Search

Metastasis is the leading cause of death in breast cancer patients. Osthole, as an active compound detected in the traditional Chinese medicine Wenshen Zhuanggu Formula, has shown a promising anti-metastatic activity in human breast cancer cells, but the underlying mechanisms remain ambiguous. In this study we elucidated the anti-metastatic mechanisms of osthole in highly metastatic breast cancer cells and a zebrafish xenograft model. We showed that the expression of integrin α3 (ITGα3) and integrin β5 (ITGβ5) was upregulated in highly metastatic MDA-MB-231, MDA-MB-231BO breast cancer cell lines but was downregulated in poorly metastatic MCF-7 breast cancer cell line, which might be the key targets of osthole's anti-metastatic action. Furthermore, we showed that knockdown of ITGα3 and ITGβ5 attenuated breast cancer cell migration and invasion possibly via suppression of FAK/Src/Rac1 pathway, whereas overexpression of ITGα3 and ITGβ5 caused the opposite effects. Consistently, osthole significantly inhibited breast cancer metastasis by downregulating ITGα3/ITGβ5 signaling in vitro and in vivo. These results provide new evidence that osthole may be developed as a candidate therapeutic drug for metastatic breast cancer.

AIM: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). METHODS: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. RESULTS: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. CONCLUSION: A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

Past suicide attempts (SA) are a major contributor to suicide. The prevalence of SA in pregnant and postpartum women varied significantly across studies. Therefore, this meta-analysis was conducted to examine the prevalence of SA and its mediating factors in this population. Relevant articles published in PubMed, EMBASE, Web of Science, PsycINFO, Medline complete, Chinese National Knowledge Infrastructure database (CNKI), Chinese Wanfang and Chongqing VIP database were systematically searched from inception to March 28, 2019. Titles, abstracts and full texts were reviewed independently by three researchers. Studies were included if they reported data on SA prevalence or provided relevant data that enabled the calculation of SA prevalence. Data were extracted by two researchers and checked by one senior researcher. The random-effects model was used to analyze data by the CMA 2.0 and Stata 12.0, with the high degree of statistical heterogeneity present. The primary outcomes were prevalence of SA with 95% CI during pregnancy and during the first-year postpartum. Fourteen studies covering 6,406,245 pregnant and postpartum women were included. The pooled prevalence of SA was 680 per 100,000 (95% confidence interval 0.10–4.69%) during pregnancy and 210 per 100,000 (95% confidence interval 0.01–3.21%) during the first-year postpartum. Data source was significantly associated with prevalence of SA in the subgroup analysis (pregnancy, p

BACKGROUND Active bleeding due to arterial injury following the acupuncture can sometimes represent a life-threatening complication. Only few reports of an actively bleeding hematoma diagnosed by contrast-enhanced ultrasound, which enables the depiction of vascular, have been reported. CASE SUMMARY Here, we report the case of a 75-year-old woman, who presented with sudden swelling, ecchymosis, and pain in the upper left limb. She underwent an acupuncture treatment of traditional Chinese medicine followed by a deep shoulder massage 2 d before admission to hospital. A few hours after the massage, her left upper arm was red, swollen and progressively aggravated. Ultrasonography showed a large hematoma (11.2 cm × 3.5 cm × 3.4 cm) beside the left brachial artery. Color Doppler ultrasound revealed that blood flow signals of the arteries branched into the hematoma. The contrast-enhanced ultrasound showed microbubbles from the brachial artery passing into the hematoma, diffused within the hematoma with the local surge of red blood cells, and disappearing after approximately 17 s. The microbubbles were likely due to bleeding from the arteries. After pressure bandaging treatment, the hematoma became smaller (3.1 cm × 1.7 cm) and organized according to ultrasonography performed 20 d later. CONCLUSION This case highlights the ultimate importance of contrast-enhanced ultrasound for the diagnosis of an actively bleeding hematoma.

The study aimed for unraveling the long-term health impact of cumulative radiation exposure from full-spine radiographs on children/adolescents with scoliosis. All cohort, case–control or cross-sectional studies about radiation exposure to scoliosis patients with follow-up period as 20 years or more were included. Meta-analyses were performed for outcomes reported in two or more studies. A total of 9 eligible studies involving 35,641 participants between 1912 and 1990 fulfilled the inclusion criteria, including 18,873 patients with scoliosis and 16,768 controls as regional matched general population. The average number of full-spine radiographs was 23.13 (range: 0–618) according to 14,512 patients between 1912 and 1990 in five studies. The estimated mean cumulated radiation dose of breast was 11.35 cGy. In comparison with controls, pooled incidence rates of cancer, breast cancer and cancer mortality of patients with scoliosis were statistically significant higher [rate of cancer, odds risk (OR) = 1.46, p

To assess the long-term cost effectiveness of dapagliflozin (DAPA) and saxagliptin (SAXA) separately or together in patients with type 2 diabetes mellitus (T2DM) inadequately controlled by metformin (MET). Five head-to-head randomised controlled trials of the efficacy of DAPA and SAXA in type 2 diabetes mellitus (T2DM) patients were found by searching PubMed, Embase and Cochrane from inception to October 2019. The lifetime disease progression and long-term effectiveness of therapy in patients were projected by the United Kingdom Prospective Diabetes Study Outcome Model 2 (UKPDS OM2) in three T2DM therapeutic groups: DAPA + SAXA, DAPA and SAXA. Each group used DAPA and/or SAXA as an add-on therapy to MET. The study took the perspective of Chinese healthcare service providers. Univariate, scenario and probabilistic sensitivity analyses were performed. The quality-adjusted life-years (QALYs) value of the DAPA + SAXA, SAXA and DAPA groups were 11.28, 11.26 and 11.45 years, respectively. The total costs were US$27,954.84, US$23,254.46 and US$25,608.49, respectively. DAPA was dominant over DAPA + SAXA. The DAPA + SAXA group presented an estimated QALY gain of 0.02 and a total cost increase of US$4700.39 over the SAXA group, with an incremental cost of US$217,530.10 per QALY. Compared with the SAXA group, the DAPA group had a QALY gain of 0.19 years and a total cost increase of US$2354.04, for an incremental cost of US$12,191.97 per QALY. The pharmacoeconomic results were robust to univariate, scenario and probabilistic sensitivity analyses. Compared with DAPA + SAXA or SAXA, DAPA appears to be a cost-effective therapy as add-on to MET for Chinese patients whose T2DM is insufficiently controlled by MET.

Purpose Considering the difficulty of obtaining adequate biological tissue in clinical practice, we established an animal model of cytomegalovirus (CMV) keratouveitis in rats and investigated the viral infection sites and corresponding imaging and histopathological features. Methods Subconjunctival injection and topical use of dexamethasone were used to induce ocular immunosuppression in rats followed by intracameral inoculation of murine cytomegalovirus (MCMV). The clinical manifestations, intraocular pressure (IOP) and imaging changes were observed. Infected eyes were further examined by immunofluorescence, light microscopy, and electron microscopy. MCMV RNA was detected by reverse transcription-polymerase chain reaction. Results Typical keratouveitis occurred in the experimental rats and was characterized by corneal edema, keratic precipitates, and iridocyclitis with increased IOP. Corneal endothelial lesions displayed as "black holes," enlarged intercellular gaps, and high-intensity cellular infiltration by confocal microscopy, consistent with the pathological changes of "ballooning degeneration," endothelial cell detachment, and inflammatory cell infiltration. Mitochondrial edema was the most prominent organelle lesion in endothelial cells. Trabeculitis, mechanical obstruction of Schlemm's canal, and anterior chamber angle stenosis accounted for elevated IOP. Inflammation of the iris and ciliary body tended to transform into a chronic form. Immunofluorescence revealed that corneal endothelial cells, iris cells, trabecular meshwork cells, and monocytes could be infected by MCMV. MCMV RNA was found in the anterior segments after infection. Conclusions CMV can widely infect anterior segment tissue, including the corneal endothelium, iris, and trabecular meshwork, in vivo, inducing the corresponding clinical manifestations. Corneal endotheliitis and hypertensive anterior uveitis could be the specific stage of anterior segment infection of CMV.

