Search

The rhabdoid tumor (RT) predisposition syndromes 1 and 2 (RTPS1 and 2) are rare genetic conditions rendering young children vulnerable to an increased risk of RT, malignant neoplasms affecting the kidney, miscellaneous soft-part tissues, the liver and the central nervous system (Atypical Teratoid Rhabdoid Tumors, ATRT). Both, RTPS1&2 are due to pathogenic variants (PV) in genes encoding constituents of the BAF chromatin remodeling complex, i.e. SMARCB1 (RTPS1) and SMARCA4 (RTPS2). In contrast to other genetic disorders related to PVs in SMARCB1 and SMARCA4 such as Coffin-Siris Syndrome, RTPS1&2 are characterized by a predominance of truncating PVs, terminating transcription thus explaining a specific cancer risk. The penetrance of RTPS1 early in life is high and associated with a poor survival. However, few unaffected carriers may be encountered. Beyond RT, the tumor spectrum may be larger than initially suspected, and cancer surveillance offered to unaffected carriers (siblings or parents) and long-term survivors of RT is still a matter of discussion. RTPS2 exposes female carriers to an ill-defined risk of small cell carcinoma of the ovaries, hypercalcemic type (SCCOHT), which may appear in prepubertal females. RT surveillance protocols for these rare families have not been established. To address unresolved issues in the care of individuals with RTPS and to propose appropriate surveillance guidelines in childhood, the SIOPe Host Genome working group invited pediatric oncologists and geneticists to contribute to an expert meeting. The current manuscript summarizes conclusions of the panel discussion, including consented statements as well as non-evidence-based proposals for validation in the future.

Infant high-grade gliomas appear clinically distinct from their counterparts in older children, indicating that histopathologic grading may not accurately reflect the biology of these tumors. We have collected 241 cases under 4 years of age, and carried out histologic review, methylation profiling, and custom panel, genome, or exome sequencing. After excluding tumors representing other established entities or subgroups, we identified 130 cases to be part of an “intrinsic” spectrum of disease specific to the infant population. These included those with targetable MAPK alterations, and a large proportion of remaining cases harboring gene fusions targeting ALK (n = 31), NTRK1/2/3 (n = 21), ROS1 (n = 9), and MET (n = 4) as their driving alterations, with evidence of efficacy of targeted agents in the clinic. These data strongly support the concept that infant gliomas require a change in diagnostic practice and management. Significance: Infant high-grade gliomas in the cerebral hemispheres comprise novel subgroups, with a prevalence of ALK, NTRK1/2/3, ROS1, or MET gene fusions. Kinase fusion–positive tumors have better outcome and respond to targeted therapy clinically. Other subgroups have poor outcome, with fusion-negative cases possibly representing an epigenetically driven pluripotent stem cell phenotype. See related video: https://vimeo.com/438254885 See related commentary by Szulzewsky and Cimino, p. 904. This article is highlighted in the In This Issue feature, p. 890

We report on a long-term survivor of an atypical teratoid/rhabdoid tumor (ATRT-TYR) as an index patient, who carries a SMARCB1 exon 6 gain inherited from his father. The father was diagnosed with an unusual sequence of a myxopapillary INI1-negative ependymoma and a relapsing BRAF V600 wild type hairy-cell leukemia. He has two yet healthy sisters aged 33 and 38 years carrying the same variant, from which one had lost an infant to a malignant brain tumor. This family highlights the existence of RTPS1-associated SMARCB1 germline alterations with reduced penetrance and extends the spectrum of involved diseases

Infantile myofibromatosis (IM), which is typically diagnosed in young children, comprises a wide clinical spectrum ranging from inconspicuous solitary soft tissue nodules to multiple disseminated tumors resulting in life-threatening complications. Familial IM follows an autosomal dominant mode of inheritance and is linked toPDGFRBgermline variants. SomaticPDGFRBvariants were also detected in solitary and multifocal IM lesions.PDGFRBvariants associated with IM constitutively activate PDGFRB kinase activity in the absence of its ligand. Germline variants have lower activating capabilities than somatic variants and, thus, require a second cis-acting hit for full receptor activation. Typically, these mutant receptors remain sensitive to tyrosine kinase inhibitors such as imatinib. The SIOPE Host Genome Working Group, consisting of pediatric oncologists, clinical geneticists and scientists, met in January 2020 to discuss recommendations for genetic testing and surveillance for patients who are diagnosed with IM or have a family history of IM/PDGFRBgermline variants. This report provides a brief review of the clinical manifestations and genetics of IM and summarizes our interdisciplinary recommendations.

Background Choroid plexus tumors (CPTs) are intraventricular brain tumors predominantly arising in children but also affecting adults. In most cases, driver mutations have not been identified, although there are reports of frequent chromosome-wide copy-number alterations and TP53 mutations, especially in choroid plexus carcinomas (CPCs). Methods DNA methylation profiling and RNA-sequencing was performed in a series of 47 CPTs. Samples comprised 35 choroid plexus papillomas (CPPs), 6 atypical choroid plexus papillomas (aCPPs) and 6 CPCs plus three recurrences thereof. Targeted TP53 and TERT promotor sequencing was performed in all samples. Whole exome sequencing (WES) and linked-read whole genome sequencing (WGS) was performed in 25 and 4 samples, respectively. Results Tumors comprised the molecular subgroups “pediatric A” (N=11), “pediatric B” (N=12) and “adult” (N=27). Copy-number alterations mainly represented whole-chromosomal alterations with subgroup-specific enrichments (gains of Chr1, 2 and 21q in “pediatric B” and gains of Chr5 and 9 and loss of Chr21q in “adult”). RNA sequencing yielded a novel CCDC47-PRKCA fusion transcript in one adult choroid plexus papilloma patient with aggressive clinical course; an underlying Chr17 inversion was demonstrated by linked-read WGS. WES and targeted sequencing showed TP53 mutations in 7/47 CPTs (15%), five of which were children. On the contrary, TERT promoter mutations were encountered in 7/28 adult patients (25%) and associated with shorter progression-free survival (log-rank test, p=0.015). Conclusion Pediatric CPTs lack recurrent driver alterations except for TP53, whereas CPTs in adults show TERT promoter mutations or a novel CCDC47-PRKCA gene fusion, being associated with a more unfavorable clinical course.

