anti-EGFR antibodies seem to be active in particular setting of metastatic colorectal cancer patients. However, it is not well defined whether the addition of anti-VEGF - and anti-EGFR strategies to chemotherapy could improve outcome in those patients susceptible to colorectal cancer-related metastases resection. Among the most promising approaches to activating therapeutic antitumor immunity is the blockade of immune checkpoints, exemplified by the recently FDA-approved agent, Ipilimumab, an antibody that blocks the coinhibitory receptor CTLA-4. Capitalizing on the success of Ipilimumab, agents that target a second coinhibitory receptor, PD-1, or its ligand, PD-L1, are in clinical development. This section attempts to discuss recent progress of targeted agents and in tackling a more general target applicable to gastrointestinal cancer .

Background: The Platelet derived growth factor (PDGF) and its receptors play a major role in inducing proliferation, migration, and angiogenesis by activating intracellular PI3K/Akt/mTOR signaling events in different solid tumors and therefore represent attractive targets in tumor therapy. Recently we showed a PDGF-induced activation of metabolism and proliferation in HT29 colon cancer cells in the absence of specific PDGF receptors. The aim of this study was to analyze PDGFR and VEGFR expression and possible alternative PDGF binding partners in colorectal cancer (CRC). Methods: Human HT29 colon cancer cells were cultured and stimulated with PDGF in a time-dependent manner. Additionally, VEGFR2 and EGFR inhibition was performed to analyze alternative PDGF signaling events. Whole cell or RNA extracts were analyzed by Western Blot and RT-q-PCR for receptors and PI3K/Akt/mTOR signaling. To investigate the effects of specific receptor inhibition on proliferation, MTS proliferation assays were performed. Moreover, mRNA levels of PDGFR and VEGFR in tumors from patients with CRC were analyzed by RT-qPCR. Results: Human UICC stage I-IV tumors exhibited a significantly increased PDGFRβ and VEGFR1,2 gene expression. As observed previously, HT29 colon cancer cells showed only positivity for VEGFR1,2, but no PDGFR protein expression. Despite that, stimulation with PDGF resulted in increased proliferation and metabolic changes. In contrast, Caco-2 and SW480 colon cancer cells showed PDGFR and VEGFR expression on protein level. Interestingly, PDGF stimulation increased VEGFR1 and 2 gene expression in HT29 colon cancer cells and secondly inhibition of VEGFR2 and EGFR showed alterations in proliferation and Akt signaling in PDGF stimulated cancer cells. Conclusion: Despite the absence of PDGF receptors in HT29 colon cancer cells, PDGF induced proliferating and metabolic effects in the tumor cells, suggesting an alternative binding partner on the tumor cell surface. Further investigation of the alternative PDGF binding partners could be of clinical relevance in CRC. Note: This abstract was not presented at the meeting. Citation Format: Romana Moench, Tanja Grimmig, Christoph-Thomas Germer, Ana Maria Waaga-Gasser, Martin Gasser. PDGF induces cell growth and changes in glucose metabolism in colon cancer in the absence of PDGF receptors [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2017; 2017 Apr 1-5; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2017;77(13 Suppl):Abstract nr 1237. doi:10.1158/1538-7445.AM2017-1237

Background: CD137L is expressed on antigen presenting cells and CD137/CD137L interaction co-stimulates activation and proliferation of CD137 expressing T cells. CD137L expression has also been detected on various cancer cells. While signaling in immune cells showed both inhibiting and activating effects the impact of CD137L induction on tumor cells is poorly understood. In this study, the expression of CD137 and CD137L and the effects of CD137L activation were analyzed in human colorectal cancer (CRC). Methods: Expression of CD137 and CD137L was examined in human colon cancer cell lines HT29, SW480 and SW620 treated with or without hypoxia using RT-qPCR, Western blot and FACS analysis. Its differentiated expression was further analyzed in human CRCs by immunofluorescent double-staining. To dissect the effects of CD137L activation on cancer cells, MTS proliferation assays were additionally performed. Results: All three human colon cancer cell lines demonstrated high cellular (FACS) and protein (Western Blot) CD137L expression. CD137 was found only in SW480 cells at weak expression. Additionally, both CD137 and CD137L were significantly upregulated in cells treated with hypoxia. In human CRCs both CD137 and CD137L expressing tumor cells were detected by immunofluorescent double-staining. Interestingly, activation of CD137L by immobilized CD137-Fc resulted in reduced cancer cell proliferation compared to IgG1-Fc controls. Conclusion: Our results demonstrate tumor cell mediated expression of the costimulatory molecule CD137 and its ligand CD137L in both colon cancer cell lines and human colorectal cancer. Moreover, CD137L reverse signaling was found to reduce cancer cell proliferation in vitro. Based on these data, the CD137/CD137L signaling pathway seems to present a promising target for cancer therapy in CRC. Note: This abstract was not presented at the meeting. Citation Format: Tanja Grimmig, Simone Callies, Hannes Naegele, Martin Wagner, Romana Moench, Buelent Polat, Christoph-Thomas Germer, Martin Gasser, Ana Maria Waaga-Gasser. Activation of CD137/CD137L results in reduced tumor cell proliferation in human colon cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2017; 2017 Apr 1-5; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2017;77(13 Suppl):Abstract nr 5616. doi:10.1158/1538-7445.AM2017-5616

