Search

In Brazil, Spigelia anthelmia is an herbaceous weedy plant normally used for the treatment of helminths in humans and animals. Leaves and stems of S. anthelmia showing black spots were observed in cities in the Northeast region of Brazil. Two fungal species were isolated from symptomatic tissues. The preliminary identification of the fungal isolates was based on morphological characteristics. To confirm the identification of the isolates, the ITS region and partial sequences of the ACT and GAPDH genes were amplified and sequenced. By using morphological and phylogenetic analyses of multilocus genes, the fungi were identified as Colletotrichum karstii and Colletotrichum siamense. All isolates were pathogenic to S. anthelmia seedlings. To the best of our knowledge, this is the first report of C. karstii and C. siamense causing anthracnose on S. anthelmia in the world.

The use of more than one control technique can maximize the reduction of the damages caused by the fungus Asperisporium caricae causal agent of the black spot in the papaya crop. The objective of this work was to evaluate the sensitivity of the fungi Hansfordia pulvinata and Acremonium spp. to alternative products with potential for use in the control of the black-spotted ptarmigan. Three isolates of Acremonium spp. (A-598, A-602 and A-617) and an isolate of H. pulvinata (H-611) were grown in BDA medium containing Agro-Mos®, Bion®, Ecolife®, Hortifospk®, Matriz G®, Vitaphol® separately. The Amistar 500WG ® fungicide was used as a positive control and pure BDA as a negative control. The toxicity of the tested products was determined based on the values of the biological index, derived from the means of mycelial growth, sporulation and germination of conidia, in each experimental unit. In this way it was possible to select the products classified as compatible for all isolates, and to test them in vivo. In the greenhouse, only the isolates and isolates with selected products, were applied in papaya plants with foliar symptoms of black-spotted. The incidence of leaves with hyperparasites and the percentage of black-painted lesions colonized by the tested isolates were evaluated. Thus, the H-611 isolate proved to be compatible with most of the alternative products tested, except with Hortifos®. Bion® and Matrix® products were compatible with all tested isolates and could be used in conjunction with Acremonium spp. and H. pulvinata to control the papaya black spot, since these products did not present toxicity on the hyperparasitic fungi. Resumo O uso de mais de uma técnica de controle pode maximizar a redução dos danos causados pelo fungo Asperisporium caricae agente causal da pinta preta na cultura do mamoeiro. O objetivo deste trabalho foi avaliar a sensibilidade dos fungos Hansfordia pulvinata e Acremonium spp. a produtos alternativos com potencial para uso no controle da pinta-preta. Três isolados de Acremonium spp. (A-598, A-602 e A-617) e um isolado de H. pulvinata (H-611) foram cultivados em meio BDA contendo Agro-Mos®, Bion®, Ecolife®, Hortifospk®, Matriz G®, Vitaphol® separadamente. Fungicida Amistar 500WG® foi utilizado como controle positivo e BDA puro, como controle negativo. A toxicidade dos produtos testados foi determinada com base nos valores do índice biológico, provenientes das médias do crescimento micelial, esporulação e germinação de conídios, em cada unidade experimental. Dessa forma foi possível selecionar os produtos classificados como compatíveis para todos os isolados, e testá-los in vivo. Em casa de vegetação, somente os isolados e os isolados com produtos selecionados, foram aplicados em plantas de mamoeiro com sintomas foliares de pinta-preta. Avaliaram-se a incidência de folhas com hiperparasitas e a porcentagem de lesões de pinta-preta colonizadas pelos isolados testados. Assim o isolado H-611 mostrou-se compatível com a maioria dos produtos alternativos testados, exceto com Hortifos®. Os produtos Bion® e Matriz® apresentaram compatibilidade com todos os isolados testados, podendo ser utilizados em conjunto com o Acremonium spp. e H. pulvinata para controlar a pinta-preta do mamoeiro, uma vez que estes produtos não apresentaram toxidade sobre os fungos hiperparasitas.

Marssonina brunnea is the main pathogen that causes poplar black spot disease, which leads to the decrease of the photosynthetic efficiency and significantly affects the production and quality of timber. Currently, no in-field diagnostic exists for M. brunnea. Here, we described a loop-mediated isothermal amplification (LAMP) assay for the rapid and sensitive detection of M. brunnea. A set of six oligonucleotide primers was designed to recognize eight distinct sequences of the internal transcribed spacer (ITS) region of M. brunnea. The LAMP assay was optimized by the combination of high specificity, sensitivity, and rapidity for the detection of less than 10 pg/&mu, L of target genomic DNA in 60 min per reaction at 65 &deg, C, whereas with PCR, there was no amplification of DNA with concentration less than 1 ng/&mu, L. Among the genomic DNA of 20 fungalisolates, only the samples containing the genomic DNA of M. brunnea changed from violet to sky blue (visible to the naked eye) by using hydroxynaphthol blue (HNB) dye. No DNA was amplified from the eight other fungus species, including two other Marssonina pathogens, three other foliar fungi pathogens of poplar, and three common foliar fungal endophytes of poplar. Moreover, the detection rates of M. brunnea from artificially and naturally infected poplar leaves were 10/16 (62.5%) and 6/16 (37.5%) using PCR, respectively, while the positive-sample ratios were both 16/16 (100%) using the LAMP assay. Overall, the ITS LAMP assay established here can be a better alternative to PCR-based techniques for the specific and sensitive detection of M. brunnea in poplar endemic areas with resource-limited settings.

Black spot is a major foliar disease of sweet basil (Ocimum basilicum) present in a typical cultivation area of northern Italy, including the Liguria and southern Piedmont regions, where this aromatic herb is an economically important crop. In this study, 15 Colletotrichum isolates obtained from sweet basil plants with symptoms of black spot sampled in this area were characterized morphologically and by nuclear DNA analysis using internal transcribed spacers (ITS) and intervening 5.8S nrDNA as well as part of the &beta, tubulin gene (TUB2) regions as barcode markers. Analysis revealed all but one isolate belonged to the recently described species C. ocimi of the C. destructivum species complex. Only one isolate was identified as C. destructivum sensu stricto (s.s.). In pathogenicity tests on sweet basil, both C. ocimi and C. destructivum s.s. isolates incited typical symptoms of black spot, showing that although C. ocimi prevails in this basil production area, it is not the sole causal agent of black spot in northern Italy. While no other hosts of C. ocimi are known worldwide, the close related species C. destructivum has a broad host range, suggesting a speciation process of C. ocimi within this species complex driven by adaptation to the host.

Identification of chlorophyll compound of Caulerpa racemosa has been carried out using Thin Layer Chromatography (TLC) method. Four compound has been found namely xanthophll, chlorophyll b, chlorophyll a, and phaeophytin. Xanthophyll was identified with the yellow spot on TLC plates which the Rf is 0,46. Chlorophyll b is yellow green spot with Rf is 0,61, the Rf of Chlorophyll a is 0,69 with the color is blue green, whereas phaeophytin is indicated as a black spot with the Rf 0,77. Volpi and UV light sources were used in this study, the volpi light radiation was caused chlorophyll extract degradation about 80,87% at Qy of l 663 nm, and the UV light source caused 72,27% degradation at l 663 nm.Key words: identification, photodegradation, chlorophyll, Caulerpa racemosa.