Atypical teratoid/rhabdoid tumor (AT/RT) is a highly malignant central nervous system tumor predominantly occurring in infants that may also arise in older children and adults. Rare secondary AT/RT developing from other tumors such as pleomorphic xanthoastrocytoma (PXA) are on record, but AT/RT presenting with molecular features of PXA have not been described. Here, we report 3 malignant central nervous system tumors in children (10, 13, and 18 y old). All tumors were located in the temporal lobe. In 2 cases, there was no history of a low-grade precursor lesion; in 1 case anaplastic PXA had been diagnosed 3 months earlier. Histopathologically, all tumors were composed of RT cells and showed frank signs of malignancy as well as loss of nuclear SMARCB1/INI1 protein expression. Two cases displayed homozygous deletions of the SMARCB1 region while the third case showed an exon 7 mutation (c.849_850delGT; p.Met283Ilefs*77). Of note, DNA methylation profiles did not group with AT/RT or other tumor entities using the Heidelberg Brain Tumor Classifier (version v11b4). By unsupervised t-distributed stochastic neighbor embedding analysis and hierarchical clustering analysis, however, all tumors clearly grouped with PXA. Genome-wide copy number analysis revealed homozygous CDNK2A/B deletions and gains of whole chromosome 7. BRAF V600E mutations could be demonstrated in all cases. In conclusion, the possibility of AT/RT with molecular features of PXA needs to be taken into account and warrants molecular characterization of AT/RT especially in older children. Since treatments targeting mutated BRAF are available, identification of such cases may also have therapeutic consequences.

Background Controversy exists as to what may be defined as standard of care (including markers for stratification) for patients with atypical teratoid/rhabdoid tumors (ATRTs). The European Rhabdoid Registry (EU-RHAB) recruits uniformly treated patients and offers standardized genetic and DNA methylation analyses. Methods Clinical, genetic, and treatment data of 143 patients from 13 European countries were analyzed (2009–2017). Therapy consisted of surgery, anthracycline-based induction, and either radiotherapy or high dose chemotherapy following a consensus among European experts. Fluorescence in situ hybridization, multiplex ligation-dependent probe amplification, and sequencing were employed for assessment of somatic and germline mutations in SWItch/sucrose nonfermentable related, matrix associated, actin dependent regulator of chromatin, subfamily B (SMARCB1). Molecular subgroups (ATRT-SHH, ATRT-TYR, and ATRT-MYC) were determined using DNA methylation arrays, resulting in profiles of 84 tumors. Results Median age at diagnosis of 67 girls and 76 boys was 29.5 months. Five-year overall survival (OS) and event-free survival (EFS) were 34.7 ± 4.5% and 30.5 ± 4.2%, respectively. Tumors displayed allelic partial/whole gene deletions (66%; 122/186 alleles) or single nucleotide variants (34%; 64/186 alleles) of SMARCB1. Germline mutations were detected in 26% of ATRTs (30/117). The patient cohort consisted of 47% ATRT-SHH (39/84), 33% ATRT-TYR (28/84), and 20% ATRT-MYC (17/84). Age Conclusions Age and molecular subgroup status are independent risk factors for survival in children with ATRT. Our model warrants validation within future clinical trials.

Background The clinical phenotype associated with germline SMARCB1 mutations has as yet not been fully documented. It is known that germline SMARCB1 mutations may cause rhabdoid tumor predisposition syndrome (RTPS1) or schwannomatosis. However, the co‐occurrence of rhabdoid tumor and schwannomas in the same patient has not so far been reported. Methods We investigated a family with members harboring a germline SMARCB1 deletion by means of whole‐body MRI as well as high‐resolution microstructural magnetic resonance neurography (MRN). Breakpoint‐spanning PCRs were performed to characterize the SMARCB1 deletion and its segregation in the family. Results The index patient of this family was in complete continuous remission for an atypical teratoid/rhabdoid tumor (AT/RT) treated at the age of 2 years. However, at the age of 21 years, she exhibited paraparesis of her legs and MRI investigations revealed multiple intrathoracic and spinal schwannomas. Breakpoint‐spanning PCRs indicated that the germline deletion segregating in the family encompasses 6.4‐kb and includes parts of SMARCB1 intron 7, exons 8–9 and 3.3‐kb located telomeric to exon 9 including the SMARCB1 3′ UTR. The analysis of sequences at the deletion breakpoints showed that the deletion has been caused by replication errors including template‐switching. The patient had inherited the deletion from her 56‐year‐old healthy mother who did not exhibit schwannomas or other tumors as determined by whole‐body MRI. However, MRN of the peripheral nerves of the mother's extremities revealed multiple fascicular microlesions which have been previously identified as indicative of schwannomatosis‐associated subclinical peripheral nerve pathology. Conclusion The occurrence of schwannomatosis‐associated clinical symptoms independent of the AT/RT as the primary disease should be considered in long‐term survivors of AT/RT. Furthermore, our investigations indicate that germline SMARCB1 mutation carriers not presenting RTs or schwannomatosis‐associated clinical symptoms may nevertheless exhibit peripheral nerve pathology as revealed by MRN.

The aims of this study were to analyze the maxillomandibular morphology of patients with mucopolysaccharidosis (MPS) type I, II, III, IVa and VI and to evaluate the craniofacial effect of hematopoietic stem cell transplantation (HCST) in MPS I. One hundred head magnetic resonance images were retrospectively analyzed from 41 MPS and 27 control individuals. The width, height and length of the maxilla and mandible were plotted against age and the means of controls, MPS I, MPS II and MPS III were statistically compared. To determine the effect of HSCT in MPS I, jaw morphology was compared between MPS I patients with full donor chimerism versus patients with mixed/no donor chimerism. Maxillary dimensions were not statistically different between the MPS types. The height and length of the mandible were clearly smaller in MPS I as compared to those in controls, MPS II and MPS III. This was associated with progressive resorption of the mandibular condyles in MPS I, which was also observed in MPS II and VI, but not in MPS III or IVa. Whereas the success of HCST did not affect these changes, mandibular width was significantly smaller in MPS I individuals with full donor chimerism. MPS I individuals have a smaller mandible as compared to control, MPS II and MPS III individuals due to progressive condylar degeneration. These abnormalities are also evident following successful HSCT. Clinicians should be aware of specific differences in mandibular morphology and condylar involvement among the MPS subtypes.