Purpose: Prostate specific antigen is not reliable in diagnosing prostate cancer (PCa), making the identification of novel, precise diagnostic biomarkers important. Since chemokines are associated with more aggressive disease and poor prognosis in diverse malignancies, we aimed to investigate the diagnostic relevance of chemokines in PCa. Materials and methods: Preoperative and early postoperative serum samples were obtained from 39 consecutive PCa patients undergoing radical prostatectomy. Serum from 15 healthy volunteers served as controls. Concentrations of CXCL12, CXCL13, CX3CL1, CCL2, CCL5, and CCL20 were measured in serum by Luminex. The expression activity of CXCR3, CXCR4, CXCR5, CXCR7, CXCL12, CXCL13, CX3CR1, CXCL1, CCR2, CCR5, CCR6, CCR7, CCL2, and CCL5 mRNA was assessed in tumor and adjacent normal tissue of prostatectomy specimens by quantitative real-time polymerase chain reaction. The associations of these chemokines with clinical and histological parameters were tested. Results: The gene expression activity of CCL2 and CCR6 was significantly higher in tumor tissue compared to adjacent normal tissue. CCL2 was also significantly higher in the blood samples of PCa patients, compared to controls. CCL5, CCL20, and CX3CL1 were lower in patient serum, compared to controls. CCR2 tissue mRNA was negatively correlated with the Gleason score and grading. Conclusion: Chemokines are significantly modified during tumorigenesis of PCa, and CCL2 is a promising diagnostic biomarker.

The drug efflux transporter ABCB5 identifies cancer stem–like cells (CSC) in diverse human malignancies, where its expression is associated with clinical disease progression and tumor recurrence. ABCB5 confers therapeutic resistance, but other functions in tumorigenesis independent of drug efflux have not been described that might help explain why it is so broadly overexpressed in human cancer. Here we show that in melanoma-initiating cells, ABCB5 controls IL1β secretion, which serves to maintain slow cycling, chemoresistant cells through an IL1β/IL8/CXCR1 cytokine signaling circuit. This CSC maintenance circuit involved reciprocal paracrine interactions with ABCB5-negative cancer cell populations. ABCB5 blockade induced cellular differentiation, reversed resistance to multiple chemotherapeutic agents, and impaired tumor growth in vivo. Together, our results defined a novel function for ABCB5 in CSC maintenance and tumor growth. Cancer Res; 74(15); 4196–207. ©2014 AACR.

Toll like receptor (TLR) signaling has been suggested to play an important role in the inflammatory microenvironment of solid tumors and through this inflammation-mediated tumor growth. Here, we studied the role of tumor cells in their process of self-maintaining TLR expression independent of inflammatory cells and cytokine milieu for autoregulative tumor growth signaling in pancreatic cancer. We analyzed the expression of TLR2, -4, and -9 in primary human cancers and their impact on tumor growth via induced activation in several established pancreatic cancers. TLR-stimulated pancreatic cancer cells were specifically investigated for activated signaling pathways of VEGF/PDGF and anti-apoptotic Bcl-xL expression as well as tumor cell growth. The primary pancreatic cancers and cell lines expressed TLR2, -4, and -9. TLR-specific stimulation resulted in activated MAP-kinase signaling, most likely via autoregulative stimulation of demonstrated TLR-induced VEGF and PDGF expression. Moreover, TLR activation prompted the expression of Bcl-xL and has been demonstrated for the first time to induce tumor cell proliferation in pancreatic cancer. These findings strongly suggest that pancreatic cancer cells use specific Toll like receptor signaling to promote tumor cell proliferation and emphasize the particular role of TLR2, -4, and -9 in this autoregulative process of tumor cell activation and proliferation in pancreatic cancer.

Colon cancer is one of the most common tumors worldwide, with increasing incidence in developing countries. Patients treated with fluoxetine (FLX) have a reduced incidence of colon cancer, although there still remains great controversy about the nature of its effects. Here we explore the latest achievements related to FLX treatment and colon cancer. Moreover, we discuss new ideas about the mechanisms of the effects of FLX treatment in colon cancer. This leads to the hypothesis of FLX arresting colon tumor cells at the at G1 cell-cycle phase through a control of the tumor-related energy generation machinery. We believe that the potential of FLX to act against tumor metabolism warrants further investigation.

Background Measles virus (MV) causes T cell suppression by interference with phosphatidylinositol-3-kinase (PI3K) activation. We previously found that this interference affected the activity of splice regulatory proteins and a T cell inhibitory protein isoform was produced from an alternatively spliced pre-mRNA. Hypothesis Differentially regulated and alternatively splice variant transcripts accumulating in response to PI3K abrogation in T cells potentially encode proteins involved in T cell silencing. Methods To test this hypothesis at the cellular level, we performed a Human Exon 1.0 ST Array on RNAs isolated from T cells stimulated only or stimulated after PI3K inhibition. We developed a simple algorithm based on a splicing index to detect genes that undergo alternative splicing (AS) or are differentially regulated (RG) upon T cell suppression. Results Applying our algorithm to the data, 9% of the genes were assigned as AS, while only 3% were attributed to RG. Though there are overlaps, AS and RG genes differed with regard to functional regulation, and were found to be enriched in different functional groups. AS genes targeted extracellular matrix (ECM)-receptor interaction and focal adhesion pathways, while RG genes were mainly enriched in cytokine-receptor interaction and Jak-STAT. When combined, AS/RG dependent alterations targeted pathways essential for T cell receptor signaling, cytoskeletal dynamics and cell cycle entry. Conclusions PI3K abrogation interferes with key T cell activation processes through both differential expression and alternative splicing, which together actively contribute to T cell suppression.