Background: Ginseng black spot disease resulting from Alternaria panax Whuetz is a common soil-borne disease, with an annual incidence rate higher than 20–30%. In this study, the bacterial strains with good antagonistic effect against A. panax are screened. Methods: A total of 285 bacterial strains isolated from ginseng rhizosphere soils were screened using the Kirby–Bauer disk diffusion method and the Oxford cup plate assay. We analyzed the antifungal spectrum of SZ-22 by confronting incubation. To evaluate the efficacy of biocontrol against ginseng black spot and for growth promotion by SZ-22, we performed pot experiments in a plastic greenhouse. Taxonomic position of SZ-22 was identified using morphology, physiological, and biochemical characteristics, 16S ribosomal DNA, and gyrB sequences. Results: SZ-22 (which was identified as Brevundimonas terrae) showed the strongest inhibition rate against A. panax, which showed 83.70% inhibition, and it also provided broad-spectrum antifungal effects. The inhibition efficacies of the SZ-22 bacterial suspension against ginseng black spot reached 82.47% inhibition, which is significantly higher than that of the 25% suspension concentrate azoxystrobin fungicide treatment (p

Black spot is a common disease occurring on Dendrobium officinale, which significantly reduces the quality and yield of this medicinal plant (family Orchidaceae). The disease manifests itself as small, black spots on leaves which can develop into circular streaks that become necrotic tan or brownish black, with the leaves eventually turning yellow or brown-yellow. Fungal pathogens such as Alternaria tenuissima and Phyllosticta spp. are known to cause black spot of D. officinale. A fungus which was atypical of A. tenuissima or Phyllosticta spp. was isolated from leaves of D. officinale showing symptoms of black spot from Zhejiang and Guangxi provinces, China. Pathogenicity tests in vitro as well as on tissue-cultured seedlings using fungal isolate GXDF24 showed that it was able to cause typical black spot symptoms. Molecular identification based on the ITS sequence revealed that isolate GXDF24 shared 99% similarity with Cladosporium oxysporum. This is the first report of C. oxysporum as a pathogen causing black spot of D. officinale in China.

Ascochyta pisi induces leaf spot in Pisum sativum . Currently A . pisi was found pathogenic against 4 pea varieties. Ten concentrations of Eucalyptus camaldulensis leaf extract and its 7 fractionations were appraised for antifungal activity against A . pisi . The highest concentration revealed 78% suppression in growth. Fractionation was carried out successively with n-hexane, Chloroform, Ethyl acetate and n-Butanol. In in vivo bioassays, all the solvent fractions particularly n-Butanol controlled pathogen efficiently on all varieties. In RT-PCR, all genes were expressed in control and treated plants of Greenfeast but the intensity of gene 2 and 8 was upregulated in treated plants. n-Butanol induced the over expression of gene 3 and 7 in Meteor. Then, in native PAGE Glu 1 was the glucanase isozyme, detected only in variety Greenfeast. Control plants of Rondo showed Glu 2 and 3, while its treated plants had Glu 1, Glu 2, Glu 3 and Glu 4.

The effects of thiamine against pink and black spot rots caused by Trichothecium roseum and Alternaria alternata and modulation on the metabolism of reactive oxygen species (ROS) and phenylpropanoid pathway were investigated in this paper. In vitro test indicated that thiamine significantly inhibited mycelia growth and spore germination of T. roseum and A. alternata. Thiamine at 100 mmol L−1 effectively inhibited lesion development of muskmelon fruit inoculated with T. roseum or A. alternata, enhanced production rate of and H2O2 content, activities of catalase (CAT), ascorbate peroxidase (APX) and glutathione reductase (GR) in muskmelon fruit. Thiamine also affect phenylpropanoid pathway in muskmelon fruit by increasing the activities of phenylalanine ammonia lyase (PAL) and peroxidase (POD), the content of total phenolic compounds, flavonoids and lignin. These results suggest that the effects of thiamine on pink and black spot rots in muskmelon fruits are associated with its direct fungitoxic against the pathogens and the modulation of and H2O2 production, eliminating enzymes and phenylpropanoid pathway.

A novel disease characterized by small brown-black spots (1 to 2 mm in diameter) on tender tea leaves (Camellia sinensis) has been observed in many regions of Hubei Province, China, which severely affects the yield and quality of tea. Tea leaf samples with typical symptoms were collected from three major tea-cultivation regions of Hubei, and were subjected to pathogen isolation for etiological analysis. As a result, 34 Pestalotiopsis isolates were obtained from 20 samples, and they were identified as Pestalotiopsis theae (14 isolates), P. camelliae (12), and P. clavispora (8), determined by morphologies and phylogenetic analysis based on internal transcribed spacer, and partial β-tubulin and translation elongation factor 1-alpha genes. Pathogenicity tests on detached tea leaves showed that no matter what mycelial discs or conidium suspensions were used, inoculation of the Pestalotiopsis fungi could result in small brown-black spots (1 to 2 mm in diameter) on wounded leaves, similar to those observed in the field in the sizes and colors. It also revealed that only P. theae had pathogenicity on unwounded tea leaves, and P. theae and P. clavispora showed significantly higher virulence than P. camelliae. Inoculation test with conidium suspension on intact tea leaves in the field further confirmed that P. theae as the pathogen of brown-black spots. Reisolation of the pathogens from diseased leaves confirmed that the symptom was caused by the inoculation of Pestalotiopsis fungi. The P. theae isolates responsible for brown-black spots were also compared with those for tea gray blight disease in growth rate, pathogenicity, and molecular characteristics in parallel. To our knowledge, this is the first report that the Pestalotiopsis fungi cause brown-black spot disease on tender tea leaves. The results provide important implications for the prevention and management of this economically important disease.

The differential expression of 13 defense related genes during Phoma koolunga infection of stems and leaves of susceptible versus resistant field pea (Pisum sativum) was determined using qRT-PCR. Expression, in terms of relative mRNA level ratios, of genes encoding for Ferredoxin NADP oxidoreductase, 6a-hydroxymaackiain methyltransferase (‘hmm6’), Chalcone synthase (‘PSCHS3’) and Ascorbate peroxidase in leaves and stems differed across 6-72 hours post-inoculation (hpi) and reflected known host resistance levels in leaves versus stems. In comparison to susceptible genotype, at 24, 48, and 72 hpi, the two genes, ‘hmm6’ (122.43, 206.99, and 32.25 fold, respectively) and ‘PSCHS3’ (175.00, 250.13, and 216.24 fold, respectively), were strongly regulated in leaves of the resistant genotype, highlighting that resistance against P. koolunga in field pea is governed by the early synthesis of pisatin. Infection of P. koolunga on leaves at 24 hpi showed clear differences in expression of target genes. For example, the gene encoding for a precursor of the defensin ‘disease resistance response protein 39’ was substantially downregulated in leaves of both the susceptible and resistant genotypes inoculated with P. koolunga. This contrasts with other studies on another pea black spot pathogen, Didymella pinodes, where this same gene is strongly upregulated in leaves of resistant and susceptible genotypes. The current study provides the first understanding of defense related genes involved in the resistance against P. koolunga, opening novel avenues to engineer new field pea cultivars with improved leaf and stem black spot disease resistance as the basis for developing more effective and sustainable management strategies. This article is protected by copyright. All rights reserved.

Black spot disease caused by the hemibiotrophic ascomycete Diplocarpon rosae is the most devastating disease of field-grown roses. Although resistance to black spot is an important trait for rose breeding, little information on the diversity of the pathogen is currently available. To date, a number of single-spore isolates have been characterized based on a set of test genotypes of the host. In this study, six polymorphic simple sequence repeat (SSR) markers for D. rosae were developed and their potential application to single-spore isolates collected from a wide range of geographic locations within and outside Europe discussed. Populations of the fungus were then analysed in different German rose collections/populations. Gene diversity was highest in older rose collections managed without fungicide application, and lowest in the two- to three-year-old testing sites of German rose breeders. Additional analyses of a global collection of single samples and populations revealed no unique alleles from any of the locations, indicating that global trading of rose varieties has led to an admixture of the pathogen.