Background Until today, adult and pediatric clinical trials investigating single-agent or combinatorial HDAC inhibitors including vorinostat in solid tumors have largely failed to demonstrate efficacy. These results may in part be explained by data from preclinical models showing significant activity only at higher concentrations compared to those achieved with current dosing regimens. In the current pediatric trial, we applied an intra-patient dose escalation design. The purpose of this trial was to determine a safe dose recommendation (SDR) of single-agent vorinostat for intra-patient dose escalation, pharmacokinetic analyses (PK), and activity evaluation in children (3–18 years) with relapsed or therapy-refractory malignancies. Results A phase I intra-patient dose (de)escalation was performed until individual maximum tolerated dose (MTD). The starting dose was 180 mg/m2/day with weekly dose escalations of 50 mg/m2 until DLT/maximum dose. After MTD determination, patients seamlessly continued in phase II with disease assessments every 3 months. PK and plasma cytokine profiles were determined. Fifty of 52 patients received treatment. n = 27/50 (54%) completed the intra-patient (de)escalation and entered phase II. An SDR of 130 mg/m2/day was determined (maximum, 580 mg/m2/day). n = 46/50 (92%) patients experienced treatment-related AEs which were mostly reversible and included thrombocytopenia, fatigue, nausea, diarrhea, anemia, and vomiting. n = 6/50 (12%) had treatment-related SAEs. No treatment-related deaths occurred. Higher dose levels resulted in higher Cmax. Five patients achieved prolonged disease control (> 12 months) and showed a higher Cmax (> 270 ng/mL) and MTDs. Best overall response (combining PR and SD, no CR observed) rate in phase II was 6/27 (22%) with a median PFS and OS of 5.3 and 22.4 months. Low levels of baseline cytokine expression were significantly correlated with favorable outcome. Conclusion An SDR of 130 mg/m2/day for individual dose escalation was determined. Higher drug exposure was associated with responses and long-term disease stabilization with manageable toxicity. Patients with low expression of plasma cytokine levels at baseline were able to tolerate higher doses of vorinostat and benefited from treatment. Baseline cytokine profile is a promising potential predictive biomarker. Trial registration ClinicalTrials.gov, NCT01422499. Registered 24 August 2011

AT/RT is a challenging entity due to a dearth of controlled clinical trials and lack of biological samples. We aimed to identify clinical and molecular risk factors in a carefully characterised series of AT/RT. METHODS: We enrolled 142 patients from 13 European countries (06/2009 to 08/2017). Median age at diagnosis was 17,5 months (25(th) /75(th) percentile: 9/26,5 months). Therapy followed a consensus regimen. Tumors were investigated for SMARCB1 and SMARCA4 mutations using FISH, MLPA and/or sequencing (n=87/142). Blood was examined for germline mutations (GLM) (n=114/142). Molecular subgroups (ATRT-TYR, -SHH or -MYC) were determined in tumors using Illumina BeadChip based DNA-methylation profiling (n=102/142). RESULTS: Preliminary 5y-OS- and EFS-estimates of this cohort are 20 ± 5% and 26 ± 5%. In a multivariate model, patients (a) below 1 year at diagnosis with (b) M+-disease, (c) synchronous tumours and (d) incomplete resection (no GTR) had the worst prognosis (p

Glycogen storage disease (GSD) 0a is a rare congenital metabolic disease with symptoms in infancy and childhood caused by biallelic GYS2 germline variants. A predisposition to cancer has not been described yet. We report here a boy with GSD 0a, who developed a malignant brain tumor at the age of 4.5 years. The tumor was classified as a group 3 medulloblastoma, and the patient died from cancer 27 months after initial tumor diagnosis. This case appears interesting as group 3 medulloblastoma is so far not known to arise in hereditary syndromes and the biology of sporadic group 3 medulloblastoma is largely unknown.

A retrospective analysis of data from the European Rhabdoid Registry (EU-RHAB) was performed to describe the outcome of children with atypical teratoid/rhabdoid tumors (AT/RT) who underwent high-dose chemotherapy (HDCT) with auto-SCT. Nineteen patients (male, n=15; median age at diagnosis 21 months) were identified. Nine patients presented with metastatic disease at diagnosis. A partial or subtotal resection was achieved in 11, a total resection in five and a biopsy in three patients. Patients received a median of six chemotherapy cycles prior to HDCT. Additional radiotherapy was performed in 14 patients (first-line, n=9; following progression, n=5). Six patients underwent tandem auto-SCT. Disease status before HDCT was CR in six, PR in eight, stable disease in two and progressive disease (PD) in two patients (data missing, n=1). With a median follow-up of 16 months, 14 patients progressed. Estimated progression-free and OS at 2 years were 29% (±11%) and 50% (±12%), respectively. At last follow-up, eight patients were alive (first CR, n=4; second CR, n=2; PR, n=1; PD, n=1). Eleven patients died of PD. Median time-to-progression was 14 months. Selected patients with AT/RT might benefit from HDCT with radiotherapy. The definitive impact of this treatment modality has to be evaluated prospectively in a randomized trial.

Heritable predisposition is an important cause of cancer in children and adolescents. Although a large number of cancer predisposition genes and their associated syndromes and malignancies have already been described, it appears likely that there are more pediatric cancer patients in whom heritable cancer predisposition syndromes have yet to be recognized. In a consensus meeting in the beginning of 2016, we convened experts in Human Genetics and Pediatric Hematology/Oncology to review the available data, to categorize the large amount of information, and to develop recommendations regarding when a cancer predisposition syndrome should be suspected in a young oncology patient. This review summarizes the current knowledge of cancer predisposition syndromes in pediatric oncology and provides essential information on clinical situations in which a childhood cancer predisposition syndrome should be suspected.