Background: Hyperthermic intraperitoneal chemotherapy (HIPEC) is a promising procedure for the treatment of peritoneal carcinomatosis (PC). Heat shock proteins (HSPs) and other proteins involved in cellular repair mechanisms seem to induce cytoprotective processes during HIPEC therapy. Therefore, the aim of this study was to analyze the effects of HIPEC-related conditions on tumor cell proliferation and the expression of HSPs in human colon cancer. Methods: Human colon cancer cell lines HT29, SW480 and SW620 were exposed to different temperatures (37°C, 41°C, and 43°C) as well as defined cytostatic agents (Oxaliplatin, Mitomycin C, and 5-Fluorouracil). After cellular regeneration (30 min, 24 h, 48 h and 72 h) RNA isolation and whole cell extraction was performed. Gene and protein expression analysis of HSP27, 70, 72 and 90 as well as PCNA, Ki-67, BCl-2 and BCl-Xl were carried out using RT-qPCR and Western blot. Additionally, MTS cell proliferation assays were performed 24 h, 48 h, 72 h and 96 h post treatment. Moreover, AnnexinV apoptosis assays were conducted. Results: All colon cancer cells exposed to hyperthermic conditions showed initially up-regulated HSP gene expression. Highest expression was found after exposure to 43°C. Combined cytostatic and hyperthermic treatment demonstrated additional increase in HSP27 expression and in other HSPs to a lesser degree. Tumor cells exposed to cytostatic agents showed overall higher HSP gene expression compared to cells without chemotoxic treatment. Similar effects were detected for the expression of the proliferation marker PCNA and anti-apoptotic protein BCl-Xl. Apoptosis assay demonstrated decreased numbers of apoptotic cells at 43°C compared to normothermia. Additionally, proliferation assays revealed reduced chemosensitivity in cells treated with hyperthermia. Conclusion: Desired effects of hyperthermia used in HIPEC therapy to achieve anti-proliferative and apoptosis inducing effects seem to be negatively influenced by cell stress mediated repair mechanisms in colon cancer. Our in vitro findings suggest analyzed HSPs to be significantly involved in this hyperthermia and chemotoxicity mediated cellular repair mechanisms. While initial increase in HSP expression can counteract cytotoxic effects during HIPEC therapy their prolonged expression may promote lasting resistance to cellular stress. Citation Format: Tanja Grimmig, Kerstin Kloos, Rebecca Thumm, Romana Moench, Christoph T. Germer, Ana Maria Waaga-Gasser, Martin Gasser. Cell stress during HIPEC causes heat shock protein induction and reduced chemosensitivity in human colon cancer. [abstract]. In: Proceedings of the 107th Annual Meeting of the American Association for Cancer Research; 2016 Apr 16-20; New Orleans, LA. Philadelphia (PA): AACR; Cancer Res 2016;76(14 Suppl):Abstract nr 2945.

Cancer stem cells (CSC) responsible for disease progression and therapeutic resistance have been identified in several human malignancies, including colorectal cancer (CRC). However, the molecular mechanisms through which CSC drive tumor growth are incompletely understood. ABCB5, a member of the ATP-binding cassette superfamily of active transporters, serves as a CSC-specific multidrug resistance mechanism in diverse human malignancies. Additionally, ABCB5 has recently been demonstrated to function as an anti-apoptotic gene in tissue-specific non-malignant stem cells. Here we demonstrate that ABCB5 also serves an anti-apoptotic role required for CSC maintenance in human cancer. Targeted inhibition of ABCB5, previously shown to be preferentially expressed on CD133-positive CRC stem cells, induced tumor cell apoptosis in vitro and in vivo and inhibited human CRC growth in NSG recipient mice. Mechanistically, ABCB5-positive tumor cell ablation through monoclonal antibody-mediated blockade or shRNA-mediated gene knockdown resulted in diminished production of the receptor tyrosine kinase AXL, a pro-tumorigenic molecule identified herein to be preferentially produced by CRC stem cells. Restoration of AXL expression through gene transfection in ABCB5 knockdown tumors partially restored tumor growth, demonstrating that ABCB5-positive CRC stem cells drive tumorigenicity at least in part through production of AXL. Our results establish a novel anti-apoptotic function of ABCB5 in human cancer and indicate that targeted blockade of ABCB5 represents a novel strategy for CSC eradication, independent of its previously established function as a multidrug resistance mediator. Citation Format: Qin Guo, Gretchen Berg, Brian J. Wilson, Gabriel Gonzalez, Jie Ma, Jason S. Gold, Bisweswar Nandi, Qin Huang, Qian Zhan, George F. Murphy, Ana Maria Waaga-Gasser, Christine G. Lian, Markus H. Frank, Martin Gasser, Natasha Frank. The stem cell gene ABCB5 mediates colorectal cancer resistance to apoptosis. [abstract]. In: Proceedings of the AACR Special Conference: Developmental Biology and Cancer; Nov 30-Dec 3, 2015; Boston, MA. Philadelphia (PA): AACR; Mol Cancer Res 2016;14(4_Suppl):Abstract nr B28.