International audience; Alternaria brassicicola (Pleosporaceae) is destructive plant fungus causing black spot disease on virtually every important cultivated Brassica species including broccoli, cabbage, canola, and mustard [1,2. The pathogen is responsible for significant economic damage as infections may occasionally lead to 20 – 50% yield reductions in crops such as canola, mustard and rape. [2]. Furthermore A. brassicicola is a potent source of mold-derived allergens inducing chronic respiratory diseases such as asthma and chronic rhinosinusitis in humans. Lichens are complex symbiotic organisms consisting of fungi and cyanobacteria or algae. They are known to produce a large variety of unique secondary metabolites some exhibiting notable anti-inflammatory, antioxidant, antibacterial but also antifungal activities [3]. Despite the wide range of studied biological activities found in lichens, very little is known about their effect on A. brassicicola. The present study therefore evaluated the antifungal activity of lichen extracts and compounds on A. brassicicola using a nephelometry based method for measuring fungal growth [1]. Crude extracts of Lasallia pustulata (Umbilicariaceae), Ramalina fastigiata (Ramalinaceae), Evernia prunastri (Parmeliaceae) and Lobaria scrobiculata (Lobariaceae) were found to exhibit interesting inhibitory activities at 68.3, 42.5, 40.0 and 34.7 percent inhibition at 25 µg/Ml, respectively. Furthermore (+) usnic acid (1) (57.5% at 72.67µM) and m-scrobiculin (2) (32.5% at 59.8µM) showed notable antifungal effects.

Alternaria brassicicola (Schwein.) Wiltshire is a phytopathogenic fungus that together with A. brassicae causes Alternaria black spot disease in Brassica species. Brassicicolin A is the major host-selective phytotoxin produced in cultures of A. brassicicola. Biosynthetic studies to establish the metabolic precursors of brassicicolin A were carried out with isotopically labeled compounds. Incorporation of D-[13C6]glucose, L-[15N]valine, or L-[2H8]valine into brassicicolin A was established using 1H, 13C, 15N NMR and INADEQUATE spectroscopy and HPLC-ESI-MS spectrometry. Based on analyses of the spectroscopic data, the labeling patterns of brassicicolin A isolated from cultures incubated with the labeled precursors are found to be consistent with both the glycolytic and the valine pathways. That is, the carbons of mannitol and acetyl units and the isocyanide carbon atoms are derived from D-[13C6]glucose whereas the hydroxyisopentanoyl and isocyanoisopentanoyl units are derived from L-valine, including the nitrogen atoms of both isocyanide groups.

RESUMO O objetivo deste trabalho foi verificar o potencial de extratos oriundos de plantas medicinais (Rosmarinus officinalis L., Equisetum arvense L. e Moringa oleifera Lam.) e produtos comerciais (a base de extratos vegetais, óleos vegetais e fosfito de potássio) no controle in vitro de Diplocarpon rosae. Avaliou-se o efeito dos tratamentos sobre o fitopatógeno pelo índice de velocidade de crescimento micelial, inibição do crescimento micelial, inibição da esporulação, índice de esporulação, síntese de proteínas, a atividade específica de peroxidase e catalase no micélio do fitopatógeno, utilizando extrato bruto aquoso (EBA) de folhas de R. officinalis (1%); EBA de caules de E. arvense (1%); EBA de sementes de M. oleifera (1%); produto comercial a base de extratos vegetais fermentados (0,01%); produto comercial a base de fosfito de potássio (0,01%); produto comercial a base de óleos vegetais (0,01%); produto a base de massa cítrica (0,01%); fungicida a base de Tiofanato metílico (0,007%); adjuvante (0,0025%) BDA e BD. Pelos resultados observou-se maior redução do crescimento de D. rosae quando na presença do produto comercial a base de óleos vegetais. O EBA de E. arvense e o produto comercial a base de extratos vegetais fermentados apresentaram efeito anti-esporulante. Os tratamentos com EBA de R. officinalis, EBA de E. arvense, EBA de M. oleifera, produto comercial a base de óleos vegetais e produto a base de massa cítrica aumentaram a síntese de proteínas no micélio D.rosae. Houve aumento da atividade específica das enzimas peroxidase e catalase no micélio quando na presença do EBA de R. officinalis e produto comercial a base de fosfito de potássio, respectivamente. O EBA de E. arvense, e os produtos comerciais a base de óleos vegetais e a base de extratos vegetais fermentados, apresentaram resultados promissores no controle do fitopatógeno D. rosae. ABSTRACT The aim of this study was to verify the potential of extracts derived from medicinal plants (Rosmarinus officinalis L., Equisetum arvense L. and Moringa oleifera Lam.) and commercial products (based on plant extracts, plant oil and potassium phosphite) on the in vitro control of Diplocarpon rosae. The effect of treatments on the phytopathogen was evaluated according to the mycelial growth speed rate, mycelial growth inhibition, sporulation inhibition, sporulation rate, protein synthesis, and peroxidase and catalase specific activity on the mycelium of the phytopathogen, using aqueous crude extract (ACE) of R. officinalis leaves (1%); ACE of E. arvense stems (1%); ACE of M. oleifera seeds (1%); commercial product based on fermented plant extracts (0.01%); commercial product based on potassium phosphite (0.01%); commercial product based on plant oil (0.01%); product based on citrus mass (0.01%); fungicide based on thiophanate methyl (0.007%); and adjuvant (0.0025%) in PDA and PD media. Results showed a higher reduction in the growth of D. rosae in the presence of commercial product based on plant oils. The ACE of E. arvense and the commercial product based on fermented plant extracts exhibited anti-sporulant effect. Treatments with ACE of R. officinalis, ACE of E. arvense, ACE of M. oleifera, commercial product based on plant oil and product based on citrus mass increased protein synthesis in D. rosae mycelium. There was increased specific activity of the enzymes peroxidase and catalase in the mycelium in the presence of ACE of R. officinalis and commercial product based on potassium phosphite, respectively. The ACE of E. arvense and the commercial products based on plant oils and fermented plant extracts showed promising results in the control of the phytopathogen D. rosae.

Marssonina brunnea (Ellis and Everh.) Magnus f. sp. brunnea Spiers is the most damaging Marssonina sp. affecting Populus spp. in the world (1). First described from eastern North America at the turn of the century, it subsequently became a serious disease of hybrid poplar in Europe in the 1960s and in New Zealand in 1976 (1). It causes punctiform black spots on both leaf surfaces and lesions on petioles and young stems. Symptoms are typically most severe in the lower portion of the crown of trees. Not observed in the Pacific Northwest on hybrid poplar until recently, it is still only present in a few locations. Voucher specimens from near Ilwaco, WA, at the mouth of the Columbia River, and from near Har-rison Mills, British Columbia, were deposited in the Herbarium at the Pacific Forestry Centre (DAVFP 25202 and 24958, respectively). The fungus was identified as M. brunnea by its conidial morphology. Conidia were hyaline, uniseptate, mostly straight, and narrowly obovoid, and, when measured in lactoglycerol, averaged 16.1 μm × 5.0 μm (WA collection) and 15.7 μm × 5.6 μm (BC collection). The septum is located about 30% of the total conidium length from the conidium base. Inoculations of leaf disks (1) proved that the species was pathogenic to hybrids but not to local P. tremuloides Michx., and thus the fungus was identified as M. brunnea f. sp. brunnea. Variation in resistance, from light spotting to severe, was noted both among 12 P. trichocarpa Torr. & A. Gray × P. deltoides J. Bartram ex. Marsh. hybrid clones in the Ilwaco plantation and among 56 hybrid clones in the inoculation study. Reference: (1) A. G. Spiers. Eur. J. For. Pathol. 18:140, 1988.