Hydroxyurea (HU) is approved in EU and USA for preventing vaso-occlusive crises (VOC) including acute chest syndromes (ACS) in adults, adolescents and children ≥2 years with sickle-cell disease (SCD). Further to the double blinded, randomized controlled Multicenter Study of Hydroxyurea administration (MSH) which provided the first data on clinical efficacy of HU (Charache 1995), a few follow-up studies suggested that long-term use of HU resulted in significant clinical benefit on patient outcome. This was reflected by lower mortality rates in HU-treated patients compared to conventionally treated patients (Steinberg 2003 & 2010, Voskaridou 2010, Lê 2015). Sustained hematological and clinical response after several years of follow-up at maximal tolerated dose was further shown in subsequent studies, especially the LaSHS study (Voskaridou 2010). Based on these data, the ESCORT-HU (European Sickle Cell Disease COhoRT - HydroxyUrea) study was launched aiming in the establishment of the safety and the sustainability of hematological and clinical benefits to HU administration in the prevention of sickle-cell vaso-occlusive crises in routine practice. We hereby present preliminary results from a large cohort of patients enrolled in the study between January 2009 and June 2017. 1920 patients were enrolled from 63 centers in France, Germany, Greece and Italy, For 147 of the 600 HU-naive patients (never treated with HU before enrolment) and started on HU for VOC or ACS, there was documented clinical outcome (number of VOC >48h and ACS episodes per year) over a 4-year follow-up period. These patients were selected for analysis to evaluate sustainability of clinical and hematological HU response in routine practice. Demographic data and Hb genotypes are displayed in table 1. The children group was mainly composed of βS/βS patients, while adults were mainly βS/βS and βS/β-thal patients. As shown in figure 1 and 2, there was a dramatic reduction in the number of VOC >48h and ACS episodes (-79%) from year 1 in adults and children, with results comparable to previous randomised clinical trials in adults (Charache et al., 1995) and children (Jain et al, 2012). Overall, the reduction in number of VOC (>48h) and ACS was stable over the 4 years of follow-up. This reduction is inversely proportional to the increase in HbF. There were however a moderate rebound in children from year 2 while adults remained stable. Similarly, there was reduction in the proportion of adults and children requiring transfusion (figure 3). The clinical benefit of HU was higher in severe forms of SCD, as displayed by the markedly reduced number of patients with ≥ 3 VOC episodes (>48h)/year at year 1 (figure 4). Hematological response to HU was evidenced as soon as year 1 with a marked increase in HbF% (+6-10) and were maintained over subsequent years of treatment (figure 1 and 2) as the dose of HU was further increased. While there was no striking differences in HbF% variation between age groups and genotypes, the requirement for increase in HU dose over the 4 years of follow-up was markedly higher in children, probably reflecting the different severity between the two population at entry (figure 5). The red cell red cell mean corpuscular volume (MCV) could be used as a measurement of compliance, showing differences between age group (figure 5). There was, as expected, an apparent negative correlation between induction of HbF synthesis and number of VOC >48h and ACS episodes at year 1, attesting to reduced effectiveness of treatment in some patients (figure 6). Improvement in blood parameters was accompanied by mild reduction of absolute neutrophil and platelet count although not to the point of myelosuppression (defined as ANC < 2 x 109/L), showing that MTD was not targeted in routine practice. Treatment-emergent adverse reactions occurring in the 147 patients of the cohort over the 4 years of follow-up were consistent with the known safety profile of hydroxyurea. The commonest effects included neutropenia and thrombocytopenia (25 events in 13 patients) and were easily manageable with temporary discontinuation of treatment. No tumorigenesis was reported. In conclusion, preliminary results from ESCORT-HU in 147 patients treated with HU showed sustained hematological and clinical response while MTD was not targeted, with differences between adults and children which may be attributed in part to reduced compliance in the latter group. Disclosures Voskaridou: Celgene Corp: Membership on an entity's Board of Directors or advisory committees, Research Funding; Acceleron: Membership on an entity's Board of Directors or advisory committees, Research Funding. Oevermann:Addmedica: Membership on an entity's Board of Directors or advisory committees. Thuret:Addmedica: Research Funding; bluebird bio: Research Funding; Novartis: Research Funding. Steschenko:Novartis: Membership on an entity's Board of Directors or advisory committees.

BACKGROUND Choroid plexus tumors are intraventricular neoplasms derived from the choroid plexus epithelium. A better knowledge of molecular factors involved in choroid plexus tumor biology may aid in identifying patients at risk for recurrence. METHODS Methylation profiles were examined in 29 choroid plexus papillomas (CPPs, WHO grade I), 32 atypical choroid plexus papillomas (aCPPs, WHO grade II), and 31 choroid plexus carcinomas (CPCs, WHO grade III) by Illumina Infinium HumanMethylation450 Bead Chip Array. RESULTS Unsupervised hierarchical clustering identified 3 subgroups: methylation cluster 1 (pediatric CPP and aCPP of mainly supratentorial location), methylation cluster 2 (adult CPP and aCPP of mainly infratentorial location), and methylation cluster 3 (pediatric CPP, aCPP, and CPC of supratentorial location). In methylation cluster 3, progression-free survival (PFS) accounted for a mean of 72 months (CI, 55-89 mo), whereas only 1 of 42 tumors of methylation clusters 1 and 2 progressed (P< .001). On stratification of outcome data according to WHO grade, all CPCs clustered within cluster 3 and were associated with shorter overall survival (mean, 105 mo [CI, 81-128 mo]) and PFS (mean, 55 mo [CI, 36-73 mo]). The aCPP of methylation cluster 3 also progressed frequently (mean, 69 mo [CI, 44-93 mo]), whereas no tumor progression was observed in aCPP of methylation clusters 1 and 2 (P< .05). Only 1 of 29 CPPs recurred. CONCLUSIONS Methylation profiling of choroid plexus tumors reveals 3 distinct subgroups (ie, pediatric low-risk choroid plexus tumors [cluster 1], adult low-risk choroid plexus tumors [cluster 2], and pediatric high-risk choroid plexus tumors [cluster 3]) and may provide useful prognostic information in addition to histopathology.