BACKGROUND Wilson disease (WD) is a genetic disorder of hepatic copper excretion, leading to copper accumulation in various tissues. The manifestations are quite variable, and hemolytic anemia is the most common hematological presentation. WD associated with thrombocytopenia is very rare. CASE SUMMARY We report the case of an 11-year-old Chinese girl with WD that was associated with immune thrombocytopenia (ITP). Thrombocytopenia was the initial chief complaint for her to visit a hematologist, and ITP was diagnosed based on the results of a bone marrow biopsy and positive antiplatelet autoantibodies. About two weeks before the thrombocytopenia was found, the patient developed drooling. Tremors developed in her right hand about one week after being diagnosed with ITP, after which she was admitted to our hospital. Further evaluations were performed. Ceruloplasmin was decreased, with an increased level of copper in her 24-h urine excretion. Kayser Fleischer's ring (K-F ring) was positive. The ultrasound showed liver cirrhosis, and brain magnetic resonance imaging showed that the lenticular nucleus, caudate nucleus, and brainstem presented a low signal intensity in T1-weighted images and high signal intensity in T2-weighted images. WD was diagnosed and a genetic analysis was performed. A compound heterozygous mutation in ATP7B was detected; c.2333G>T (p.Arg778Leu) in exon 8 and c.3809A>G (p.Asn1270Ser) in exon 18. The former was inherited from her father and the latter from her mother. However, her parents showed normal liver function and negative K-F rings. Such a compound mutation in a case of WD associated with ITP in children has not been published previously. CONCLUSION WD can associate with thrombocytopenia but the mechanism is still unclear. We recommend that antiplatelet autoantibodies should be tested in WD patients with thrombocytopenia in future to verify the association.

Background: Olaparib, a potent oral poly (ADP-ribose) polymerase inhibitor, exhibits antitumor activity and prevents the recurrence in advanced ovarian cancer. In this article, we assessed the efficacy and safety of olaparib maintenance therapy on platinum-sensitive ovarian cancer patients with BRCA mutations through a meta-analysis of available randomized controlled trials (RCTs) to provide more evidence for its clinical applications. Methods: We searched PubMed, Embase, Wanfang, CNKI, Web of Science, Cochrane Library, and VIP databases from 1 August 2018 to identify RCTs and finally included four RCTs (seven articles) with 567 eligible participants beyond the participants, interventions, comparisons, outcomes, and study design regulation. The outcomes of olaparib efficacy including progression-free survival (PFS) and overall survival (OS) were measured by HR and 95% CI, while the quality of life was evaluated by calculating the combination of P-value. Seven common adverse events were tested by risk ratio and 95% CI as the outcomes of olaparib safety. These data were analyzed, and the forest figures were produced using Review Manager 5.3. Results: Compared with other interventions (ie, placebo or chemotherapy drugs), olaparib significantly prolonged PFS (HR=0.31, 95% CI=0.15-0.62) and slightly improved OS (HR=0.75, 95% CI=0.56-0.99), but did not influence the quality of life (P=0.058) in the patients with platinum-sensitive BRCA-mutated ovarian cancer. Additionally, the toxicity profile of olaparib involved anemia, fatigue, vomiting, diarrhea, and nausea with grade 1-2. Conclusion: This meta-analysis suggests that olaparib maintenance therapy is effective and well-tolerated for the patients with platinum-sensitive BRCA-mutated ovarian cancer. More updated RCTs and long-term follow-up should be conducted to compare and analyze the efficacy and toxicity of olaparib at different doses in ovarian cancer patients.

Objective Identification of the risk factors for extraordinary hidden blood loss (HBL) could clarify the underlying causes and provide more appropriate management. This study aims to identify the predictors of HBL in spinal surgery.Methods Medical records were retrospectively retrieved to collect the data of patients who undergoing posterior thoracic and lumbar fusion surgery or scoliosis surgery. Demographic information, perioperative visible blood loss volume, as well as laboratory results were recorded. The patients receiving fusion surgery or scoliosis surgery were further divided into the HBL positive subgroup and the HBL negative subgroup. Differences in the variables between the groups were then analyzed. Binary logistic regression analysis was performed to determine independent risk factors associated with HBL.Results For patients undergoing posterior spinal surgery, the independent risk factors associated with HBL were autologous transfusion (for fusion surgery P=0.011, OR: 2.627, 95%CI: 1.574-2.782; for scoliosis surgery P

All-inorganic CsPbX3 (X = Cl, Br, and I) perovskite quantum dots have great potential in the field of white light emission owing to their excellent optical properties. However, to date the research on white light based on perovskite quantum dots has focused on downconversion luminescence, while the up-conversion luminescence properties of quantum dots have received less attention due to lacking the anti-Stokes luminescence properties of the material itself, resulting in limitations in upconversion white light emission to some extent. In this paper, upconversion lanthanide ion-doped fluoride nanoparticles and perovskite quantum dots are combined; the luminescence of the quantum dots is excited successfully by the upconversion luminescence of the nanoparticles and then composite samples with white emission are obtained with regulators of concentration.

Chronic graft-versus-host disease (cGVHD) remains a common threat after allogeneic hematopoietic cell transplantation (allo-HSCT), and ocular manifestations occur in up to 60% to 90% of cGVHD patients. We sought to reveal major metabolic dysregulation and to determine tear metabolites as potential biomarkers for ocular cGVHD. Twenty-three ocular cGVHD and 16 control tear samples were collected for this study. Differential metabolites were identified using a liquid chromatography-mass spectrometry system. Spearman's test was used to analyze the correlation between metabolites and ophthalmic indexes (National Institutes of Health [NIH] eye score, fluorescein tear film break-up time [T-BUT], corneal fluorescein staining [CFS], and Schirmer's test). Receiver operating characteristic (ROC) curve was analyzed to evaluate the prediction potential of identified metabolites for ocular cGVHD. Differential metabolites were mainly observed in lipid metabolites, and we highlighted the lipid dysregulation in glycerophospholipid metabolism, sphingolipid metabolism, and biosynthesis of unsaturated fatty acids. In glycerophospholipid metabolism, phosphatidylcholine (34:1) (PC [34:1]) exhibited the strongest correlation with NIH eye score (r = 0.80), T-BUT (r = 0.79), CFS (r = 0.77), and Schirmer's test (r = 0.69). In sphingolipid metabolism, sphingomyelin (SM) was the most consistent with T-BUT (r = 0.74) and CFS (r = 0.71), whereas lactosylceramide (LacCer) was the most consistent with NIH eye score (r = 0.76) and Schirmer's test (r = 0.64). In biosynthesis of unsaturated fatty acids, docosahexaenoic acid (DHA) had the highest correlation with NIH eye score (r = 0.73), T-BUT (r = 0.60), CFS (r = 0.67) and Schirmer's test (r = 0.67) (P.0001 for all). ROC analysis revealed that area under the curve (AUC) values for PC (34:1) (AUC = 0.967), LacCer (AUC = 0.946), SM (AUC = 0.932), and DHA (AUC = 0.929) were significantly correlated with cGVHD (P.0001 for all). Our study identified PC (34:1), SM, LacCer, and DHA as promising tear biomarkers to indicate metabolic dysregulation and ophthalmic manifestations in ocular cGVHD.

Background Premature ovarian insufficiency (POI) is an ovarian dysfunction that seriously affects a woman’s physiological health and reproduction. Mesenchymal stem cell (MSC) transplantation offers a promising treatment option for ovarian restoration in rodent POI models. However, the efficacy and mechanism of it remain unclear. Methods POI mice model was generated by cyclophosphamide and busulfan, followed with the treatment of tail-vein injection of the human umbilical cord mesenchymal stem cells (hUCMSCs). Maternal physiological changes and offspring behavior were detected. To reveal the pathogenesis and therapeutic mechanisms of POI, we first compared the metabolite profiles of healthy and POI ovarian tissues using untargeted metabolomics analyses. After stem cell therapy, we then collected the ovaries from control, POI, and hUCMSC-treated POI groups for lipid metabolomics and pseudotargeted metabolomics analysis. Results Our results revealed remarkable changes of multiple metabolites, especially lipids, in ovarian tissues after POI generation. Following the transplantation of clinical-grade hUCMSCs, POI mice exhibited significant improvements in body weight, sex hormone levels, estrous cycles, and reproductive capacity. Lipid metabolomics and pseudotargeted metabolomics analyses for the ovaries showed that the metabolite levels in the POI group, mainly lipids, glycerophospholipids, steroids, and amino acids changed significantly compared with the controls’, and most of them returned to near-healthy levels after receiving hUCMSC treatment. Meanwhile, we also observed an increase of monosaccharide levels in the ovaries from POI mice and a decrease after stem cell treatment. Conclusions hUCMSCs restore ovarian function through activating the PI3K pathway by promoting the level of free amino acids, consequently improving lipid metabolism and reducing the concentration of monosaccharides. These findings provide potential targets for the clinical diagnosis and treatment of POI.