In 3 consecutive years, preharvest applications of Bacillus subtilis field sprays integrated with copper oxychloride or benomyl consistently reduced severity of avocado black spot (BS), caused by Pseudocercospora purpurea at Omega, Republic of South Africa. Control was equal to that obtained with copper oxychloride or benomyl-copper oxychloride in the first and third years of spraying at Omega. In the second year, only the integrated treatment controlled BS, while copper oxychloride proved ineffective. The antagonist was applied on its own or integrated with copper oxychloride sprays at two other geographically distinct locations, Westfalia Estate and Waterval. The integrated and biological treatments at these localities were less effective than copper oxychloride sprays in controlling BS disease. Integrated control was more effective than B. subtilis sprays at Westfalia. On continuation of the biological spray program at Waterval for an additional three seasons, control was as effective as copper oxychloride in the last 2 years of spraying. Sooty blotch (SB), caused by an Akaropeltopsis sp., was reduced by the integrated treatment at Omega during the second season and at Westfalia during the first season. Although the two fungicide treatments reduced SB at Omega in the first season, copper oxychloride increased it above that of the control in the third season. Only the copper oxychloride treatment reduced SB at Waterval in the third season, while the B. subtilis treatment increased disease above that of the control in the fourth season.

A severe epidemic of a leaf blight of cotton occurred in the state of Paraná, Brazil, during 1994 and 1995, causing up to 100% yield losses in some commercial fields of cultivar Paraná 3. The severity of the disease among fields was variable and cultivar-dependent. Attempts were made to identify the organism causing the leaf blight symptoms, which were characterized as circular to irregular dark brown to black spots turning reddish brown with age and varying between 2 and 10 mm in diameter. The older lesions showed cracks and/or holes in the center. Severely diseased leaves dried rapidly and abscised. Fructifications of a fungus in the genus Stemphylium were observed on young, as well as on old, lesions. The Stemphylium sp. was consistently isolated on potato dextrose agar from disease samples collected from five cultivars in 14 locations. In inoculation tests, the Stemphylium isolates from cotton were highly aggressive to cotton, tomato, potato, and blue lupines; whereas an isolate of S. solani from tomato was highly aggressive on tomato and potato but less aggressive on cotton. On the basis of its morphological, cultural, and pathogenic characteristics, the principal pathogen causing leaf blight symptoms was identified as Stemphylium solani. Epidemics caused by S. solani on cotton have not been reported previously in commercial cotton cultivation.

Fungicides were evaluated for their efficacy against black spot of rose, caused by Diplocarpon rosae, when applied during winter months to hybrid tea rose plants in two studies. One study, conducted at two Auburn University campus sites, consisted of applications of horticultural oil, chlorothalonil plus an antitranspirant, and cyproconazole, along with nontreated plants; one site included triforine applications. Rose canes were treated two and three times between late October and February in 1996-97 and 1997-98, respectively; then plants were examined every 2 to 4 days beginning in mid-February for onset of symptoms of black spot. In both years, winter applications of fungicides (chlorothalonil, cyproconazole, and triforine) delayed disease onset compared with treatments without fungicides (nontreated and oil applications). Decreased plant defoliation, as well as improved plant vigor, were observed through the 1998 growing season following fungicidal winter treatments at campus sites; winter treatments with oil did not suppress disease compared with no treatment. In a second study started in November 1997, at a site near Shorter, AL, three systemic fungicides (myclobutanil, cyproconazole, and triforine) were applied to rose canes during the winter; nontreated plants were included. Decreased disease symptoms and defoliation of rose plants were observed early in the 1998 and 1999 seasons following winter applications of cyproconazole and triforine compared with myclobutanil or nontreated plants. Winter treatments with these fungicides did not consistently provide season-long reduction of black spot. However, season-long plant vigor and flower production on plants were improved at the Shorter site following winter applications of any of the above systemic fungicides compared with nontreated plants.

Ascospores produced on diseased leaves in the leaf litter constitute the primary inoculum causing scab in commercial apple orchards in the northeastern United States. Two sanitation practices, shredding the leaf litter with a flail mower and urea application, were evaluated for their potential to reduce the risk of primary scab. Three measures of a treatment's potential were made: leaf litter density was evaluated to determine reduction of the source or primary inoculum; trapped ascospores were counted to measure the reduction of primary inoculum; and scab lesions on trees and seedlings were counted to determine reduction in disease incidence and severity on leaves and fruit. The results show that in the northeastern United States, shredding the leaf litter in November or April will reduce the risk of scab by 80 to 90% if all of the leaf litter is shredded. If 10 to 35% of the leaf litter cannot be shredded because of the limited offset of the flail mower and spread of the tree canopy, then the risk of scab is reduced by 50 to 65%. Urea applied to the leaf litter in November (when approximately 95% of the leaves had fallen) reduced the number of ascospores trapped by 50%. Urea applied to the leaf litter in April (before bud break) reduced the number of ascospores trapped by 66%. The reductions are discussed in relation to a sanitation action threshold that links sanitation to a strategy that reduces the fungicide dose to control primary scab in an orchard assessed with a moderate amount of foliar scab the previous autumn.

Rhamnus purshiana, or cascara, is a deciduous tall shrub or small tree as much as 9 m high with thin, smooth, silver-gray bark. It is often present in shady sites in redwood and mixed evergreen forests of the North Ameri-can west coast, from British Columbia to northern California. In July 2005, symptomatic leaves with irregular, black spots, 2 to 5 mm in diameter and concentrated toward the tips, were collected from four cascara plants in the Samuel P. Taylor State Park, Marin County, California. There was no evidence of defoliation. Pieces of necrotic tissue were plated on selective medium (PARP) and maintained at 19°C for 2 weeks. A Phytophthora sp. was consistently isolated and it was identified as P. ramorum on the basis of morphological and molecular traits published previously (3,4). The P. ramorum isolate Pr-418 has been deposited in the American Type Culture Collection (ATCC MYA-3676) and a portion of the internal transcribed sequence (ITS) of rDNA has been deposited in the NCBI database (GenBank Accession No. DQ168874). Koch's postulates were completed using the leaf-dip method (2) on detached leaves collected from three cascara plants growing at the University of California Botanical Garden at Berkeley. Zoospore inoculum was prepared by flooding a 2-week-old culture growing on V8 agar with sterile water for 4 days. The liquid was filtered after cold shocking at 4°C for 30 min and incubated at room temperature for 1 h. Fifteen leaves were dipped in the resulting zoospore suspension (1.6 × 104 zoospores per ml) for either 1 min (experiment 1) or overnight (experiment 2). Leaves used as negative controls were dipped in sterile water. After removal from the inoculum, excess liquid was allowed to drain. Leaves were maintained in a moist chamber at 19°C with 13 h of natural light for 1 week. After 3 days of incubation, necrotic spots similar to those observed in the field had developed on leaves in experiment 2, while no symptoms were observed in experiment 1. Necrotic lesions were observed on 12 and 15 of 15 leaves in experiments 1 and 2, respectively, after 7 days of incubation. For each leaf, the necrotic area and percent necrosis was determined by placing the leaves in a flatbed scanner and processing the images with Assess (Version 1.01; The American Phytopathological Society, St. Paul, MN). Lesions extended from the tip of the leaves and covered 3 ± 1% of the total leaf area in experiment 1 and 33 ± 3% in experiment 2. Reisolation of P. ramorum on PARP was successful for all inoculated leaves. P. ramorum was never isolated from negative controls and no symptoms of infection were observed. The leaf-dip inoculation method is a rapid and reliable indicator of host susceptibility to P. ramorum, with many species developing necrosis when exposed to high concentrations of zoospores (3). Our results show that exposure time to the pathogen can play an important role in the development of symptoms. R. purshiana has been previously reported as a host in Oregon (1,2), but to our knowledge, this is the first report of cascara as a natural host of P. ramorum in the state of California. Our results confirm those from Oregon (2). The impact of infection by P. ramorum on cascara is unknown. References: (1) J. M. Davidson et al. Plant Health Prog. DOI:10.1094/PHP-2003-0707-01-DG, 2003. (2) E. Hansen et al. Plant Dis. 89:63, 2005. (3) D. M. Rizzo et al. Plant Dis. 86:205, 2002. (4) S. Werres et al. Mycol Res. 105:1155, 2001.