Background: Inhibitors of the mammalian target of rapamycin (mTOR) might become a novel tool to treat advanced prostate cancer. However, chronic drug exposure may trigger resistance, limiting the utility of mTOR inhibitors. Methods: Metastatic potential of PC3 prostate cancer cells, susceptible (PC3par) or resistant (PC3res) to the mTOR-inhibitor RAD001 was investigated. Adhesion to vascular endothelium or immobilised collagen, fibronectin and laminin was quantified. Motility, migration and invasion were explored by modified Boyden chamber assay. Integrin α and β subtypes were analysed by flow cytometry, western blotting and real-time PCR. Integrin-related signalling, EGFr, Akt, p70S6kinase and ERK1/2 activation were determined. Results: Adhesion was reduced, whereas motility, migration and invasion were enhanced in PC3res. The α2 and β1 integrin subtypes were dramatically elevated, integrins α1 and α6 were lowered, whereas α5 was nearly lost in PC3res. Activation of the Akt signalling pathway was strongly upregulated in these cells. Treating PC3par cells with RAD001 reduced motility, migration and invasion and deactivated Akt signalling. Blocking studies revealed that α2 and β1 integrins significantly trigger the motile behaviour of the tumour cells. Conclusion: Chronic RAD001 treatment caused resistance development characterised by distinct modification of the integrin-expression profile, driving prostate cancer cells towards high motility.

Melanoma growth is driven by malignant melanoma-initiating cells (MMIC) identified by expression of the ATP-binding cassette (ABC) member ABCB5. ABCB5+ melanoma subpopulations have been shown to overexpress the vasculogenic differentiation markers CD144 (VE-cadherin) and TIE1 and are associated with CD31− vasculogenic mimicry (VM), an established biomarker associated with increased patient mortality. Here we identify a critical role for VEGFR-1 signaling in ABCB5+ MMIC-dependent VM and tumor growth. Global gene expression analyses, validated by mRNA and protein determinations, revealed preferential expression of VEGFR-1 on ABCB5+ tumor cells purified from clinical melanomas and established melanoma lines. In vitro, VEGF induced the expression of CD144 in ABCB5+ subpopulations that constitutively expressed VEGFR-1 but not in ABCB5− bulk populations that were predominantly VEGFR-1−. In vivo, melanoma-specific shRNA-mediated knockdown of VEGFR-1 blocked the development of ABCB5+ VM morphology and inhibited ABCB5+ VM-associated production of the secreted melanoma mitogen laminin. Moreover, melanoma-specific VEGFR-1 knockdown markedly inhibited tumor growth (by >90%). Our results show that VEGFR-1 function in MMIC regulates VM and associated laminin production and show that this function represents one mechanism through which MMICs promote tumor growth. Cancer Res; 71(4); 1474–85. ©2011 AACR.

Background The local and systemic activation and regulation of the immune system by malignant cells during carcinogenesis is highly complex with involvement of the innate and acquired immune system. Despite the fact that malignant cells do have antigenic properties their immunogenic effects are minor suggesting tumor induced mechanisms to circumvent cancer immunosurveillance. The aim of this study is the analysis of tumor immune escape mechanisms in a colorectal liver metastases mouse model at different points in time during tumor growth. Methods CT26.WT murine colon carcinoma cells were injected intraportally in Balb/c mice after median laparotomy using a standardized injection technique. Metastatic tumor growth in the liver was examined by standard histological procedures at defined points in time during metastatic growth. Liver tissue with metastases was additionally analyzed for cytokines, T cell markers and Fas/Fas-L expression using immunohistochemistry, immunofluorescence and RT-PCR. Comparisons were performed by analysis of variance or paired and unpaired t test when appropriate. Results Intraportal injection of colon carcinoma cells resulted in a gradual and time dependent metastatic growth. T cells of regulatory phenotype (CD4+CD25+Foxp3+) which might play a role in protumoral immune response were found to infiltrate peritumoral tissue increasingly during carcinogenesis. Expression of cytokines IL-10, TGF-β and TNF-α were increased during tumor growth whereas IFN-γ showed a decrease of the expression from day 10 on following an initial increase. Moreover, liver metastases of murine colon carcinoma show an up-regulation of FAS-L on tumor cell surface with a decreased expression of FAS from day 10 on. CD8+ T cells express FAS and show an increased rate of apoptosis at perimetastatic location. Conclusions This study describes cellular and macromolecular changes contributing to immunological escape mechanisms during metastatic growth in a colorectal liver metastases mouse model simulating the situation in human cancer.

Tumor initiation and growth result from the formation of cancer initiating cells, also known as cancer stem cells (CSC). ABCB5 is a novel human multidrug resistance mediator. We recently showed that ABCB5 identifies CSC in malignant melanoma that correlates with clinical disease progression and that can be specifically targeted to abrogate tumor growth. The aim of this study was the identification and characterization of CSC in pancreatic cancer using ABCB5. In this retrospective study a total of 51 patients with histologically verified pancreatic ductal adenocarcinoma were treated at our Department from 01/2003 to 06/2005. In addition, 21 patients were selected based on the availability of tissue specimens from the primary tumor and R0-resection. The protein and gene expression was analyzed for ABCB5 as well as the CSC cells with CD133. The potential role of ABCB5 as a novel marker for pancreatic CSC was examined by determining the specific capacity of ABCB5+ pancreatic cancer cells for in vivo tumor initiation, self-renewal and differentiation, i.e. hallmark CSC functions, in human to NOD/SCID mouse tumor xenotransplantation assays. The values of all morphological and molecular parameters were correlated with clinicopathological characteristics for their predictive value of tumor recurrence using chi-square test, Kaplan-Meier method, univariate analysis, and Mann-Whitney-U-Test. The amount of ABCB5+ tumor tissues as well as ABCB5+ tumor cells were significantly different in pancreas carcinoma compared with normal tissues or tissues from chronic pancreatitis (UICC I–IV:n=15/21 (71.4%), in which UICC I/II: n=6/10, mean 10.6±8.1% of all tumor cells; UICC III/IV: n=9/11 (82%), mean 17.0±5.0% of all tumor cells; p