Recently, bio-drying was highlighted in the drying pretreatment of high-moisture organic wastes for their energy recovery. In this study, to investigate the influences of thermal assistance on microbial stimulation and energy utilization in organic degradation, thermally assisted bio-drying (TB) was conducted on food waste (FW) and was compared with conventional bio-drying (CB) and thermal drying (TD). As expected, more water was removed in TB, which exhibited no lag phenomenon and intensified microbial activity. Corresponding with the stimulated enzyme activity, more readily degradable carbohydrates, lipids and lignocellulose were decomposed in TB than those in CB, and lipid degradation generated a significant proportion of the total bio-heat generated (43.13%–45.83%). Furthermore, according to the microbial analysis (qPCR and 16S rRNA gene sequencing), Bacillus was found to be the dominant genus involved in the degradation of organics during TB and CB. In the initial phase, rather than Weissella, as in CB, Ureibacillus was notable in TB for the degradation of readily degradable substrates. In the late phase, Pseudoxanthomonas and Saccharomonospora were enriched for degrading lignocellulose. In addition, heat balance and life-cycle energy assessment demonstrated that a small amount of thermal heat (11.96%) upgraded bio-drying with high energy efficiency. Compared with the CB and TD processes, the TB trial consumed less thermal energy (0.58 MJ/kg H2O) and achieved a higher energy output/input ratio (3.64). This research suggests that thermal assistance is a promising approach to enhancing FW bio-drying, which exhibits efficient drying performance and great potential for energy recovery.

Three-dimensional printing (3DP) has attracted significant attention for its use in additive manufacturing techniques because it provides customizability and flexibility for fabricating structures with arbitrary shapes. Certain applications in the food and medicine industries require 3D printable materials that are both biocompatible and biodegradable. Consequently, this study reports 3D printable materials constructed from food-grade high internal phase emulsions (HIPEs). The studied HIPEs (phase ratio 85%) were stabilized by the efficient adsorption behavior of cod proteins (concentration range, 10-50 mg mL

Several studies have reported a link between lipid disorders and suicidality. However, few studies have investigated the relationship between suicidal behavior and blood lipid profiles in patients with first-episode and drug-naive (FEDN) major depressive disorder (MDD). The main purpose of this study was to examine the relationship between plasma lipid profiles and suicide attempts in a large sample of FEDN MDD patients in the Chinese Han population, which has not been reported. A total of 1,718 MDD outpatients were recruited. Their clinical and demographic data as well as plasma lipid parameters were collected. We obtained suicide attempt data through interviews with patients and their family members. We rated the Hamilton Depression Scale (HAMD) and Hamilton Anxiety Scale (HAMA) for all patients. The suicide attempt rate of MDD patients was 20.14%, of which 13.68% in the last month and 6.46% in the past. Further, compared with non-attempters, suicide attempters had significantly higher total levels of cholesterol (TC) and low-density lipoprotein cholesterol (LDL-c), higher HAMA and HAMD scores, but significantly lower high-density lipoprotein cholesterol (HDL-c) levels. Logistic regression analysis showed that suicide attempts were correlated with higher TC, lower HDL-c, and higher HAMA and HAMD scores with the adjusted odds ratio (OR) of 1.35, 0.52,1.28, and 1.08, respectively (all p < 0.05). Our findings suggest that FEDN patients with MDD have a high rate of attempted suicide. In the early stage of MDD patients, certain blood lipid parameters and more severe symptoms of anxiety and depression are correlated with suicide attempts. However, due to the cross-sectional design of this study, it is impossible to draw a causal relationship between lipid profiles and suicide attempts. Moreover, an inverse correlation can also be considered, that is, high cholesterol may be the consequence of suicide attempts and depression.

Background Sleep disturbance is common in perinatal and postnatal women, but the epidemiology of sleep problems is highly variable in these populations. This was a meta-analysis that examined the prevalence of poor sleep quality and its correlates among perinatal and postnatal women. Methods A systematic search of both international and Chinese databases (PubMed, EMBASE, PsycINFO, Web of Science, CNKI, and Wangfang) was performed. Studies with data on sleep quality measured by the Pittsburgh Sleep Quality Index (PSQI) were included. Results Forty-two studies were included for analyses. The prevalence of poor sleep quality was 54.2% (95% CI: 47.9-60.5%) in perinatal and postnatal women, with 44.5% (95% CI: 37.6-51.6%) in perinatal women and 67.2% (95% CI: 57.6-75.5%) in postnatal women. The pooled total PSQI score was 7.54 ± 0.40 (95% CI: 6.75-8.33), while the average PSQI component scores varied from 0.13 ± 0.04 for use of sleeping medication to 1.51 ± 0.17 for habitual sleep efficiency. Maternal age, study site, survey year, comorbidity, PSQI cut-off value, and quality assessment score had significant moderating effects on the prevalence of poor sleep quality. Conclusion Given the negative impact of poor sleep quality on health outcomes and well-being, regular screening for poor sleep quality and effective interventions should be conducted for this population.

The accurate classification of coarse coal slime is the premise of efficient separation. Deep Cone Hydraulic Classifier (DCHC) is a new classification equipment for coarse coal slime classification, the content of fine particles (-0.2 mm) in coarse coal slime can be effectively reduced through classification, so as to create suitable feeding granularity for teetered bed separator (TBS) sorting. The DCHC designed includes a column structure area, deep cone structure area, and flush water mode of “bottom water + central water”. Experiments on the impact parameters were carried out, the results showed that: the classification efficiency increased with the decrease of feed concentration and feeding speed, increased first and then decreased with the increase of flush water flow rate. When the feed concentration was 40%, feeding speed is 0.8 m/s and flush water flow rate was 4 m3/h, the classification efficiency reached 69.3%, the content of the −0.2 mm particles in the bottom flow products was only 1.9%. The classification mechanism showed that the column structure area realized fluidization of the flow field and the deep cone structure area supplied the movement trace for the particles. Particularly the −0.074 mm particles movement trace was clear along the cone wall and could be collected as an overflow. A part of the −0.125 mm particles could be collected as an overflow, whereas the remaining part returned to the bottom flow, and increased fine particles content. In addition, the +0.2 mm particles were mostly collected as a bottom flow, and the 0.2–0.3 mm particles content are obviously affected by operating parameters. The results not only provide a new idea for the development of new classification equipment, but also provide a pathway for the efficient classification of coarse coal slime.

High-alkali Zhundong coal (ZDc) provides the main energy supply in China due to its abundant reserves and high quality. However, its high alkali contents cause a series of ash-related problems (fouling, slagging, and corrosion, etc.) in the dry bottom boiler. In recent years, a slag-tap cyclone-fired boiler operated at higher temperatures has attracted extensive attentions in China, due to its potential in alleviating the ash-related problems. However, its emission characteristics of SO2 and NO are rarely reported. In this study, therefore, the effects of alkali species and contents on SO2 and NO emissions during the combustion of high-alkali coal in a wide temperature range of 200–1400 °C were investigated. NaCl and Na2CO3 were selected as the representative alkali species and loaded on ZDc with different contents of 0.5, 1.5, and 3.0 wt%. The results demonstrated that the addition of both Na species contributed to the reduction of SO2 and NO emission amounts significantly, as well as the shift of their maximum emission temperatures to lower temperatures. The suppression effect of Na on SO2 at low temperature stage was improved as increasing the loading amount of Na species from 0.5 to 3.0 wt%. However, the suppression effect of Na on SO2 at high temperature stage gradually decreased due to the instability of the formed Na-containing sulfates and further release of SO2. Na species showed a negligible effect on the thermal NO emission at high temperature of above 1300 °C, and the highest suppression effect of NO was achieved at a Na loading amount of 1.5 wt%. It is noteworthy that Na2CO3 was more effective in the suppression of SO2 and NO emissions than NaCl. In addition, it was found that the addition of both NaCl and Na2CO3 increased the S content in the ash, indicating that the increase of sodium content in the coal could improve the sulfur fixation effect of coal ash. Besides, the enhanced XRD diffraction intensity of Na2SO4 and Na6Ca2Al6Si6O24(SO4)2 in Na-loaded ash further proved the promoted sulfur fixation effect by sodium addition.