Anthracnose of grapes is an economically devastating disease caused by Elsinoe ampelina (2). Warm, humid weather favors disease development, and therefore in the United States, it is generally restricted to grape-growing areas east of the Rocky Mountains. Vitis vinifera is highly susceptible to the disease, which is one of the principal factors preventing the development of an industry with this high-quality grape in the southeastern United States. Growers in this area produce local species-such as muscadine grapes (V. rotundifolia Michx.) and hybrids. Muscadine grapes are known for their resistance or “immunity” to many diseases found in bunch (Euvitis spp. Planch.) grape species (1). As yet, there has been no formal report of anthracnose or its causal agent on muscadine grapes. E. ampelina was detected on muscadine leaves for the first time in the experimental vineyard at the Center for Viticulture and Small Fruit Research during the summer of 2006. Approximately 40% of the 52 muscadine cultivars in the collection showed circular or irregular black spots typical of anthracnose mainly on young leaves and tendrils. However, no symptoms were observed on fruits, shoot tips, or any other plant part. To confirm the causal agent, infected leaves were surface sterilized with 75% ethanol, dipped in 2% sodium hypochlorite for 15 s, rinsed in distilled water, dissected into small 0.5-cm leaf discs, and plated on potato dextrose agar (PDA) and incubated at 28°C. Single-spore isolates were grown on PDA. Colonies were slow growing and appeared as dark red mounds with some mycelia. Conidia were cylindrical and hyaline with pointed ends consistent with previous reports for E. ampelina (2). The identity was also confirmed by using the following PCR primers to the 18S RNA: left primer; TCCGTAGGTGAACCTGCGGA and right primer; TCCTACCTGAT CCGAGGTCA designed on the basis of the alignment of E. ampelina sequences deposited in NCBI database. To fulfill Koch's postulates, symptoms were reproduced by artificial inoculation onto young muscadines (cv. Carlos) and bunch (cv. Cabernet Sauvignon) grapevines. A conidial suspension was prepared from single-conidial cultures, and three experimental vines of each species were sprayed with 0.5 ml of suspension (2 × 105 conidia per ml), whereas three control plants were sprayed with distilled water. The plants were incubated in a moist chamber at 28°C with 16 h of light. The first typical symptoms appeared on V. vinifera 4 days postinoculation and on the muscadines 6 days postinoculation. To our knowledge, this is the first report confirming anthracnose disease on muscadine grapes. References: (1) J. Lu et al. Acta Hortic. 528:479, 2000. (2) R. C. Pearson and A. C. Gohen. Anthracnose. Pages 18–19 in: Compendium of Grape Diseases. The American Phytopathological Society. St. Paul, MN, 1994.

In May 2007, a survey was conducted to evaluate the phytosanitary status of grapevine propagating materials in a commercial nursery located in Valencia Province (eastern Spain). Fungal isolation was performed on 25 grafted plants (1-year-old grapevines cv. Tempranillo grafted onto 110 R rootstock) because they showed reduced root biomass and black discoloration of the xylem vessels. Sections (10 cm long) were cut from the basal end of the rootstocks, washed under running tap water, surface sterilized for 1 min in a 1.5% sodium hypochlorite solution, and washed twice with sterile distilled water. The sections were split longitudinally and small pieces of discolored tissues were placed onto malt extract agar (MEA) supplemented with streptomycin sulfate (0.5 g L–1). Plates were incubated at 25°C in the dark for 14 to 21 days after which all colonies were transferred to potato dextrose agar (PDA). Togninia minima (Tul. & C. Tul.) Berl. (anamorph Phaeoacremonium aleophilum W. Gams, Crous, M.J. Wingf. & Mugnai) and another Phaeoacremonium sp. were consistently isolated from necrotic tissues. Single conidial isolates of this Phaeoacremonium sp. were grown on PDA and MEA in the dark at 25°C for 2 to 3 weeks until colonies produced spores (3). Colonies were grayish brown on PDA and pinkish white on MEA. Conidiophores were mostly short and unbranched, 15 to 30 (mean 20.8) μm long, often consisting of an elongate-ampuliform phialide. Conidia were hyaline, oblong-ellipsoidal occasionally reniform or allantoid, 2.5 to 5.6 (mean 3.8) μm long, and 1 to 2.1 (mean 1.4) μm wide. On the basis of these characteristics, these isolates were identified as Phaeoacremonium scolyti L. Mostert, Summerb. & Crous (2,3). Identity of isolate Psc-1 was confirmed by PCR-restriction fragment length polymorphism of the internal transcribed spacer region using Phaeoacremonium-specific primers Pm1-Pm2 and restriction enzymes BssKI, EcoO109I, and HhaI (1). Additionally, the β-tubulin gene fragment (primers T1 and Bt2b) of this isolate was sequenced (GenBank Accession No. EU260415). The sequence showed high similarity (98%) with the sequence of P. scolyti (GenBank Accession No. AY579292). Pathogenicity tests were conducted on 2-month-old grapevine seedlings (cv. Tempranillo) using the isolate Psc-1. Ten seedlings were inoculated when two to three leaves had emerged by watering the roots with 25 mL of a conidial suspension (106 conidia mL–1) harvested from 21-day-old cultures grown on PDA. Ten controls plants were inoculated with sterile distilled water. Seedlings were maintained in a greenhouse at 23 to 25°C. Within 2 months of inoculation, symptoms developed on all of the inoculated plants as crown necrosis, chlorotic leaves, severe defoliation, and wilting. Control plants did not show any symptoms. The fungus was reisolated from internal tissues of the crown area and the stems of all inoculated seedlings, completing Koch's postulates. To our knowledge, this is the first report of P. scolyti causing Petri disease in Spain. References: (1) A. Aroca and R. Raposo. Appl. Environ. Microbiol. 73:2911, 2007. (2) L. Mostert et al. J. Clin. Microbiol. 43:1752, 2005. (3) L. Mostert et al. Stud. Mycol. 54:1, 2006.