The platelet derived growth factor (PDGF) plays an important role in several solid tumors. Involved in cell migration and proliferation primarily of stromal cells in cancers PDGF represents a key target in cancer therapy. The aim of this study was to analyze the specific role of PDGF on tumor cell proliferation and metabolism in colorectal cancer (CRC). The human colon cancer cell line HT-29 was cultured and stimulated time-dependently with PDGF. Additionally, inhibition of the PI3k/Akt/mTOR-pathway was performed simultaneously to PDGF stimulation. Whole cell and RNA extracts were analyzed by Western Blot and RT-q-PCR for the PI3k/Akt/mTOR-pathway and components of cellular metabolism. To investigate the effects of PDGF on proliferation MTS assays were performed. Additionally, mRNA levels of PDGF and metabolic factors in tumors from patients with CRC were analyzed by RT-qPCR. PDGF stimulation resulted in increased HT29 cell proliferation compared to untreated controls. Blocking of Akt resulted in inhibition of pS6, activation of Retinoblastoma (Rb) and reduced tumor cell growth. Additionally, under stimulation a higher glycolytic rate was observed while oxygen consumption remained unaltered. Investigated tumors from patients with CRC showed a stage-dependent increase in PDGF expression and a boosted glycolytic rate. The cytokine PDGF induced proliferation accompanied with an altered glycolysis in HT-29 colon cancer. An increased glycolysis and tumor cell proliferation support accelerated cell proliferation and tumor growth. The growth reducing effect of Akt inhibition indicates the PI3K/Akt/mTOR-pathway to play a crucial role in CRC progression and therefore could be an important target in cancer therapy. Note: This abstract was not presented at the meeting. Citation Format: Romana Moench, Vinicius Kannen, Tanja Grimmig, Christoph T. Germer, Martin Gasser, Ana Maria Waaga-Gasser. PDGF induces cell growth and glycolysis in colon cancer. [abstract]. In: Proceedings of the 106th Annual Meeting of the American Association for Cancer Research; 2015 Apr 18-22; Philadelphia, PA. Philadelphia (PA): AACR; Cancer Res 2015;75(15 Suppl):Abstract nr 3917. doi:10.1158/1538-7445.AM2015-3917

In patients with peritoneal carcinomatosis (PC) of gastrointestinal cancer hyperthermic intraperitoneal chemotherapy (HIPEC) represents a promising treatment option integrated into multimodal concepts. Heat shock proteins (HSP) play a major role in cellular stress response conferring increased resistance in tumor cells. Therefore we analyzed HSP expression profiles in tumor cells exposed to hyperthermic and chemotherapeutic stress. To mimic HIPEC-like conditions HT29 colon cancer cells were exposed to varying hyperthermic conditions for 60 min with additional 5-fluorouracil (5-FU) treatment. HSP expression was analyzed 30 min, 24 h, 48 h and 72 h after treatment using Western Blot and RT-qPCR. Untreated cells cultivated at 37°C served as controls. Additionally, effects on tumor cell proliferation were determined 24 h, 48 h and 72 h after treatment by MTS-assay. Hyperthermia caused temperature dependent upregulation of HSP27, HSP70, HSP72, and HSP90 gene and protein expression that was further increased by additional cytotoxic 5-FU treatment. 5-FU initiated progressive rise in HSP gene expression up to 72 h after 1 h exposure at normothermia as well as under hyperthermia. After isolated hyperthermia tumor cell proliferation was recovered at 72 h. Antiproliferative effects of 5-FU could not be enhanced by further increased hyperthermia. Antiproliferative effects of hyperthermia induced during HIPEC therapy seem to be negatively influenced by highly conserved HSP mechanisms. Our findings suggest that HSP27, HSP70/72, and HSP90 are significantly involved in hyperthermia and chemotoxicity mediated cell stress repair mechanisms. While initial increase in HSP expression can counteract cytotoxic effects during HIPEC therapy long-term elevated expression levels may cause lasting resistance to cellular stress. Note: This abstract was not presented at the meeting. Citation Format: Tanja Grimmig, Rebeca Thumm, Romana Moench, Eva M. Moll, Christoph T. Germer, Ana Maria Waaga-Gasser, Martin Gasser. Hyperthermia and chemotherapy mediated effects on tumor cell proliferation and heat shock protein expression in human colon cancer. [abstract]. In: Proceedings of the 106th Annual Meeting of the American Association for Cancer Research; 2015 Apr 18-22; Philadelphia, PA. Philadelphia (PA): AACR; Cancer Res 2015;75(15 Suppl):Abstract nr 1244. doi:10.1158/1538-7445.AM2015-1244