Derived from bio-drying of municipal organic wastes (MOWs), biodried products (BPs) are normally accepted as carbon-neutral and renewable energy sources. In this study, torrefaction at different temperatures was conducted for BPs to upgrade their properties as fuels. The results indicated that high temperatures promoted formation of gases and liquids during BPs torrefaction. Among the gaseous products, the CO2 content was significantly higher than those of CO and H2. In the liquid products, including H2O, benzenes and phenols were two typical components, which coincided with organics devolatilization and lignocellulose depolymerization. Furthermore, the fuel properties of torrefied BPs were upgraded with higher fixed carbon contents (21.95%–29.25%) and heating values (15.15–17.98 MJ/kg) due to the elimination of oxygen-containing volatiles. During combustion of torrefied BPs, the devolatilization of organics was diminished, but the decomposition of lignocellulose was enhanced. Moreover, torrefaction promoted the char combustion with lower activation energy values (151.69–207.76 vs. 160.20–215.56 kJ/mol). In addition, torrefaction reduced the emissions of C O/C–O compounds and enhanced the release of CO2, CO and H2O during combustion. However, severe torrefaction decreased energy yields and the potentials of BPs for energy recovery as fuels. Moderate torrefaction (approximately 250 °C) was suggested to be more beneficial for upgrading BPs.

Recently, bio-drying is becoming a promising method to treat the slurry-type food waste together with recovering refused derived fuels (RDFs). In practice, however, conventional process frequently encountered low temperature and inefficient drying performance due to the low microbial activity and organics degradability. In order to improve bio-drying performance, in this study, an externally thermal assistant strategy was proposed to increase water evaporation and stimulate microbial degradability. Based on this idea, a series of experiments were conducted to establish, evaluate and optimize the thermally assisted bio-drying system. It was found that staged heating acclimation was an effective strategy to obtain a superior thermophilic inoculum with high metabolic activity and microbial consortia. In thermally assisted bio-drying process, an extremely high metabolic activity [cumulative OUR, 38.98 mg/(g TS·h)] was obtained, which was greatly higher than that of conventional bio-drying [19.74 mg/(g TS·h)]. Furthermore, thermally assisted bio-drying exhibited a high water-evaporation capacity as thermal drying (157.9 g vs. 147.8 g), which was 3-fold higher than conventional bio-drying. Heat balance calculation indicated that externally supplying a small fraction (12.94%) of thermal energy triggered conventional bio-drying, thus greatly promoting water removal with high energy utilization efficiency as conventional bio-drying (Qevapo 60.30% vs. 64.62%). In addition, the increased air-flow rates greatly accelerated water removal with high bio-energy efficiencies, especially at 0.8 L·min−1·kg−1. The drying effect after 4 days was close to that of 20 days in conventional bio-drying. This research suggests that thermally assisted bio-drying is a promising approach to upgrade conventional bio-drying with high efficiency and low energy cost.

Ethnopharmacological relevance Wenshen Zhuanggu Formula (WSZG) is a traditional Chinese medicine (TCM) prescription used in clinics for adjuvant treatment of breast cancer bone metastases in Longhua Hospital in China. WSZG has been reported to decrease the risk of bone metastases and alleviate the severity of bone lesions in a breast cancer xenograft model. Aim of the study The present study aimed at investigating the pharmacokinetic behaviors of six coumarins in normal and breast cancer bone-metastatic mice following oral administration of WSZG extract. Materials and methods A bone-metastatic mouse model was established by intracardiac injection of MDA-MB-231BO breast cancer cells, and WSZG extract (1.60 g/kg) was given orally to the model and normal mice for 4 weeks. Then, the blood pharmacokinetic parameters of six bioactive components from WSZG (psoralen, isopsoralen, bergapten, xanthotoxin, osthole, and imperatorin) were analyzed by liquid chromatography tandem mass spectrometry. Results There were significant differences in pharmacokinetic behaviors between normal and pathological states. Compared with normal mice, the model mice showed significantly increased AUC0–t and AUC0–∞ of the bioactive compounds (P Conclusions The different pharmacokinetic behaviors might be partly ascribed to intestinal functional disorders and imbalance of gastrointestinal microbiota under the morbid state. The findings provide some valuable information to evaluate the clinical efficacy and safety of this TCM formula.

Background Neuronal ceroid lipofuscinosis (NCLs) are lysosomal storage disorders characterized by seizures, motor impairment, and loss of vision. Ceroid lipofuscinosis (CLN) gene mutations are the cause, but NCL cases arising from CLN6 mutations have not been described in China to date. The CLN6 protein, which plays a role in lysosomal function, is an endoplasmic reticulum (ER) membrane protein with seven transmembrane (TM) domains. It has a cytosolic-facing amino terminal domain and a luminal-facing carboxyl terminal domain, with six loops between the TM domains. Case presentation Here we report a case involving a Chinese boy whose suspected diagnosis was a hereditary leukoencephalopathy, based on brain MRI imaging and epilepsy symptoms, language articulation disorders, ataxia, and unstable gait. The electroencephalogram showed epileptic discharges, and the brain MRI scan showed high signal intensity adjacent to the bilateral posterior horns of the lateral ventricles on T2-weighted images, along with cerebellar atrophy. Using next-generation sequencing for the genes in a panel for hereditary leukoencephalopathies, we detected a homozygous missense point mutation c.892G > A(p.Glu298Lys) in CLN6, and the variant was interpreted as pathogenic on in silico analysis. Absence of this mutation was confirmed in 259 controls. Late infantile NCL and secondary epilepsy were diagnosed, and oral sodium valproate was prescribed. The epilepsy was not well controlled, however, and the other signs had not improved at the 6-month follow-up. We also analyzed the loci of 31 CLN6 missense mutations, including those previously reported and the current one. We found that 22.6% (7/31) of the mutations are in the cytoplasmic domains, about 32.2% (10/31) are in the TM domains, and about 45.2% (14/31) are in the luminal domains. These mutations were mostly located in the TM3-TM4 loop (6/31), TM1-TM2 loop (4/31), and C-terminus (4/31), with none found in the TM4-TM5 loop, TM5-TM6 loop, or TM7. Conclusions We report the first case in China of NCL caused by a CLN6 mutation, expanding the genotype options for NCLs. In practice, NCLs generally are not the initial suspected diagnosis for such cases. Use of a gene sequencing panel for investigating unexplained seizures or leukoencephalopathies can help confirm the diagnosis. Electronic supplementary material The online version of this article (10.1186/s12881-018-0690-x) contains supplementary material, which is available to authorized users.

We propose a hyperchaotic encryption algorithm for the region of interest (ROI) in a color image. The ROI for the human face is first identified based on the Open Source Computer Vision library by using a Gaussian mixture model. It is then encrypted using a novel hyperchaotic system, which has three positive Lyapunov exponents. The system can be in a hyperchaotic state with the parameter changing over a wide region, which is proved by Lyapunov exponent spectrum calculations. Furthermore, hierarchical keys are adopted to ensure the security of the encrypted sequences generated. In the encryption process, crossed image row–column scrambling and pixel value diffusion are experienced. The hyperchaotic sequences required for the encryption relate not only to the keys but also to the plaintext images. Consequently, the algorithm is effective against plaintext and ciphertext attacks. The security performance is also verified in detail with respect to histograms, correlations, information entropy, key space, key sensitivity analysis, number of pixel change rate, unified average changing intensity, and known and chosen attacks. The results indicate that the proposed algorithm has a large key space and a low correlation between adjacent pixels, hence, it can also be usefully employed to resist brute-force and statistical attacks.