Bacterial canker of mango (or bacterial black spot), caused by Xanthomonas citri pv. mangiferaeindicae, is an economically important disease in tropical and subtropical producing areas (1). X. citri pv. mangiferaeindicae can cause severe infection in a wide range of mango cultivars and induces raised, angular, black leaf lesions, sometimes with a chlorotic halo. Several months after infection, leaf lesions dry and turn light brown or ash gray. Severe leaf infection may result in abscission. Fruit symptoms appear as small water-soaked spots on the lenticels. These spots later become star shaped, erumpent, and exude an infectious gum. Often, a “tear stain” infection pattern is observed on the fruit. Severe fruit infections will cause premature fruit drop. Twig cankers are potential sources of inoculum and weaken resistance of branches to wind damage. Leaf lesions with suspected bacterial canker were collected in January 2010 from mango trees cv. Keitt in several blocks at the Integrated Tamale Fruit Company, Ghana. Non-pigmented Xanthomonas-like bacterial colonies were isolated on Kasugamycin-Cephalexin semiselective agar medium (3). On the basis of IS1595-Ligation Mediated-PCR data, 16 strains from Ghana produced identical fingerprints and were identified as X. citri pv. mangiferaeindicae (4). The haplotype corresponding to the Ghanaian strains had not been previously reported. On the basis of multidimensional scaling (4), this haplotype clustered together with a group of strains from multiple origins and the analysis was not informative as an aid for tracing back the outbreak. Five Ghanaian strains (LH2-3, LH2-6, LH2-8, LH2-11, and LH2-15) were compared by multilocus sequence analysis to the type strain of X. citri and the pathotype strain of several X. citri pathovars, including pvs. anacardii and mangiferaeindicae. This assay targeted the atpD, dnaK, efp, and gyrB genes as described previously (2). Nucleotide sequences were 100% identical to those of the pathotype strain of X. citri pv. mangiferaeindicae whatever the gene assayed, but differed from any other assayed X. citri pathovar. Mango cv. Maison Rouge leaves from the youngest vegetative flush were infiltrated (10 inoculation sites per leaf, three replicate plants) using inoculum of each of the same five Ghanaian strains made from suspensions in Tris buffer containing ~1 × 105 CFU/ml. Negative control treatments consisted of leaves infiltrated with sterile Tris buffer. Typical symptoms of bacterial canker were observed for all assayed strains a week after inoculation. No lesions were recorded from the negative control. One month after inoculation, mean X. citri pv. mangiferaeindicae population sizes ranging from 4 × 107 to 1 × 108 CFU/lesion were recovered from leaf lesions, typical of a compatible interaction (1). High disease prevalence was observed in Ghana, indicating the suitability of environmental conditions in this region for the development of mango bacterial canker. The budwood for these blocks was imported from Burkina Faso in 2002 and symptoms were observed in these blocks shortly after establishment. To our knowledge, this is the first report of mango bacterial canker in Western Africa. References: (1) N. Ah-You et al. Phytopathology 97:1568, 2007. (2) L. Bui Thi Ngoc et al. Int. J. Syst. Evol. Microbiol. 60:515, 2010. (3) O. Pruvost et al. J. Appl. Microbiol. 99:803, 2005. (4) O. Pruvost et al. Phytopathology. Online publication. DOI:10.1094/PHYTO-11-10-0304, 2011.

Avocado (Persea americana L.) production for export markets has increased in Mexico during the past 10 years. The production system, however, is affected by several sanitation factors, including diseases. During the spring of 2009, smooth, black, circular spots were noted on the surface of avocado fruit. A study was conducted during the winter of 2010 to ascertain the etiology and identify the fungus associated with black spot symptoms on avocado fruit in orchards of Nuevo Parangaricutiro County (19°25′00″ and 102°07′43″) in Michoacan, Mexico. Several fungal isolates were obtained on potato dextrose agar (PDA) from the margin of lesions on immature fruit. The internal transcribed spacer region (ITS) of the rDNA from representative isolates was sequenced with universal primers ITS5 and ITS4 (2). BLAST searches in GenBank showed 100% similarity of the nucleotide sequences with Neofusicoccum parvum (Pennycook & Samuels) Crous, Slippers & A.J.L. Phillips, GenBank Accession Nos. GU188001 to GU188007 and GU187985 to GU187987. A representative nucleotide sequence of this region was deposited in GenBank under the Accession No. JN203129. Strains of N. parvum produced aerial and compact mycelium on acidified PDA, the anamorph state of Botryosphaeria parva. Mycelium was initially white, turning gradually gray to black. Conidia were one celled, hyaline, ellipsoidal to fusiform, externally smooth, thin walled, nonseptate, with one or two septa with age, and an average length and width of 14.5 (9.5 to 19) × 5.8 (4.0 to 7.2) μm (n = 100). Pathogenicity tests were conducted with six avocado fruit cv. Hass. Fruit were inoculated at three evenly spaced locations on the fruit surface, either by wounding the tissue with a needle that had been dipped in a conidial mass from an 8-day-old monoconidial culture of N. parvum strain CIAD-021-11 or by placing 5 μl of 1 × 106 conidia ml–1 suspension on each inoculation site. Inoculated fruit were maintained in a moist chamber at 25°C for 2 weeks. Black lesions appeared on all wounded sites 2 days postinoculation (dpi) and on unwounded sites 4 dpi. The delay of symptom development was likely due to penetration through the lenticels, which took longer to initiate infection. No symptoms were observed in the control fruit. The pathogen was reisolated from the lesions of all inoculated fruit, thus fulfilling Koch's postulates. The results confirmed the pathogenic potential of this fungus and indicated its possible involvement in the etiology of black spot on avocado fruit. N. parvum is a cosmopolitan, plurivorous pathogen causing disease in several hosts of economic importance, such as grapes and kiwi, as well as causing stem-end rot of avocado fruit in New Zealand (1) and avocado twigs in Spain (3). To our knowledge, this is the first report of N. parvum causing black spots on avocado fruit in Mexico. References: (1) W. F. T. Hartill et al. N.Z.J. Crop Hortic. Sci. 30:249. 2002. (2) T. J. White et al. Page: 315 in: PCR Protocols: A Guide to Methods and Application. M. A. Innis et al., eds. Academic Press, San Diego, CA, 1990. (3) T. Zea-Bonilla et al. Plant Dis. 91:1052, 2007.

Schisandra chinensis (Turcz.) Baill is a perennial liana belonging to the Schisandra genus of the family Magnoliaceae, which is cultivated in China as an important medicinal plant. In the summer of 2008, we observed a previously unknown foliar disease on the schisandras in Jingyu and Antu counties and the cities of Ji'an and Hunchun in Jilin Province. Symptoms appeared on the apex, margin, and center of leaves. The infection initially manifested as pale brown, small, necrotic spots on the leaves. Subsequently, these lesions became grayish brown in the center and dark brown with slight protuberances at the margins. Finally, these lesions developed concentric rings with a clear boundary separating them from the healthy tissue, were round to elliptical or irregular in shape, and had a diameter of 3 to 5 mm. In severely infected leaves, these spots eventually covered the entire leaf. Black spots (pycnidia) were produced on the infected leaf tissues in a humid environment. Fungus from infected leaf tissues was isolated on potato dextrose agar. The cultures were initially pale brown and turned dark green with age. Embedded pycnidia were generally formed after 5 days. The pycnidia were agglutinating, globose to subglobose, and measured 60.0 to 212.0 × 33.6 to 268.0 μm. Abundant conidia (4.06 to 7.2 × 1.65 to 3.53 μm) exhibiting zero to three oil droplets were produced by an 8-day-old colony; these conidia were ovoid or ellipsoidal, colorless, and aseptate; they were similar to conidia of Phoma glomerata. The internal transcribed spacer (ITS) sequence of rDNA of the isolated pathogenic strain (PG11; GenBank Accession No. GU724511) had 100% identity to P. glomerata (GenBank Accession No. HM769279). Therefore, the pathogen was identified as P. glomerata (Corda) Wollenw. & Hochapfel on the basis of morphology and ITS sequence data. To validate Koch's postulates, schisandra leaves were spray inoculated with a 2.5 × 105 conidia/ml suspension of the isolated pathogen. An equal number of healthy plants were inoculated with sterile water (control). After inoculation, 10 plants were covered with plastic bags for 3 days and maintained in a growth chamber at 25°C. After 8 days, all inoculated plants showed symptoms identical to those observed on the schisandra leaves infected in the field, whereas the controls did not show any symptoms. Reisolation of the fungi from lesions of inoculated leaves confirmed that the causal agent was P. glomerata. Diseases caused by P. glomerata have been reported on some plants (1,2). However, to our knowledge, this is the first report of leaf spot disease caused by P. glomerata on S. chinensis in China as well as in the world. References: (1) J. S. Chohan et al. Trans. Br. Mycol. Soc. 75:509, 1980. (2) T. Thomidis et al. Eur. J. Plant Pathol. 131:171,2011.