BACKGROUND: Choroid plexus tumors (CPTs) are rare pediatric tumors. They are classified by the World Health Organization as Choroid plexus papillomas (CPP), Atypical choroid plexus papillomas (APP) and Choroid plexus carcinomas (CPC). Current recommendations for the treatment of CPTs include surgical resection followed by adjuvant chemotherapy and or radiation therapy. The CPT-SIOP 2009 protocol compared four different chemotherapy treatment arms (standard arm A-Cyclophosphamide/VP16/VCR (CycEV) alternating with Carboplatin/VP16/VCR CarbEV) blocks, arm B-Doxorubicin/Cisplatinum/Actinomycin-D/VCR, arm C-high dose Methotrexate and arm D-Temozolomide/Irinotecan). The study closed due to insufficient enrollment of formally randomized patients. Our study reviews the patient data registry, which includes non-randomized patients. METHODS: Clinical course was evaluated amongst patients enrolled in the CPT-SIOP 2009 protocol. Data was obtained from international institutions including Australia, New Zealand, Germany, Lebanon, Turkey, Switzerland and USA. Qualitative parameters included age, sex, presenting symptoms and adjuvant therapy. Overall survival and event free survival were analyzed. RESULTS: We identified 27 cases with CPTs (APP 5, CPP 5, CPC 17), 9 females and 15 males, (2 unknown). The mean age at presentation was 7 years with a median age of 2.4 years (range 0.16 to 58 years). Twelve patients were treated under arm A, (1 B, 4 C, 1 D, 3 in observation and 6 unknown). 2y overall survival/2y EFS for n = 12 CPC patients on arm A was 78%/ 35% with a median follow up of 1.7 years, compared to 76%/ 63% for n = 41 CPC patients treated with non-alternating blocks of CarbEV or CycEV in the SIOP-CPT database. CONCLUSION: The outcome of alternating CarbEV/CycEV appears inferior to non-alternating cycles of either CarbEV or CycEV and is no longer recommended as a guidance in the SIOP-CPT registry. Our aim is to continue following these patients over time to monitor overall and event free survival.

Choroid plexus tumors (CPT) comprise choroid plexus papilloma (CPP, WHO grade I), atypical choroid plexus papilloma (aCPP, WHO grade II), and choroid plexus carcinoma (CPC, WHO grade III). CPT from 20 nations were prospectively recruited into the CPT-SIOP-2000 study (01/2000–03/2010, n=129, median follow-up 7.4 years) and the CPT-SIOP registry (04/2010-01/2018, n=119). Non-surgical risk-stratified treatment consisted of i) chemotherapy for all CPC, all metastatic CPT and incompletely resected aCPP regardless of metastases ii) focal radiotherapy in non-metastatic CPC >3y, iii) craniospinal radiotherapy in non-metastatic CPC >3y during the registry phase. Non-metastatic CPP and aCPP R0 were followed by surveillance. CPT-SIOP-2000 randomized six cycles of carboplatin/VP16/VCR vs. cyclophosphamide/VP16/VCR. Alternating combination of these cycles were given to registry patients with CPC (n=16). WHO grading was the most significant prognostic variable for OS and EFS in CPT patients, five-year OS/EFS accounting for 100/96% in CPP (n=84), 97/79% in aCPP (n=88) and 58/35% in CPC (n=76). Of note, 5y OS/EFS was 100/92% for aCPP patients 2y (n=22). CPCs opting for postop surveillance only progressed with dissemination. Carboplatin based chemotherapy trended superiorly. Clinical staging had minor impact on survival in the primary treatment groups. Radiotherapy for CPC without Li-Fraumeni syndrome had a survival advantage in the first five years of follow-up, craniospinal field did not improve survival for non-metastatic CPC. Delayed radiotherapy for young patients with CPC that progressed on chemotherapy achieved meaningful responses (n=8). In conclusion: adjuvant therapy improves outcome for high risk CPT.

Rhabdoid tumor predisposition syndrome is usually associated with shorter survival in patients with malignant rhabdoid tumors regardless of anatomical origin. Here we present four children harboring truncating heterozygous SMARCB1/INI1 germline mutations with favorable outcome. All four patients received multi-modality treatment, three according to therapeutic recommendations by the EU-RHAB registry, two without radiotherapy, and mean event-free survival accounts for 7 years. In conclusion, intensive treatment with curative intent is justified for children with rhabdoid tumors even if an underlying rhabdoid predisposition syndrome is demonstrated. Pediatr Blood Cancer 2014;61:919–921. © 2013 Wiley Periodicals, Inc.

Background Tumours of the central nervous system (CNS) are the most frequent solid tumours and the second most frequent type of cancer in children and adolescents. Overall survival has continuously improved in Germany, since an increasing number of patients have been treated according to standardised, multicentre, multimodal treatment recommendations, trials of the German Paediatric Brain Tumour Consortium (HIT-Network) or the International Society of Paediatric Oncology-Europe (SIOP-E) during the last decades. Today, two out of three patients survive. At least 8000 long-term childhood brain tumour survivors (CBTS) are currently living in Germany. They face lifelong disease- and treatment-related late effects (LE) and associated socioeconomic problems more than many other childhood cancer survivors (CCS). Method We review the LE and resulting special needs of this particular group of CCS. Results Despite their increasing relevance for future treatment optimisation, neither the diversity of chronic and cumulative LE nor their pertinent risk factors and subsequent impact on quality of survival have yet been comprehensively addressed for CBTS treated according to HIT- or SIOP-E-protocols. Evidence-based information to empower survivors and stakeholders, as well as medical expertise to manage their individual health care, psychosocial and educational/vocational needs must still be generated and established. Conclusion The establishment of a long-term research- and care network in Germany shall contribute to a European platform, that aims at optimising CBTSs' transition into adulthood as resilient individuals with high quality of survival including optimal levels of activity, participation and acceptance by society.