Accurately predicting the WHO classification of thymomas is urgently needed to optimize individualized therapeutic strategies. We aimed to develop and validate a combined radiomics nomogram for personalized prediction of histologic subtypes in patients with thymomas. A total of 182 thymoma patients were divided into training (n = 128) and test (n = 54) cohorts. Radiomics features were extracted from T2-weighted, T2-weighted fat suppression, and diffusion-weighted images to establish a radiomics signature in the training cohort. Multivariate logistic regression analysis was used to develop a combined radiomics nomogram that incorporated clinical, conventional MR imaging variables, apparent diffusion coefficient (ADC) value, and radiomics signature. The efficacy of clinical, conventional MR imaging, or ADC model was also evaluated respectively. The performances of different models were compared by receiver operating characteristic analysis and Delong test. The discrimination, calibration, and clinical usefulness of the combined radiomics nomogram were assessed. The radiomics signature, consisting of 14 features, achieved favorable predictive efficacy in differentiating low-risk from high-risk thymomas, outperforming clinical, conventional MR imaging, and ADC models. The combined radiomics nomogram incorporating tumor shape, ADC value, and radiomics signature yielded the best performance (training cohort: area under the curve [AUC] = 0.946, test cohort: AUC = 0.878). The calibration curve and decision curve analysis indicated the clinical utility of the combined radiomics nomogram. The radiomics signature is a useful tool that can be used to predict histologic subtypes of thymomas. The combined radiomics nomogram improved the individualized subtype prediction in patients with thymomas. • Fourteen robust features were selected to develop a radiomics signature for preoperative prediction of thymoma subtype. • MRI-based radiomics signature can differentiate low-risk thymomas from high-risk thymomas with favorable predictive efficacy compared with clinical, conventional MR imaging, and ADC models. • Combined radiomics nomogram based on tumor shape, ADC value, and radiomics signature could improve the individualized subtype prediction in patients with thymomas.

Acute myeloid leukemia (AML) blasts release a wide range of chemokines in which CXCL8 has recently been recognized to be important for tumor progression. To find out the function of CXCL8 in AML, we compared blood serum of AML patients and healthy donors and found that the average level of CXCL8 was higher in AML patients. Among patients, higher expression of CXCL8 was also a positive recurrence indicator which illustrated the critical role of CXCL8 in AML. Knocking down of CXCL8 in leukemic cell lines led to significant reduction of proliferation via inducing G0/G1 cell cycle arrest and apoptosis, which was accompanied by the inactivation of ERK1/2. Furthermore, inhibition of ERK1/2 by specific chemical inhibitors reconstructed the CXCL8 knocking down phenomenon. Overall, we demonstrated that expression level of CXCL8 had a positive relationship with recurrence probability in AML. And CXCL8 was strongly implicated in AML cells growth by activating the ERK1/2 signal pathway.

A compact 10-channel mode (de)multiplexer based on mode- and polarization-division multiplexing is designed to improve the transmission capacity of the on-chip optical interconnects. This presented hybrid (de)multiplexer consists of three cascaded coupling sections where each section includes two or four collateral asymmetric directional couplers to drop the high-order modes (TM1~TM3 and TE1~TE5) as the fundamental mode. A polarization beam splitter is designed to combine/separate TM0 and TE0 mode. The directional couplers are collocated in the configuration so that the overall coupling length for the (de)multiplexing device is only 59.3 µm. The simulations show that the device has low insertion loss (

Anaerobic co-digestion (co-AD) could be a more sustainable waste management solution by sharing the existed anaerobic digestion (AD) facilities and generating more biogas energy. In this study, a series of co-AD of different urban derived organic wastes (sewage sludge-SS, food waste-FW, yard waste-YW) were conducted in a semi-continuous mode, and the corresponding dynamic evolutions of microbial community structure were followed by using real-time quantitative polymerase chain reaction (qPCR). As for co-AD of two feedstocks, introduction of SS (25%, VS basis) in FW significantly improved the process stability and archaea/total microbe ratio (from 0.4% to 17.1%), which might be due to the regulating effect of abundant trace metals in SS; co-AD of SS (25%, VS basis) with YW improved the methane yield by 2.04 times than AD of YW only together with higher methane contents (57.4 ± 1.3% vs. 50.9 ± 2.2%); in co-AD of FW and YW, synergistic effects in terms of increased methane production (3.4–19.1%) were observed, which was correlated with more robust growth of both bacteria and archaea. As for co-AD of three feedstocks, high methane yields of 314.9 ± 17.1 mL/g VS were achieved with a reliable stability. These findings could provide some fundamental and technical information for the co-treatment of urban derived organic wastes in centralized AD facilities.

BackgroundWHO focused and gave priority on ten serious tropical diseases, while China has made remarkable achievements on tropical diseases control. In addition, China has a history of more than 60 years in the health assistance, however, its assistance for tropical diseases started late.MethodsA qualitative questionnaire was distributed to inquiry the opinions of professionals on China’s health assistance on tropical diseases and published articles were searched to collect those data. SWOT analysis, as a tool of qualitative analysis, was used to classify and evaluate the current strengths, the weakness, the opportunities, and the threats of health assistance on tropical diseases in China.ResultsBased on SWOT analysis, the internal factors and external environments are obtained. The strengths are focused on China’s achievements on tropical diseases control, surveillance response system of tropical diseases, and human resources of public health; the weakness laid on sustainability of aid projects and funding, applicability of Chinese experience, and lack of composite talents; the opportunities are mainly in the global need of tropical diseases control, China’s health cooperation in Belt & Road and Africa, and the actively participating of international organizations in health assistance; as well as the threats are reflected in the complex international situation, domestic needs of tropical diseases control, and the significant gaps between China and developed countries.ConclusionThe internal strengths and weaknesses of development assistance for health on tropical diseases are clearly presented in the SWOT framework, as well as the external opportunities and threats and corresponding coping strategies. In the era of global health, China should strengthen and improve the health assistance for tropical diseases.Author summaryTropical diseases are serious infections in tropical and sub-tropical regions, with billions of persons infected and millions of deaths every year, especially in Africa. WHO also called for global efforts to control and eliminate tropical diseases. In the era of global health, development assistance on tropical diseases is important to demonstrate the soft power of national diplomacy, and China has started its health assistance in 1963. In this paper, a qualitative questionnaire and published articles were combined to collect data, and then SWOT analysis was used to analyze the internal factors and external environment, that is the current strengths, the weakness, the opportunities, and the threats of the China’s Health Assistance on key tropical diseases. Based on those results, we put forward the countermeasures and suggestions for the future cooperation of tropical diseases. At the end of this paper, we call on Chinese professionals should make use of their own advantages and actively improve the global tropical diseases control.

Pre-oxidation is considered a promising technology for improving combustion efficiency and inhibiting the emission of NOx in high rank coal use. This investigation concentrated on the evolution characteristics of anthracite-N during pre-oxidation processes under O2/H2O atmospheres. A typical high rank coal was used in this study. Isothermal pre-oxidation tests were performed under different reaction atmospheres (O2: 3, 6, 10 vol%; H2O: 0, 10 vol%), and the results illustrated that the enhancement of the O2 volumetric fraction and the addition of H2O expressed positive effects on promoting the release of anthracite-N (16.7% → 31.7%) rapidly, and more structural nitrogen tended to be removed as HCN and NH3 (0.85% → 5.48%) during the O2/H2O pre-oxidation process. The XPS results demonstrated that the increasing O2 volumetric fraction and addition of H2O in the pre-oxidation atmosphere led to the enrichment of pyrrole (N-5), which was the precursor of HCN, at the expense of pyridine (N-6) and quaternary nitrogen (N-Q). Furthermore, the increasing pre-oxidation degree accelerated the attachment of oxygen atoms on the anthracite surface, generating massive amounts of reactive functional groups. The Raman results illustrated that the variations in the chemical structure of nitrogen-containing complexes was caused by the cracking of condensed aromatic structures into reactive fragments or defect structures due to carbon-O2/H2O reactions during the pre-oxidation process, leading to massive amounts of internal structural nitrogen exposed to the edge of aromatic structures (N-Q/N-6 → N-5). When the pre-oxidation occurred in an atmosphere consisting of 10 vol% O2 and 10 vol% H2O, the conversion ratio of anthracite-N to NO during the whole pre-oxidation process reached the minimum value of 5.31%, and the reactivity of the semi-char was the highest.