In the 1990s, pistachio (Pistacia vera L. ‘Kerman’ and ‘Peters’) was introduced in China. They are found in many orchards in Beijing and Gansu and Hebei provinces, northern China. In 2009, a new disease was observed on leaves, stems, and fruits in pistachio orchards in Gansu Province. Disease incidence in 8- to 12-year-old orchards was 30%. Yield losses reached 25%. Symptoms began as discrete, sunken, black spots, approximately 10 mm in diameter, followed by circular lesions that eventually coalesced with tissue death recorded and orange fructifications developed on lesions. Pieces of diseased leaves, stems, and fruits were surfaced sterilized and placed on 2% potato dextrose agar (PDA) at 25°C. A fungus was consistently isolated. After 10 days, cultures on PDA showed aerial, white mycelium that turned gray to grayish black with a salmon-to-orange conidial mass at 25°C and a 12-h photoperiod. Brown, 80 to 120 μm long setae were observed in the acervulus. Conidia were hyaline, fusiform to nearly straight, and averaged 12 to 18 × 3 to 5 μm. On the basis of morphological characteristics, the fungus was identified as Colletotrichum gloeosporioides (Penz.) Sacc. (2). On PDA, 0.5 μg/ml of benomyl was applied for the sensitivity test (3). Benomyl completely inhibited the growth of the fungus. Mycelial DNA was extracted, PCR amplified using ITS1 and ITS4 primers for the ribosomal DNA internal transcribed spacers 1 and 2, and sequenced. The DNA sequence was recorded in GenBank as No. HQ631378. The DNA sequence was blasted showing 99% identity with Accession Nos. GQ144454 and GU004376, for C. gloeosporioides. Pathogenicity tests were conducted under greenhouse conditions at 25°C. Three replicates of 2-year-old ‘Kerman’ plants were inoculated with mycelial PDA plugs placed on 0.5-cm2 stem wounds and then wrapped with Parafilm. Controls were inoculated with PDA plugs without the fungus. After 3 weeks, stem cankers were observed on inoculated plants. Control plants remained healthy. Pathogenicity was also tested on injured leaves and fruits. A 10-μl drop of a spore suspension of 104 conidia/ml was applied on ‘Kerman’ and ‘Peters’ leaves and ‘Kerman’ fruits and placed on plates with a wet filter paper at 25°C. Small, black lesions were observed at 2 days after inoculation. At 7 days, necrotic lesions covered the entire surface. C. gloeosporioides was reisolated from necrotic lesions. Controls did not develop symptoms. C. acutatum has been reported on pistachio in Australia (1), but to our knowledge, this is the first report of anthracnose caused by C. gloeosporioides on pistachio. References: (1) G. J. Ash and V. M. Lanoiselet. Australas. Plant Pathol. 30:365, 2001. (2) J. Y. Lu. Plant Pathogenic Mycology. China Agricultural Press, Beijing, 2001. (3) N. A. R. Peres et al. Plant Dis. 86:620, 2002.

Paper mulberry, Broussonetia papyrifera (L.) Venten. (family Moraceae), is a fast-growing tree with luxuriant branches and leaves. Because of strong adaptability and tolerance to unfavorable environmental conditions, it is an important tree species for shade or shelter and reforestation in mined areas and on hillsides. During the summer of 2010, brown-to-black spots were observed on leaves of paper mulberry in Baiwangshan Forest Park in Beijing, China. Early symptoms were round or elliptic, light brown, small lesions that later extended to round or irregular spots (4 to 6 × 4 to 8 mm) that were dark brown or black in the center with brown or light brown margins. Several dozen spots were found on severely infected leaves. Leaf tissues (2 × 2 mm), cut from the margins of lesions, were surface disinfected in 0.5% NaOCl solution for 3 min, rinsed three times with sterile water, plated on potato dextrose agar (PDA) and incubated at 25°C with a 12-h light and 12-h dark period. Numerous waxy subepidermal acervuli with setae were observed after 3 days. Acervuli were brown or black, round or elongate, and 100 to 250 μm in diameter. Setae were dark brown, erect straight or slightly curved, and 60 to 74 × 4 to 8 μm with one to two septa. Conidiophores were hyaline or light brown, short with no branches, and cylindrical with dimensions of 12 to 21 × 4 to 5 μm. Conidia were 11 to 21 × 3 to 6 μm, hyaline, aseptate, and cylindrical. Mycelia on PDA were off white-to-dark gray on the reverse side of the colony. Six isolates (BP21-1 to BP21-6) were obtained from different infected leaves and identified as Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. (teleomorph Glomerella cingulata (Stonem.) Spaulding & Schrenk) on the basis of reverse colony color, dimensions and colors of acervuli, conidiophores, and conidia (3). ITS1-5.8S-ITS2 rDNA sequence analysis was performed on all six isolates. The resultant sequences were identical (GenBank Accession No. HQ 654780) and revealed 99% similarity (100% coverage) with C. gloeosporioides isolates in the GenBank (Accession Nos. EU371022.1 and AY376532.1) (2). Pathogenicity was demonstrated using six potted 3-month-old paper mulberry trees. Isolate BP21-2 was grown on PDA for 14 days and conidia were harvested to prepare a suspension of 106 conidia/ml. Three plants were sprayed with the conidial suspension and three were sprayed with sterile water. All trees were covered with plastic bags for 24 h to maintain high humidity and incubated at 25°C for 6 days. All conidia-inoculated trees showed identical symptoms as the infected leaves in the park, while the control trees remained symptom free. Reisolation of the fungus confirmed that the causal agent was C. gloeosporioides. C. gloeosporioides is distributed worldwide causing anthracnose on a wide variety of plants including members of mulberry family Moraceae, e.g., mortality of stem cuttings and death of saplings on mulberry (Morus alba L.) in India (1). To our knowledge, this is the first report of C. gloeosporioides causing black spots on paper mulberry in China. References: (1) V. P. Gupta et al. Indian Phytopathol. 50:402, 1997. (2) K. D. Hyde et al. Fungal Divers. 39:147, 2009. (3) J. E. M. Mordue. No. 315 in: Descriptions of Pathogenic Fungi and Bacteria. CMI. Kew, Surrey, UK, 1971.