Summary. Three patients with myelofibrosis received allogeneic stem cell transplantation after a dose-reduced conditioning regimen of busulphan (8 mg/kg), fludarabine (180 mg/m2) and antithymocyte globulin (4 × 10 mg/kg). The median age at transplantation was 51 years (range 44–58). All patients engrafted with a leucocyte count > 1·0 × 109/l after a median of 18 d (range 16–20). Grade II acute skin graft-versus-host disease (GvHD) occurred in one patient. One limited and one extensive chronic GvHD was observed. All patients achieved complete haematological remission. In one patient the fibrosis resolved completely 180 d post transplant. All patients are alive 126, 466 and 764 d after transplantation.

ESCORT-HU (European Sickle Cell Disease (SCD) COhoRT - HydroxyUrea) is a multicenter prospective non interventional study implemented in Europe, following the European Medical Agency's request to collect more information focused on long-term safety profile of hydroxycarbamide (HU) in SCD patients treated with HU. Primary endpoint of the study is to determine the frequency of adverse events (AEs) under HU treatment Secondary endpoints include the efficacy of HU in labeled indications (prevention of vaso-occlusive complications and of acute thoracic syndrome), frequency of hospitalizations due to SCD events and frequency of blood transfusions. Data collection on the reason for HU initiation permitted to identify in-label (in the therapeutic indication of the European marketing authorization, group 1, G1) and off-label (other therapeutic indication, group 2, G2) prescriptions of HU. Frequency of AEs (including not related to SCD and infections) was compared between adults and children, both in G1 and G2, with focus on the following subclasses: blood and lymphatic system disorders, fever, gastrointestinal disorders, infection, nervous system disorders, skin and subcutaneous tissue disorders and others. As of 6th June 2016 (cut-off date), a cohort of 1047 sickle cell patients have been enrolled in 3 European countries (Greece, 11.4%, Germany, 13.4%, and France, 75.2%). Of the 1047 patients, 845 (80.7%) have an in-label prescription (478 adults and 367 children), 170 (16.2%) an off-label prescription (61 adults and 109 children), and 32 reported unknown or no indication (Table 1a). As usually observed in any disease, the off-label use is more frequent in children compared to adults (p=0.01). Main reasons for off-label prescription were anemia (31%) (n=9 in adults and n=44 in children), abnormal Transcranial Doppler (TCD) values/cerebral vasculopathy (15%) (n=2 in adults and n=24 in children) and sickle cell organopathy including renal impairment (15%) (n=14 in adults and n=12 in children) (Table 1b). These three indications follow recommendations issued by European clinicians and are in accordance with the last version of US guidelines (JAMA 2014). Mean HU daily doses at initiation were respectively 18 mg/kg (G1) and 17.3 mg/kg (G2) in children, and 16.2 mg/kg (G1) and 13.5 mg/kg (G2) in adults. Not SCD-related AEs were respectively reported in 25% and 27.6% of patients in G1 and G2 groups (Table 2a). Focusing on the number of not-SCD related AE reported in each group, 355 AE have been reported in 211 patients in G1 and 73 AE have been reported in 47 patients in G2. Within G1 group, more AEs were reported in adults (30.8%) vs. children (17.4%) (p < 0.01) (Table 2b) but not in G2 group (NS) (Table 2c). When compared by AE type in G1, significant differences appeared between children and adults for the following AE subclasses (p < 0.01): infections more frequent in children as usually observed, renal & urinary disorders, immune system disorders more common in adults. Regarding neoplasms benign, immune system disorders, no malignancy has been reported, but mainly cysts (1 ovary, 2 breast), 1 renal tumor and 1 cutaneous lesion (histological types not provided), 1 other (location not reported) (Table 3). All AEs were more frequent in adults except infections. In conclusion, the current ESCORT-HU data confirm the more frequent off-label use of HU in children, a similar frequency of patients reporting not SCD-related AE between the in-label and off-label groups despite a higher number of AE reported in the in-label group, and a significant difference between children and adults in frequency of AEs in the in-label group. Disclosures De Montalembert: Addmedica: Research Funding; Novartis: Research Funding, Speakers Bureau. Ribeil:Bluebirdbio: Consultancy; Addmedica: Research Funding.