In order to challenge the existing literature that points to the detachment of Bitcoin from the global financial system, we use daily data from August 17, 2011–February 14, 2020 and apply a risk spillover approach based on expectiles. Results show reasonable evidence to imply the existence of downside risk spillover between Bitcoin and four assets (equities, bonds, currencies, and commodities), which seems to be time dependent. Our main findings have implications for participants in both the Bitcoin and traditional financial markets for the sake of asset allocation, and risk management. For policy makers, the findings suggest that Bitcoin should be monitored carefully for the sake of financial stability.

Purpose In populations without contrast enhancement, the imaging features of atypical brain parenchyma inflammations can mimic those of grade II gliomas. The aim of this study was to assess the value of the conventional MR-based radiomics signature in differentiating brain inflammation from grade II glioma. Methods Fifty-seven patients (39 patients with grade II glioma and 18 patients with inflammation) were divided into primary (n = 44) and validation cohorts (n = 13). Radiomics features were extracted from T1-weighted images (T1WI) and T2-weighted images (T2WI). Two-sample t-test and least absolute shrinkage and selection operator (LASSO) regression were adopted to select features and build radiomics signature models for discriminating inflammation from glioma. The predictive performance of the models was evaluated via area under the receiver operating characteristic curve (AUC) and compared with the radiologists’ assessments. Results Based on the primary cohort, we developed T1WI, T2WI and combination (T1WI + T2WI) models for differentiating inflammation from glioma with 4, 8, and 5 radiomics features, respectively. Among these models, T2WI and combination models achieved better diagnostic efficacy, with AUC of 0.980, 0.988 in primary cohort and that of 0.950, 0.925 in validation cohort, respectively. The AUCs of radiologist 1’s and 2’s assessments were 0.661 and 0.722, respectively. Conclusion The signature based on radiomics features helps to differentiate inflammation from grade II glioma and improved performance compared with experienced radiologists, which could potentially be useful in clinical practice.

SummaryWhat is known and objective Numerous population pharmacokinetic studies of theophylline have been conducted in paediatric and adult patients. The purpose of this review was to summarize the published studies concerning population pharmacokinetics of theophylline in patients of different ages and discuss factors that might cause the large variability in the pharmacokinetics of theophylline. Methods A literature search was conducted in PubMed using the following keywords: ‘theophylline’, ‘population pharmacokinetic(s)’ and ‘nonlinear mixed effect model’. Additionally, the relevant references listed in the retrieved articles were manually reviewed. All of the studies that reported the population pharmacokinetics of theophylline in humans were included in this review. However, articles were excluded if they were not written in English. Results and discussion Sixteen articles were included in this review. Among them, 11 were conducted on paediatric patients, and five were conducted on adults. A one-compartment model with first-order elimination was employed in most of the included articles. A nonlinear mixed effect modelling approach (NONMEM) was the most commonly used software to develop a population pharmacokinetic model. Body weight and age (post-conceptional age and post-natal age) were the most important factors associated with the clearance (CL) of theophylline in paediatric patients. Body weight (ideal body weight and lean body mass), age and smoking status were most frequently used to estimate the CL of theophylline in adults. The median (range) estimate values of CL for paediatric and adult patients were 0·062 (0·0056–0·0949) L/h/kg and 0·053 (0·0493–0·0517) L/h/kg, respectively. The median values of the interindividual variability of CL were 33·5% in adults and 25·8% in paediatric patients. The mean values of the residual variability were 21% in paediatric patients and 14·3% in adults. What is new and conclusion This review concludes that body weight and age were the most important factors associated with the clearance of theophylline in paediatric patients. Body weight, age and smoking were most frequently used to estimate the clearance of theophylline in adults. Future studies are warranted to detect the influence of new factors, such as cytochrome P450 (CYP) 1A2 gene polymorphisms, on the pharmacokinetics of theophylline because some pharmacokinetic variability was not fully explained.

// Ping-Heng Lan 1, 11, * , Zhi-Heng Liu 2, * , Yan-Jun Pei 1 , Zhi-Gang Wu 3, 4 , Yang Yu 5, 6 , Yong-Feng Yang 7 , Xu Liu 8 , Lu Che 8 , Chi-Jiao Ma 9 , Yan-Ke Xie 8 , Qing-Jie Hu 8 , Zhong-Yuan Wan 10 , Hai-Qiang Wang 1 1 Department of Orthopaedics, Xijing Hospital, Fourth Military Medical University, Xi’an, P. R. China 2 Department of Orthopaedics, Xi’an Air Force Hospital, Xi’an, P.R. China 3 The Second Department of Surgery, No. 518 Hospital of the PLA, Xi’an, P. R. China 4 Department of Orthopaedic Surgery, Lanzhou General Hospital of Lanzhou Military Region, PLA, Lanzhou, P. R. China 5 State Key Laboratory of Military Stomatology, Department of Periodontology, School of Stomatology, Fourth Military Medical University, Xi’an, P. R. China 6 Shaanxi Key Laboratory of Stomatology, Biomaterials Unit, School of Stomatology, Fourth Military Medical University, Xi’an, P. R. China 7 Company Eleven, Brigade of Undergraduates, Fourth Military Medical University, Xi’an, P. R. China 8 Aerospace Medical School, Fourth Military Medical University, Xi’an, P. R. China 9 The First Hospital of Hanbin Area, Ankang, P. R. China 10 Department of Orthopedics, General Hospital of Beijing Military Command, Beijing, P. R. China 11 Department of Orthopaedics, No. 5 Hospital of the PLA, Yinchuan, P. R. China * These authors contributed equally to this work Correspondence to: Hai-Qiang Wang, email: hqwang@fmmu.edu.cn , drwanghq@163.com Keywords: noncoding RNAs, miRNAs, circRNAs, gene regulation, RNA transcription Received: March 30, 2016 Accepted: August 12, 2016 Published: August 17, 2016 ABSTRACT Accumulating evidence indicates noncoding RNAs (ncRNAs) fine-tune gene expression with mysterious machinery. We conducted a combination of mRNA, miRNA, circRNA, LncRNA microarray analyses on 10 adults’ lumbar discs. Moreover, we performed additional global exploration on RNA interacting machinery in terms of in silico computational pipeline. Here we show the landscape of RNAs in human lumbar discs. In general, the RNA-abundant landscape comprises 14,635 mRNAs (37.93%), 2,059 miRNAs (5.34%), 18,995 LncRNAs (49.23%) and 2,894 (7.5%) circRNAs. Chromosome 1 contributes for RNA transcription at most (10%). Bi-directional transcription contributes evenly for RNA biogenesis, in terms of 5’ to 3’ and 3’ to 5’. Despite the majority of circRNAs are exonic, antisense (1.49%), intergenic (0.035%), intragenic (1.69%), and intronic (6.29%) circRNAs should not be ignored. A single miRNA could interact with a multitude of circRNAs. Notably, CDR1as or ciRS-7 harbors 66 consecutive binding sites for miR-7-5p (previous miR-7), evidencing our pipeline. The majority of binding sites are perfect-matched (78.95%). Collectively, global landscape of RNAs sheds novel insights on RNA interacting mechanisms in human intervertebral disc degeneration.

Objectives: To investigated the effects of Bailing capsule on hypoxia-induced proliferation of pulmonary arterial smooth muscle cells (PASMCs). Methods: This prospective study was performed at the Central Laboratory, Chengdu Medical College, Chengdu, China between April 2012 and November 2014. Ten healthy adult male Wistar rats were administrated with gastric perfusion of Bailing capsule to obtain serum containing the tested drugs. Proliferation of pulmonary arterial smooth muscle cells proliferation was measured using cell counting kit-8 assay. Production of reactive oxygen species (ROS) in rat PASMCs was determined through a fluorometric assay, whereas production of endothelin-1 (ET-1) was detected by ELISA and quantitative real-time PCR (qRT-PCR). Expression of proliferating cell nuclear antigen (PCNA), c-fos, and c-jun in PASMCs was also determined using immunohistochemistry staining and qRT-PCR. Results: We observed that the medicated serum obviously inhibited hypoxia-induced cell proliferation in a concentration-dependent manner. Moreover, the medicated serum significantly reduced hypoxia-induced production of ROS and ET-1, as well as expression of PCNA, c-fos, and c-jun, in PASMCs. Conclusion: Results demonstrated that Bailing capsule can inhibit hypoxia-induced PASMC proliferation possibly by suppressing ET-1 and ROS production and by inhibiting expression of PCNA, c-fos, and c-jun. These results suggest that Bailing possess antiproliferative property, which is probably one of the underlying mechanisms of Bailing capsule for the clinical treatment of chronic obstructive pulmonary disease. Saudi Med J 2016; Vol. 37 (5): 498-505 doi:10.15537/smj.2016.5.14953 How to cite this article: Li X, Peng K, Zhou Y, Deng F, Ma J. Inhibitory effect of Bailing capsule on hypoxia-induced proliferation of rat pulmonary arterial smooth muscle cells. Saudi Med J 2016; Vol. 37 (5): 498-505.