Interactions between chemokines and chemokine receptors have been proposed recently to be of importance in the development and progression of cancer. Human breast cancer cells express the chemokine CXCL10 (IP-10) and also its receptor CXCR3. In this study, we have investigated the role of Ras activation in the regulation of CXCL10 and its receptor splice variant CXCR3-B in two human breast cancer cell lines MDA-MB-435 and MCF-7. In cotransfection assays, using a full-length CXCL10 promoter-luciferase construct, we found that the activated form of Ras, Ha-Ras(12V), promoted CXCL10 transcriptional activation. Ras significantly increased CXCL10 mRNA and protein expression as observed by real-time PCR, fluorescence-activated cell sorting analysis, and ELISA. Selective inhibition of Ha-Ras by small interfering RNA (siRNA) decreased CXCL10 mRNA expression in a dose-dependent manner. Further, using effector domain mutants of Ras, we found that Ras-induced overexpression of CXCL10 is mediated primarily through the Raf and phosphatidylinositol 3-kinase signaling pathways. We also observed that the expression of the splice variant CXCR3-B, known to inhibit cell proliferation, was significantly down-regulated by Ras. Selective inhibition of CXCR3-B using siRNA resulted in an increase in CXCL10-mediated breast cancer cell proliferation through Gi proteins and likely involving CXCR3-A. Finally, we observed intense expression of CXCL10 and CXCR3 in association with human breast cancer in situ, indicating that these observations may be of pathophysiologic significance. Together, these results suggest that activation of Ras plays a critical role in modulating the expression of both CXCL10 and CXCR3-B, which may have important consequences in the development of breast tumors through cancer cell proliferation. (Cancer Res 2006; 66(19): 9509-18)

Despite the radical surgical resection performed in patients with colorectal carcinoma, there is a high rate of tumor recurrence. Over an observation period of 3 years, 18% of the patients in our collective suffered a tumor relapse with local or distinct metastases after initial R0-resection. Some evidence suggests that this may be due to suppression of anti-tumor responses, a phenomenon that might be attributed to regulatory T cells. The aim of our study was to investigate the tumor-specific immune response depending on the UICC stage of patients with colorectal cancer. The cellular immune responses against defined antigens that are overexpressed in most of the patients with colorectal cancer were characterized. For this purpose, the tumor suppressor gene, p53, was chosen as the tumor-associated antigen that exhibits mutations and overexpression in up to 60% of colorectal carcinoma. We observed that p53 induced both IFN-gamma and IL-10 secretion. The predominance of IL-10 production indicated that regulatory T cells directly participate in modulating the anti-tumor immune response. IL-10 levels in the blood as well as the expression of regulatory T-cell specific genes at the tumor site correlate with the UICC stage of the disease. These results may provide an explanation for the poor prognosis and increased recurrence rate in patients with advanced carcinoma.

Self-tolerance and tumor-induced peripheral tolerance may be responsible for the limitations of the immune system in controlling tumor growth in cancer patients. It is known, that self-proteins are continuously processed and presented by antigen presenting cells. During development, auto-reactive T cells encountering self peptide/self-MHC complexes are being eliminated in the thymus. This process called 'negative selection' results in the removal of nascent auto-reactive T cells thus preventing an autoimmune attack of our own tissues. Many self-peptides (e.g. parts of p53), despite their high affinity for self-MHC, remain cryptic in the thymus and do not mediate cell deletion. Under conditions that favor up-regulation of cryptic self-determinants, one or more of these subsets of the 'protected' T cell repertoires, can be stimulated by these self-determinants, leading to induction of autoreactivity. The latter could eventually result in auto-immunity under permissive conditions governed by MHC and non-MHC genes. Thus, considering tumor tissue a 'modified self-tissue', this process that may have evolved to prevent excessive purge of the T cell repertoire, providing the potential for the development of autoimmune responses and therefore for anti-cancer therapy in adults.

Enhanced drug efflux mediated by ABCB1 P-glycoprotein and related ATP-binding cassette transporters is one of several mechanisms of multidrug resistance thought to impair chemotherapeutic success in human cancers. In malignant melanoma, its potential contribution to chemoresistance is uncertain. Here, we show that ABCB5, which functions as a determinant of membrane potential and regulator of cell fusion in physiologic skin progenitor cells, is expressed in clinical malignant melanoma tumors and preferentially marks a subset of hyperpolarized, CD133+ stem cell phenotype-expressing tumor cells in malignant melanoma cultures and clinical melanomas. We found that ABCB5 blockade significantly reversed resistance of G3361 melanoma cells to doxorubicin, an agent to which clinical melanomas have been found refractory, resulting in a 43% reduction in the LD50 from 4 to 2.3 μmol/L doxorubicin (P < 0.05). Our results identified ABCB5-mediated doxorubicin efflux transport as the underlying mechanism of resistance, because ABCB5 blockade significantly enhanced intracellular drug accumulation. Consistent with this novel ABCB5 function and mechanism in doxorubicin resistance, gene expression levels of the transporter across a panel of human cancer cell lines used by the National Cancer Institute for drug screening correlated significantly with tumor resistance to doxorubicin (r = 0.44; P = 0.016). Our results identify ABCB5 as a novel drug transporter and chemoresistance mediator in human malignant melanoma. Moreover, our findings show that ABCB5 is a novel molecular marker for a distinct subset of chemoresistant, stem cell phenotype-expressing tumor cells among melanoma bulk populations and indicate that these chemoresistant cells can be specifically targeted via ABCB5 to enhance cytotoxic efficacy.