Background. The TWiTCH multicentre randomised phase III trial showed recently non inferiority of hydroxyurea (HU) with phlebotomy versus transfusions with chelation for primary stroke prevention and management of iron overload in children with sickle cell anemia, having had abnormal transcranial Doppler but no severe vasculopathy and after at least one year of transfusion. Importantly, children in the HU arm received the drug at the maximum tolerated dose (MTD) with escalation of dosage until absolute neutrophil count (ANC) is Methods. We extracted data from the ESCORT-HU cohort, which is non-interventional, prospective, observational open-label study on the efficacy and safety of Siklos. The cut-off date was set as February 5th, 2016. Out of the global cohort of 992 patients, 386 patients were aged 2 to 18 years at the time of study initiation. Among them, 233 patients were HU treatment-naïve and initiated Siklos® treatment. A follow-up of at least 12 months and data allowing biological or clinical efficacy evaluations were available in a subgroup of 139 "naïve" (= not previously treated with HU) patients. Our objectives were 1) to collect the dosages of HU and to compare HbF% and ANC before and 12 months after initiation of Siklos® in the subgroup of naïve patients (table 1); 2) to assess the efficacy of HU in this cohort. We compared using Mac-Nemar paired t-test and Wilcoxon sign rank-test in the 12 months period before treatment and 12 months after initiation of treatment i) painful crises >48 hours, ii) acute chest syndromes (ACS), iii) hospitalizations, and iv) blood transfusion (% of patients having had at least 1 event and the total numbers of events); 3) to assess in the total cohort of 386 children the % of children with ANC count within the ranges recommended in the TWiTCH trial, underlining those treated with HU for cerebral vasculopathy (table 2). Results 1) HbF% and ANC in the subgroup of 139 children not previously treated with HU (table 1) 46.8% were males; mean age was 8.1 ± 3.9 years. Genotypes were HbSS, HbSC, HbSb0thalassemia, HbSb+ thalassemia, and unknown in respectively 86.5%, 1.4%, 7.8%, 2.1% and 2.1% of cases. 2) Efficacy data in this subgroup The % of patients having had at least 1 episode and the total numbers of painful crises > 48 hours, ACS, hospitalizations, and blood transfusion in the 12 months, decreased significantly under HU (P 3) ANC in the total cohort of children from ESCORT-HU cohort (table 2) The total cohort enrolled 386 children, 51.1 % were males, and mean age was 9.65 ± 4.26 years. Genotypes were HbSS, HbSC, HbSb0thalassemia, HbSb+ thalassemia, and unknown in respectively 89.1%, 2%, 4.7%, 2%, and 2.2% of cases. Only 159 patients had one HbF% determination 12 months after inclusion. Out of these, 138 (86.79%) had ANC > 3.0 x109/L, their mean HbF was 13.04 ± 8.6 %; 21 (13.20%) had ANC < 3.0 x109/L, their mean HbF was 21.02 ± 9.64 %. In conclusion We show that children included in the ESCORT-cohort received median HU dosage quite lower than the one given to children included in the TWiTCH trial which resulted in quite lower HbF %. This dosage was sufficient to very dramatically reduce SCD-related painful events. Whether it can exert the same brain protection as the one demonstrated in the TWiTCH study is so far not known. We encourage physicians to reach MTD when the indication for HU is brain protection. Disclosures De Montalembert: Addmedica: Research Funding; Novartis: Research Funding, Speakers Bureau.

Three studies using multiple modalities in treating germ cell tumors are compared. The evolution of a more prominent role for chemotherapy is demonstrated for a subgroup of this heterogenous group of tumors. This includes nongerminomatous germ cell tumors as well as pure germinomas.

We studied a patient with mild beta-thalassaemia major under treatment with the oral chelator deferiprone (DFP or L1) for about 10 yr (L1 veteran). Due to poor compliance with desferrioxamine, the patient started compassionate use of DFP at an age of 23 yr with a serum ferritin of 5200 microg/L. Monitoring iron overload by SQUID biosusceptometry revealed a dramatic decrease of liver iron concentrations from 4500 to 950 microg/g(liver) within 9.5 yr. A good clinical response to chelation treatment with DFP was observed together with an improvement of liver and cardiac function and a reduction in the hepatitis virus load.

Little is known about pediatric spinal cord high grade gliomas (SCHGG) beyond their dismal prognosis. Here, we analyzed the HIT-GBM® database for the influence of surgical resection on survival. Between 1991 and 2010 the HIT-GBM group collected data from European children diagnosed with high grade glioma. Patients with the following inclusion criteria were analyzed in this study: astrocytic histology, WHO grade III or IV, age at diagnosis

Choroid plexus tumors are rare intraventricular neoplasms occurring predominantly in children. The group of choroid plexus tumors is made up of choroid plexus papillomas (WHO grade I), atypical choroid plexus papillomas (WHO grade II) and choroid plexus carcinomas (WHO grade III). While choroid plexus papillomas usually have an excellent clinical prognosis, children with choroid plexus carcinomas face five year survival rates between 27 and 46 % [1]. Chromosomal aberrations in choroid plexus carcinomas are complex [2], but little is known about epigenetic alterations and their potential prognostic value. Methylation upstream of the transcription start site (UTSS) of the human telomerase reverse transcriptase (hTERT) promoter is a frequent event in pediatric brain tumors [3]. However, in choroid plexus tumors only limited data regarding the methylation status of the hTERT promoter is available, and its prognostic role has not yet been evaluated. We therefore aimed to examine the frequency and prognostic impact of hTERT promoter methylation status in a large series of choroid plexus tumors. Formalin-fixed paraffin-embedded tissue samples of 99 choroid plexus tumors (36 choroid plexus papillomas, 26 atypical choroid plexus papillomas and 37 choroid plexus carcinomas) were collected from the archives of the Institute of Neuropathology Munster and from institutions that had previously submitted cases for reference in context of the CPT-SIOP studies. All samples were reviewed neuropathologically according to current WHO criteria. Followup data was collected from the CPT-SIOP database (available for 20 choroid plexus papillomas, 17 atypical choroid plexus papillomas and 33 choroid plexus carcinomas). Permission for collection and scientific use of all tumor samples was obtained from the local ethical committee (Munster 2007-420-f-S). After isolation of genomic DNA using the Maxwell LEV FFPE Tissue DNA Purification Kit (Promega, Mannheim, Germany), bisulfite conversion was performed (EZ DNA Methylation-Gold-Kit, Zymo Research, Orange, CA). DNA was then subjected to methylation specific PCR, using specifically designed primers interrogating four UTSS CpG sites of the hTERT promoter described to be clinically relevant in other pediatric brain tumors [3] (FWD-primer for both methylated and unmethylated: 50-GGGAAGTGTTGTAGGGAGGTATTT; REV-primer for methylated: 50-CGTACGACGACCCTTTAACCG; REV-primer for unmethylated: 50CATACAACAACCCTTTAACCA). This approach allows for distinction of tumors with no methylation of the four interrogated CpG sites versus those tumors with methylation of all of these CpG sites. PCR-products were visualized using the Agilent 2200 TapeStation (Agilent Technologies, Santa Clara, CA, USA). Methylation of the hTERT promoter was found in 47/99 choroid plexus tumors (47 %, see Online Resource 1). As Electronic supplementary material The online version of this article (doi:10.1007/s11060-014-1473-7) contains supplementary material, which is available to authorized users.