Background: Many studies have evaluated the association between aldosterone synthase (CYP11B2) C-344T polymorphism and preeclampsia (PE) susceptibility, however, the results from different studies are inconsistent. Objective: The study aimed to derive a more precise estimation of this association. Methods: We searched PubMed, Embase, Chinese National Knowledge Infrastructure, China Biological Medicine, and Wanfang Database. The association was evaluated by calculating the odds ratios (ORs) with the corresponding 95% confidence intervals (CIs). Results: Seven case-control studies with a total of 720 cases and 766 controls were eligible to be included in this meta-analysis. Overall, there was no significant association between CYP11B2 C-344T polymorphism and PE (for the allele model T vs.C: OR=0.78, 95%CI 0.60-1.01, p=0.06; for the codominant model CT vs. CC: OR=1.08, 95%CI 0.80-1.46, p=0.63; for the dominant model TT + CT vs. CC: OR=0.91, 95%CI 0.68-1.20, p=0.49). Similar results were obtained in sensitivity analysis. Conclusion: In summary, the present meta-analysis suggests that CYP11B2 C-344T polymorphism may not be associated with genetic susceptibility of PE, but the association remains indeterminate due to the insufficient evidence.

Bone metastasis of breast cancer causes severe skeletal-related events and poor prognosis. Wensheng Zhuanggu Formula (WSZG), a traditional Chinese prescription, is used to adjunctively treat breast cancer bone metastases in clinical practice. This study was undertaken to investigate the antibone-metastatic activities and mechanisms of WSZG extract by evaluating the effect of this formula on the cross-talk between bone marrow-derived mesenchymal stem cells (BMSCs) and breast cancer cells in triggering epithelial-mesenchymal transition (EMT) in vivo and in vitro. The results demonstrated that BMSCs might enhance the invasive and metastatic potentials of breast cancer cells as a consequence of EMT induction through direct cell-to-cell contact. WSZG treatment remarkably suppressed motility, invasion, EMT-related gene, and protein markers in BMSC-conditioned breast cancer cells and ameliorated bone metastases and damages in nude mice following co-injection of BMSCs and MDA-MB-231BO breast cancer cells. Further investigation showed that the transforming growth factor-β1 (TGF-β1)/Smads pathway was an important mechanism enabling BMSCs to induce EMT occurrence of breast cancer cells. WSZG treatment reversed BMSC-induced EMT by downregulating TGF-β1/Smads signaling. Thus, WSZG extracts may be regarded as a potential antibone-metastatic agent for breast cancer therapy.

In this study, thermal assistance was employed in the cooling stage of conventional biodrying. The results indicated that thermal assistance greatly enhanced water removal with improved vapor-carrying capacity of air-flow, and rapidly decreased moisture contents (MCs) from 45.15% to 49.42% to 15.20–25.85% in 6 days, which were much lower than those of conventional biodrying (CB, 34.90–40.85%). More importantly, a synergistic enhancement of physical and biological effects was observed in thermally assisted biodrying (TB) in terms of stimulated enzymes activity and microbial metabolism (higher oxygen uptake rate and degradation coefficient k). Among the degraded organics, lignocellulose was noted to be important for bio-heat generation in cooling stages, especially for straw as bulking agent. Heat balance results suggested that small fractions of thermal heat (19.76–24.73%) were required to upgrade CB processes for water evaporation with higher energy efficiency. Based on economic viability analysis and with consideration of the further drying for CB products, thermally assisted biodrying presented more economic benefits with less investment and shorter payback period. This research provided an efficient engineering approach to upgrade the cooling stage of conventional biodrying with low external heat cost.

Background Spinal cord injury (SCI) is one of the most severe central nervous system injuries. Currently, transplanting bone marrow mesenchymal stem cells (BMSCs) is considered a therapeutic option for SCI. Tanshinone IIA (TIIA) is one of the extracts obtained from Salvia miltiorrhiza Bunge, which has been shown to have some protective effects against SCI. The present research was aimed to explore whether TIIA would influence the fate of transplanted BMSCs in a rat model of SCI, especially with regard to their differentiation into neuronal cells. Methods Bone marrow mesenchymal stem cells were obtained from immature rats and identified using flow cytometry. After SCI, 1.0 × 107 cells labeled with PKH67 were transfused into the injured spinal cord. TIIA was first injected into the tail vein (30 mg/kg) 1 h before surgery. From day 1 to day 7 post-SCI, TIIA was injected (20 mg/kg) per day at the same time. Recovery of locomotor function and histological regeneration of the spinal cord were compared among the groups, with the differentiation and distribution of BMSCs determined anatomically and biochemically by the expression of neural cell markers. Results Locomotor assessments showed that the rats in the BMSCs + TIIA group exhibited higher scores (19.33 ± 0.58) than those in the other groups (13.67 ± 1.53, 17.67 ± 0.58, 18.00 ± 1.73). The area of the cavity in the BMSCs + TIIA rats was smaller than that in the other groups (1.30 ± 0.56, 10.39 ± 1.59, 6.84 ± 1.18, 4.36 ± 0.69). Co-expression of glial fibrillary acid protein was observed in transplanted BMSCs, with a reduced rate in the BMSCs + TIIA group relative to that in the SCI group. In contrast, the expression levels of Nestin, neuron-specific nuclear protein (NeuN) and neurofilament protein 200 (NF200) were greatest in the transplanted cells in the BMSCs + TIIA group. Conclusions Tanshinone IIA treatment enhances the therapeutic effects of BMSC transplant on SCI, likely by promoting the differentiation of neuronal cells.

Current studies have evaluated the association between CD14-260 (also known as -159) C/T polymorphism and Alzheimer's disease (AD) susceptibility. However, the association remains inconclusive. The aim of this study was to draw an accurate conclusion of the association. The literature search was conducted using PubMed, Embase, Chinese National Knowledge Infrastructure, China Biological Medicine Database, and Wanfang Databases for related articles. Four case-control studies with a total of 868 cases and 766 controls were eligible to be included in this meta-analysis. The association was evaluated by calculating the odds ratios (ORs) with the corresponding 95% confidence intervals (CIs). Overall, there was no significant association between CD14-260C/T polymorphism and AD risk in all genetic models (the allele model T vs. C: OR = 1.06, 95% CI 0.92-1.21, p = 0.44; the homozygous model TT vs. CC: OR = 1.09, 95% CI 0.83-1.44, p = 0.53; the heterozygote model CT vs. CC: OR = 0.95, 95% CI 0.75-1.22, p = 0.71; the dominant model TT + CT vs. CC: OR = 1.05, 95% CI 0.84-1.32, p = 0.66; the recessive model TT vs. CT + CC: OR = 1.14, 95% CI 0.92-1.43, p = 0.24). The sample size of 5064 was calculated by applying trial sequential analysis. Cumulative z curve does not cross trial sequential monitoring boundary. In conclusion, the present meta-analysis suggests that the CD14-260C/T polymorphism may not be associated with genetic susceptibility of AD, but the association remains indeterminate due to the insufficient evidence.