Background: Recent data demonstrate the programmed death-1/programmed death ligand (PD-1/PD-L) pathway in T cell activation to play an important role in tumor evasion from host immunity. The aim of this study was to analyze the clinical significance of PD-1/PD-L1/L2 signaling in colorectal cancer (CRC). Methods: Gene and protein expression levels of PD-1, PD-L1, PD-L2, CD4, CD8 and Foxp3 were analyzed in tumors from patients with CRC (n=116 with completed 5-year follow up) by immunohistochemistry and RT-qPCR. Obtained data were analyzed for their prognostic significance with respect to outcome analysis. Results: 90.5% of the investigated tumors showed T cell infiltration, with 58% of the patients demonstrating PD-1-positive T cells in their tumors. Increased PD-L1-expression levels were found in patients who developed PD-1-positive T cell infiltration compared to PD-1-T cell negative individuals. Statistical analysis showed ligand expression (PD-L1/PD-L2) in the cancer tissues combined with dense PD-1-positive T cell infiltration to be associated with poor prognosis in affected patients (p Conclusion: The presented results from clinical cancers suggest for the first time for CRC that negative signaling of infiltrating PD-1-positive T cells through PD-L1 expression within the tumor is promoting tumor progression through downregulation of anti-tumor immunity. In conclusion, this study demonstrates the importance of strategies inhibiting negative PD-1/PD-L1 signaling in CRC. Citation Format: Tanja Grimmig, Romana Mönch, Andreas Rosenwald, Christoph T. Germer, Martin Gasser, Ana Maria Waaga-Gasser. The potential of PD-1/PD-L1 signaling inhibition outlined from clinical analysis of colorectal cancer. [abstract]. In: Proceedings of the 105th Annual Meeting of the American Association for Cancer Research; 2014 Apr 5-9; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2014;74(19 Suppl):Abstract nr 4095. doi:10.1158/1538-7445.AM2014-4095

Background: The platelet derived growth factor (PDGF) and Vascular Endothelial Growth Factor (VEGF) are known to play a crucial role in different tumor entities. Involved in cell migration and proliferation of stromal cells and tumor cells they represent key targets in cancer therapy. The aim of the study was to analyse the specific role of PDGF and VEGF stimulation on tumor cell proliferation and metabolism in colorectal cancer (CRC). Methods: The human colon cancer cell line HT-29 and Caco-2 were cultured and stimulated with PDGF and VEGF in a time-dependent manner. Whole cell extracts and RNA extracts were analyzed by Western Blot and RT-q-PCR for PDGF- and VEGF receptors and for components of cellular metabolism. To discover effects of PDGF and VEGF on proliferation MTS proliferation assays were performed. Results: Western Blot analysis and RT-qPCR showed no relevant PDGF-receptor α and β expression in HT-29 cells but varying expression in Caco-2 cells. Stimulation with PDGF or VEGF resulted in increased proliferation compared to untreated controls while simultaneous stimulation with both growth factors did not result in intensified proliferation. Additionally, under stimulation altered expression of various metabolic components was detected. Conclusion: Our results demonstrate a promoting effect on tumor cell proliferation of both growth factors VEGF and PDGF. Simultaneous stimulation did not show synergistic effects. PDGF in HT-29 cells resulted in proliferation in the absence of PDGF receptors with changes in tumor cell metabolism after stimulation. Moreover in HT-29 cells glucose metabolism changed during stimulation. In conclusion, our data give evidence for direct receptor/ligand signalling of PDGF not only on stromal cells but also on colon cancer cells even in the absence of the PDGF receptor. Citation Format: Romana Mönch, Tanja Grimmig, Vinicius Kannen, Christoph T. Germer, Ana Maria Waaga-Gasser, Martin Gasser. The influence of PDGF and VEGF on tumor proliferation in colon cancer. [abstract]. In: Proceedings of the 105th Annual Meeting of the American Association for Cancer Research; 2014 Apr 5-9; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2014;74(19 Suppl):Abstract nr 28. doi:10.1158/1538-7445.AM2014-28

Background: In patients with isolated peritoneal carcinosis (PC) of gastric, colorectal and ovarian cancer hyperthermic intraperitoneal chemotherapy (HIPEC) represents a promising treatment option integrated into multimodal concepts. We analyzed relevant heat shock proteins (HSPs) that confer resistance to physical stress like hyperthermia as well as specific multidrug resistence (MDR) genes in patients with PC. Materials/Methods: Patients with different adenocarcinomas and additional PC that underwent HIPEC therapy between 09/09 and 03/11 in our department (gastric, colorectal and ovarian cancer) were included in the study. HIPEC therapy was performed under specific conditions (1hr permanent chemotherapeutical flux via external pump into the abdominal cavity after resection of relevant tumor masses with elevated temperature up to 43°C). Tumors before and after HIPEC therapy were analyzed for HSPs, ABC transporter and CD133 expression by immunohistochemistry, Western Blot, and RT-qPCR. Additionally, HT29 tumor cells were exposed in vitro to different conditions of hyperthermia up to 43°C for 60 minutes and comparably analyzed. Tumor cells were counted and studied for apoptosis. Results: HSP70/72, HSP90 and CD133 expression was upregulated in the investigated tumors, in particular post HIPEC therapy. Upregulated protein and gene expression was also shown for MDR genes ABCB5, ABCG2 and ABCC5. Hyperthermia induced upregulated protein and gene expression in HT29 tumor cells dependent on incubation temperature, mainly for HSPs observed in western blot, immunohistochemistry and RT-qPCR. Furthermore, cell viability decreased with increasing incubation temperature. Conclusion: Therapeutic approaches like HIPEC to achieve antiproliferative and apoptosis inducing cellular effects in patients with PC seem to be negatively influenced by highly conserved HSP mechanisms as well as multidrug resistance genes. Studying HSP and MDR expression profiles both in patient tumors and in vitro are valuable tools to further clarify the effects of hyperthermia and chemotherapeutical agents in context with the treatment of HIPEC therapy in the affected patients. Citation Format: Martin Gasser, Maria Lazariotou, Malte Vetterlein, Tanja Grimmig, Christoph T. Germer, Joerg Pelz, Ana Maria Waaga-Gasser. Hyperthermic isolated intraperitoneal chemoperfusion (HIPEC) for treatment of patients with peritoneal carcinosis - Analysing negative influencing cellular mechanisms in the tumor cells. [abstract]. In: Proceedings of the 104th Annual Meeting of the American Association for Cancer Research; 2013 Apr 6-10; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2013;73(8 Suppl):Abstract nr 881. doi:10.1158/1538-7445.AM2013-881