SummaryInhibitor development is a rare but serious event in hemophilia B patients. Management is hampered by the frequent occurrence of allergic reactions to factor IX, low success rates of current inhibitor elimination protocols and the risk of development of nephrotic syndrome. Single cases of immune tolerance induction (ITI) including immunosuppressive agents like mycophenolat mofetil (MMF) or rituximab have been reported. We present a case of successful inhibitor elimination with a combined immune-modulating therapy and high-dose factor IX (FIX). This boy had developed a FIX inhibitor at the age of 5 years and had a history of allergic reactions to FIX and to FEIBA→. Under on-demand treatment with recombinant activated FVII the inhibitor became undetectable but the boy suffered from multiple joint and muscle bleeds. At the age of 11.5 years ITI was attempted with a combination of rituximab, MMF, dexamethasone, intravenous immunoglobulins and high-dose FIX. The inhibitor did not reappear and FIX half-life normalized. No allergic reaction, no signs of nephrotic syndrome and no serious infections were observed.

Successful donor-lymphocyte infusion for extreme immune-hemolysis following unrelated BMT in a patient with X-linked chronic granulomatous disease and McLeod phenotype

SUMMARY: In patients with pathologically altered erythrocytes, red blood cell exchange is a very efficient therapeutic measure without important side effects. With increasing migration more patients with e.g. severe malaria or sickle cell anemia have to be treated. In minor or bidirectional ABO-mismatched stem cell transplantations after reduced intensity conditioning, hemolysis can be prevented by prophylactic erythrocytapheresis. Other rare indications for red blood cell exchange are advanced erythropoietic protoporphyria and babesiosis. Sickle cell anemia can be treated with hydroxyurea. Transfusions are administered when necessary, but this results in iron overload in the long term. An expensive but safe and very efficient treatment alternative is red blood cell exchange. In cases with stroke, acute chest syndrome and other severe complications, erythrocytapheresis reproducibly breaks the vicious circle of sickling and increasing oxygen deficiency. At the same time one can aim at an exact end hematocrit. In severe malaria, erythrocytapheresis both reduces parasite load to the designated extent and reconstitutes reduced oxygen transport capacity without serious adverse effects. Here we describe our experience of erythrocytapheresis in long-term prophylaxis of complications in sickle cell anemia and sickle cell thalassemia patients. The documentation of improved iron balance was carried out by liver susceptometry.

BACKGROUND. Ovarian small cell carcinoma of the hypercalcemic type is a rare neoplasm that is associated with a poor prognosis. The objective of the current study was to investigate the clinicopathologic features of this tumor and to develop preliminary diagnostic and therapeutic guidelines. METHODS. Between 1994 and 2005, 11 girls (ages 9–22 years) who were registered on the German Maligne Keimzelltumoren studies and the Kiel Pediatric Tumor Registry were analyzed. Prior to histopathologic review, 8 patients had been misdiagnosed with either germ cell tumor or juvenile granulosa cell tumor. RESULTS. According to the International Federation of Gynecologic Oncology, 4 patients had Stage IA disease, 3 patients had Stage IC disease, and 4 patients had Stage III disease. After resection, 4 patients were followed without additional therapy, and all 4 patients developed recurrent disease after 3 to 11 months. Seven patients received adjuvant chemotherapy during first-line treatment. One patient with Stage III disease received additional regional deep hyperthermia. During first-line treatment, high-dose chemotherapy was received by 4 patients who achieved a complete response (CR) after conventional chemotherapy. All 4 of those patients remained in CR for 7 to 73 months, whereas the other 3 patients developed recurrent disease. Salvage treatment after recurrence or tumor progression consisted of surgery and chemotherapy. One patient received high-dose chemotherapy in 2nd CR and remained in 2nd CR. In total, 5 patients remained alive with no evidence of disease. CONCLUSIONS. Patients with ovarian small cell carcinoma of the hypercalcemic type require multiagent chemotherapy during first-line treatment. High-dose chemotherapy may be used to consolidate the therapeutic success. Cancer 2006. © 2006 American Cancer Society.

Abstract 4680 One of the most common human chromosomal abnormalities, Down syndrome, is caused by trisomy 21. Transient myeloproloferative disorders (TMD) occur in 10-20 % of newborns with Down syndrome. About 30 % of those TMD patients develop Acute Megakaryoblastic Leukemia (AMKL) within 4 years. Therefore both disorders have their origin in the fetus. There is emerging evidence that the protein product of GATA1 mutations, GATA1s, directly contributes to leukemogenesis. Although an in utero origin of GATA1 mutations and consecutively TMD is established it was never analyzed if GATA1 mutations could be detected in maternal PBL collected before and after the delivery of a child with Down syndrome and TMD. We therefore initiated a study to detect mutant GATA1 in three pairs of mother and child (A, B, C). After the identification of the specific GATA1 mutations of the newborn with TMD, PBL samples of the mothers drawn 4 days after delivery (mother A), 7 days after delivery (mother B) and 4 week before as well as just before sectio cesarea ( mother C) were analyzed. Results All 3 patients had duplications in exon 2. Patient A had a duplication of 191 bp including the start codon,, patient B showed a duplication of 2 bp, and patient C had a duplication of 13 bp, respectively. The three mothers harbored the TMD specific GATA1 mutations in PBL analyzed around the birth of their children. The GATA1s signal in mother A and B had disappeared 1 month after birth. No analysis at this time point was done in mother C,whereas she was positive for the specific GATA1 mutation one month before delivery. At that time TMD was suggested by ultrasound which revealed clinical signs of hydrops in the fetus. In mother B and C the particular GATA1 mutations could also be detected in their plasma, in the plasma sample of mother C even 4 weeks before delivery (not done in mother A). Conclusion In our study we could show for the first time that GATA1 mutations of leukemic cells could be detected in PBL of the mothers around birth. Cell free GATA1 DNA was also detectable. The prenatal finding of TMD specific mutations in the mothers' blood suggests that feto-maternal transfer of leukemic cells and DNA may already occur up to 4 weeks before delivery. Disclosures: No relevant conflicts of interest to declare.

10535Background: In preclinical pediatric cancer models, the HDAC inhibitor vorinostat showed significant activity only at higher concentrations compared with those achieved with currently recommen...