Background and Aim Traditional pathological scoring systems for liver fibrosis progression are predominantly based on the description of architectural changes with no consideration of the amount of collagen fiber deposition. Our purpose was to explore a true histological standard in accordance with the liver stiffness measured by point shear wave elastography (PSWE) in patients with chronic hepatitis B. Methods A total of 78 patients with liver neoplasms underwent liver stiffness measurements with PSWE as well as biochemical investigations within 3 days before partial hepatectomy. One tissue section of the liver specimens was stained with HE trichrome and evaluated traditionally with the Scheuer scoring system. The other tissue section was stained with picroSirius red and was evaluated according to the semiquantitative Chevallier et al. scoring system. In addition, this second tissue section was evaluated for the collagen proportionate area (CPA) with computer-assisted digital image analysis. The reproducibility of PSWE technology was explored through the intra-class correlation coefficient of a reliability analysis. Results The PSWE technology revealed good reproducibility in liver stiffness measurements, and the PSWE values increased with the pathological severity of liver fibrosis on both the Scheuer scoring system and the semiquantitative Chevallier et al. scoring system. PSWE values exhibited more reasonable relationships with CPA (r = 0.628, P = 0.00

A 60-year-old female visited Guihang Guiyang Hospital (Guiyang, China). She presented with abdominal pain in the right side for the previous 2-months, with a touchable mass identified for the previous 1-month. Computed tomography with magnetic resonance imaging revealed a huge mass in the right abdomen. The diagnosis of well-differentiated retroperitoneal liposarcoma with renal involvement was made. During surgery, the tumor was removed, including the fatty renal capsule; however, the kidney was preserved. It is currently debatable whether resection of adjacent organs is required to obtain the negative margins. Conventional viewpoints advise that multi-organ resection is required in order to obtain the negative-margin. However, even if an R0 resection is achieved, the local recurrence rate remains markedly high. Additionally, the complications of organ resection have more impact on patients. Radiotherapy and chemotherapy are an important adjuvant method for these patients. In conclusion, retroperitoneal liposarcoma is a rare disease with a high rate of recurrence. Complete resection is the predominant treatment; however, combined resection of adjacent organs must be considered.

Analyze the management vulnerabilities and technology vulnerabilities of current bank cards firstly, explain the technical features of the magnetic stripe and memory chip bank card, and disclose the method probably used by criminals while attacking. Meanwhile analyze the reasons why PKI may be infeasible to guarantee the security of bank cards. Vertical authentication based security solution for bank cards are proposed. Use CPU smart chip to replace the magnetic stripe card and memory chip. Set up signature and encryption protocols dealing with withdrawal form or payment order on the basis of vertical authentication in CPU smart chips, and replace current withdrawal or payment password authentication protocol. Therefore, set up a chip-level withdrawal or payment system for ATM or POS to guarantee the security of bank card withdrawal or payment.

The unique midgap excited states of Co2+-doped ZnO quantum dots have given rise to new applications in photocatalysis, sensing, magneto-optics, and magnetoelectronics. However, the electronic characteristics of these midgap transitions are not fully understood, and the uncertain interplay between these transitions has led to disagreement in the literature. In this work, midgap excited states of Co2+-doped ZnO quantum dots are analyzed using linear response time-dependent density functional theory and the effective mass theory with a focus on the geometry relaxation in the donor-type photoionization excited state. Relaxation of the excited-state geometry lowers the charge-transfer transition energy to be in the vicinity of the prominent spin-allowed 4A2 → 4T1 Co2+ d–d transition that gives this material its characteristic color. For large quantum dots, the excited-state population distribution between this Co2+ d–d excited state and the charge-transfer excited state can be tuned by thermal energy, resultin...

A variety of high-density and strong signal electromagnetic jamming and interference effect is one of the difficult problems which have bad effects on the accuracy of GNSS Satellite navigation receivers. For different types of jamming and interference effect, this paper will analyze their corresponding coping strategies on GNSS satellite navigation terminal. On the structure basis of the smart antenna array, the algorithm flow of LMS, RLS and CMA are analyzed and the simulation of these three classic beam forming algorithm are also performed. The comparison result of the convergence curves output and convergent beam directional diagram shows that all of them can extract the useful signal from the interfering signals. RLS algorithm has a better setup speed and convergence rate, and also has a strong adaptability to non-stationary signals. Therefore, its filtering performance is significantly better than LMS and CMA. But due to its high computational complexity, real-time processing is very hard to achieve.

Background and Aim Elastography point quantification (ElastPQ) was a newly non-invasive method for the assessment of liver fibrosis by measuring liver stiffness. We aimed at evaluating the reproducibility of ElastPQ technology in the determination of liver stiffness and to investigate the value of ElastPQ in liver fibrosis staging among chronic hepatitis B patients. Methods A total of 291 successive patients who underwent liver partial hepatectomy or biopsy were examined with the ElastPQ technology for the measurement of liver stiffness. Ten ElastPQ measurements were obtained in the right lobe of the liver through the seventh to the tenth intercostal space for every patient. The reproducibility of ElastPQ technology was analyzed with intraclass correlation (ICC) of reliability analysis. Comparing the median of 10 measurements of ElastPQ with liver fibrosis, necroinflammatory activity, and steatosis pathologically, as well as gender and age, potential factors affecting liver stiffness were explored by multiple linear regression analysis, and the performances of ElastPQ were evaluated with repeated measures anova and receiver operating characteristic (ROC) curve. Results The ICC of 10 measurements of liver stiffness with ElastPQ technique was 0.798, which indicated a good reproducibility. Liver fibrosis and necroinflammatory activity were positively correlated with ElastPQ (P = 0.00, 0.01

Ultrasonography is the most frequently used clinical tool for the identification, assessment, and follow-up of thyroid nodules. The purpose of this research was to evaluate the value of diagnostic ultrasonography indicators, to obtain rankings of the most valuable indicators in the differential diagnosis of thyroid nodules, and to analyze the optimal diagnostic points and clinical values.One hundred forty-four patients with 172 thyroid nodules underwent preoperative ultrasonography examinations, including gray-scale ultrasonography (GSUS), color Doppler ultrasonography (CDUS), and contrast-enhanced ultrasonography (CEUS). Fourteen indicators of thyroid nodules on GSUS, CDUS, and CEUS were selected to evaluate all thyroid nodules. The differences between the benign and malignant thyroid nodules in all indicators were analyzed by the chi-squared test; the diagnostic ultrasonography values were obtained by logistic regression; and the optimal diagnostic points were explored by receiver operating characteristic curve analysis.Of the 172 thyroid nodules that were surgically removed, 78 were benign and 94 were malignant. Ten indicators of GSUS and CEUS showed significant differences between the benign and malignant nodules (p0.05), whereas four CDUS indicators had no value. The rankings of the valuable indicators were obtained according to their odds ratios (ORs). The top four indicators were ring enhancement and homogeneity of enhancement on CEUS, and microcalcification and halo on GSUS. These indicators were the most valuable, with ORs of greater than 20 in the differential diagnosis of benign and malignant thyroid nodules. The other six indicators-the relative arrival time of the nodule on CEUS, interior echogenicity on GSUS, peak interior echogenicity on CEUS, shape on GSUS, peak peripheral echogenicity on CEUS, and orientation on GSUS-were also valuable, with ORs less than 20. The areas under the receiver operating characteristic curves for GSUS, CEUS, and the combination of GSUS and CEUS in the diagnosis of thyroid nodules were 0.936, 0.910, and 0.966, respectively. Five positive features of the 10 valuable indicators on GSUS and CEUS defined the cut-off for the diagnosis of malignant thyroid nodules, with a sensitivity of 89.4% (84/94), specificity of 93.6% (73/78), and accuracy of 91.3% (157/172).The ring enhancement and homogeneity of enhancement of thyroid nodules on CEUS and the microcalcification and halo on GSUS were the four most valuable indicators in the differential diagnosis of thyroid nodules. Conjoint analysis of specific features of thyroid nodules on GSUS and CEUS could enhance the diagnostic value of thyroid nodules.

According to the adverse status of physical health and physical activity of middle school seniors, proposing solutions about "sports network" system and mechanism of the construction of middle school students by using the methods of literature data, analysis, synthesis and so on. In the longitudinal aspects, form the macroscopic policy makers, middle managers, micro executives and all kinds of linkage among the audience and coordinate system and mechanism. In Lateral aspects, establish and form "family, school, social’’ interaction and cooperation mechanism, prompting the coordinated development and deep fusion of school sports, social sports and competitive sports so as to change the bad status of seniors’ physical health and physical activity.