Melanoma remains a disease with relatively few beneficial treatments currently available, for late-stage patients. The ATP-binding cassette (ABC) transporter ABCB5 has recently been identified as a cell-surface marker for malignant melanoma initiating cells (MMICs; Schatton et al, Nature 2008), opening a new paradigm for investigation of this aggressive cancer. We have previously demonstrated that these ABCB5+ MMICs can evade the host immune system, and also express VEGFR-1, required for efficient tumor formation. However, the possibility that ABCB5 itself plays a functional role in melanoma tumorigenic growth and progression has not been investigated, until now. To test whether ABCB5 plays a functional role in melanoma growth, or is solely a marker of the cancer stem-cell subset, we generated ABCB5-shRNA knockdown (ABCB5-KD) cell populations in melanoma model cell-lines. To distinguish a bona fide role in intrinsic tumorigenesis from immuno-modulatory effects we subcutaneously injected these cells, versus control cells, into highly immunocompromised NOD/SCID Il2rγ-/- mice and followed tumor progression. We observed a marked and significant downregulation in the ability of ABCB5-KD cells to maintain efficient tumor growth, implying a direct role for ABCB5 in melanoma progression. To obtain mechanistic data to explain this phenotype we generated RNA from ABCB5-KD cells versus controls, and performed microarray analysis of global genomic changes in transcript levels of these cells. We then validated potential “ABCB5-pathway” genes, which also change in the reciprocal manner in an ABCB5 overexpression system that we have developed. Our study links ABCB5 to a direct role in melanoma carcinogenesis, identifies genes and pathways of interest, and uncovers ABCB5 as a putative master-regulator of melanoma. Citation Format: Brian J. Wilson, Karim R. Saab, Tobias Schatton, Jie Ma, George F. Murphy, Martin Gasser, Ana Maria Waaga-Gasser, Natasha Y. Frank, Markus H. Frank. ABCB5 is functionally required for melanoma growth. [abstract]. In: Proceedings of the 104th Annual Meeting of the American Association for Cancer Research; 2013 Apr 6-10; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2013;73(8 Suppl):Abstract nr 243. doi:10.1158/1538-7445.AM2013-243

Targeted personalized treatment approaches are critical for the development of successful therapies for advanced colorectal cancer (CRC). In this regard, circulating tumor cells (CTC) are of foremost interest as potential predictors of metastatic disease progression and patient therapeutic response. We have previously demonstrated that ATP-binding cassette member B5 (ABCB5) is expressed by cancer stem cells (CSC) in several human malignancies, including CRC, and that ABCB5 identifies therapy-refractory tumor subpopulations in CRC patients that correlate with disease progression. In order to evaluate the potential role of ABCB5 as a clinically relevant CTC marker, we utilized a human-to-mouse xenograft model system to examine the relationship of ABCB5-positive CRC-CTC to CRC metastasis. Human CRC tumor cells were grafted subcutaneously into immunocompromized NSG mice. 7 weeks after xenotransplantation, peripheral blood mononuclear cells and lungs were evaluated by qPCR for expression of human ABCB5 and GAPDH mRNAs. Expression analysis of these specimens revealed a significant positive correlation between peripheral blood human ABCB5 mRNA expression and aggregate metastatic disease load as determined by human GAPDH mRNA expression levels in lungs (r=0.8994, P=0.0147). Remarkably, no significant correlation existed between peripheral blood human GAPDH mRNA expression and metastatic disease load, indicating a unique and essential role of ABCB5-positive CSC-CTC in colorectal cancer metastatic disease progression. Significantly increased peripheral blood ABCB5 expression was also observed in a clinical series of UICC stages I-III colorectal cancer patients (n=105) compared to healthy controls (P Citation Format: Qin Guo, Jie Ma, Brian J. Wilson, Martin Gasser, Ana Maria Waaga-Gasser, Markus H. Frank, Natasha Y. Frank. ABCB5 expression in colorectal cancer circulating tumor cells correlates with metastatic disease progression. [abstract]. In: Proceedings of the 104th Annual Meeting of the American Association for Cancer Research; 2013 Apr 6-10; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2013;73(8 Suppl):Abstract nr 4914. doi:10.1158/1538-7445.AM2013-4914