Black spot is a major disease of field pea (Pisum sativum L.) production across southern Australia. Known causal agents in Australia include one or more of Mycosphaerella pinodes (Berk. & Bloxam) Vestergr., Phoma medicaginis var. pinodella (L.K. Jones), Ascochyta pisi Lib., or P. koolunga (Davidson, Hartley, Priest, Krysinska-Kaczmarek, Herdina, McKay & Scott) (2), but other pathogens may also be associated with black spot symptoms. Black spot generally occurs on most plants and in most pea fields in Western Australia (W.A.), and during earlier winter/spring surveys of blackspot pathogens, some isolates were tentatively allocated to P. medicaginis var. pinodella despite different cultural characteristics on potato dextrose agar (PDA). Recently, single-spore isolations of a single culture each from an infested pea crop at Medina, Moora, and Mt. Barker in W.A. were made onto PDA. A PCR-based assay with TW81 and AB28 primers was used to amplify from the ITS-5.8S rDNA region. Purified DNA products were sequenced for the three isolates and then BLASTn was used to compare sequences with those in GenBank. Our sequences (GenBank Accession Nos. JN37743, JN377439, and JN377438) had 100% nucleotide identity with P. exigua Desm. var. exigua accessions (GI13385450, GI169894028, and GI189163921), an earlier synonym of what is now known as Boeremia exigua var. exigua ([Desm.] Aveskamp, Gruyter & Verkley) (1). Davidson et al. (2) used the same primers to identify P. koolunga, but none of our isolates were P. koolunga. A suspension of 107 conidia ml–1 of each representative isolate was inoculated onto foliage of 15-day-old field pea cv. Dundale plants and maintained at >90% relative humidity for 72 h postinoculation. Control plants inoculated with just water remained symptomless. Brown lesions were evident by 8 to 10 days postinoculation and mostly 1 to 3 mm in diameter. B. exigua var. exigua was readily reisolated from infected leaves. Isolates have been lodged in the W.A. Culture Collection Herbarium maintained at the Department of Agriculture and Food W.A. (Accession Nos. WAC13500, WAC13502, and WAC13501 from Medina, Moora, and Mt. Barker, respectively). Outside Australia, its synonym P. exigua var. exigua is a known pathogen of field pea (4), other legumes including common bean (Phaseolus vulgaris L.) (4) and soybean (Glycine max [L.] Merr.) (3), and is known to produce phytotoxic cytochalasins. In eastern Australia, P. exigua var. exigua has been reported on common bean (1930s and 1950s), phasey bean (Macroptilium lathyroides [L.] Urb.) and siratro (M. atropurpureum (DC.) Urb.) (1950s and 1960s), mung bean (Vigna radiata [L.] Wilczek.) (1960s), ramie (Boehmeria nivea [L.] Gaudich.) (1939), potato (Solanum tuberosum L.) (1980s), and pyrethrum (Tanacetum cinerariifolium [Trevir.] Schultz Bip.) (2004 and 2007) (Australian Plant Pest Database). To our knowledge, this the first report of B. exigua var. exigua on field pea in Australia, and because of its potential to be a significant pathogen on field pea, warrants further evaluation. References: (1) M. M. Aveskamp et al. Stud. Mycol. 65:1, 2010. (2) J. A. Davidson et al. Mycologia 101:120, 2009. (3) L. Irinyi et al. Mycol. Res. 113:249, 2009. (4) J. Marcinkowska. Biul. Inst. Hod. Aklim. Rosl. 190:169, 1994.

In March 2010, citrus black spot symptoms were observed on sweet orange trees in a grove near Immokalee, FL. Symptoms observed on fruit included hard spot, cracked spot, and early virulent spot. Hard spot lesions were up to 5 mm, depressed with a chocolate margin and a necrotic, tan center, often with black pycnidia (140 to 200 μm) present. Cracked spot lesions were large (15 mm), dark brown, with diffuse margins and raised cracks. In some cases, hard spots formed in the center of lesions. Early virulent spot lesions were small (up to 7 mm long), bright red, irregular, indented, and often with many pycnidia. In addition, small (2 to 3 mm), elliptical, reddish brown leaf lesions with depressed tan centers were observed on some trees with symptomatic fruit. Chlorotic halos appeared as they aged. Most leaves had single lesions, occasionally up to four per leaf. Tissue pieces from hard spots and early virulent spots were placed aseptically on potato dextrose agar (PDA), oatmeal agar, or carrot agar and incubated with 12 h of light and dark at 24°C. Cultures that grew colonies within a week were discarded. Fourteen single-spore cultures were obtained from the isolates that grew slower than the Guignardia mangiferae reference cultures, although pycnidia formed more rapidly in the G. mangiferae cultures (1). No sexual structures were observed. Cultures on half-PDA were black and cordlike with irregular margins with numerous pycnidia, often bearing white cirrhi after 14 days. Conidia (7.1 to 7.8 × 10.3 to 11.8 μm) were hyaline, aseptate, multiguttulate, ovoid with a flattened base surrounded by a hyaline matrix (0.4 to 0.6 μm) and a hyaline appendage on the rounded apex, corresponding to published descriptions of G. citricarpa (anomorph Phyllosticta citricarpa) (1). A yellow pigment was seen in oatmeal agar surrounding G. citricarpa, but not G. mangiferae colonies as previously reported (1,2). DNA was extracted from lesions and cultures and amplified with species-specific primers (2). DNA was also extracted from G. mangiferae and healthy citrus fruit. The G. citricarpa-specific primers produced a 300-bp band from fruit lesions and pure cultures. G. mangiferae-specific primers produced 290-bp bands with DNA from G. mangiferae cultures. The internally transcribed spacer (ITS) of the rRNA gene, translation-elongation factor (TEF), and actin gene regions were sequenced from G. citricarpa isolates and deposited in GenBank. These sequences had 100% homology with G. citricarpa ITS sequences from South Africa and Brazil, 100% homology with TEF, and 99% homology with actin of a Brazilian isolate. Pathogenicity tests with G. citricarpa were not done because the organism infects immature fruit and has an incubation period of at least 6 months (3). In addition, quarantine restrictions limit work with the organism outside a contained facility. To our knowledge, this is the first report of black spot in North America. The initial infested area was ~57 km2. The disease is of great importance to the Florida citrus industry because it causes serious blemishes and significant yield reduction, especially on the most commonly grown ‘Valencia’ sweet orange. Also, the presence of the disease in Florida may affect market access because G. citricarpa is considered a quarantine pathogen by the United States and internationally. References: (1) R. P. Baayen et al. Phytopathology 92:464, 2002. (2) N. A. Peres et al. Plant Dis. 91:525, 2007 (3) R. F. Reis et al. Fitopath Bras. 31:29, 2006.

Watermelon (Citrullus lanatus (Thunb.) Matsum. & Nakai), an important member of the Cucurbitaceae family, is cultivated on 21,000 ha that produces 850,000 t in Korea. In April 2011, we received grafted watermelon with necrotic leaf spots from a commercial watermelon grower in Andong, Korea. Black spots were observed on cotyledons of the plants in seedbeds, and approximately 9% of watermelon plants were infected with the disease. Initial symptoms on the seedling were black, greasy spots sometimes surrounded by a halo of discoloration. Younger leaves usually showed symptoms later than cotyledons. Bacteria isolated from the infected plants were gram-negative, motile, straight rods with a single flagellum and 0.84 to 0.89 μm wide and 1.54 to 1.69 μm long. They formed rough colonies with a white-cream color after 48 h of incubation on Luria-Bertani (LB) agar at 28°C. Colonies of isolates were nonfluorescent, smooth, and white on King's medium B. On YBGA (7 g of yeast extract, 7 g of bactopeptone, 7 g of glucose, 15 g of agar, 1,000 ml of distilled water; pH 7.2) colonies are circular, raised with an entire margin, and white to cream. Pathogenicity tests were conducted with potted, greenhouse-grown watermelon plants. Bacterial colonies grown on LB medium for 48 h at 28°C were suspended in sterile distilled water, and the suspension (1.0 × 108 CFU/ml) was infiltrated into mesophyll of watermelon leaves with a syringe as previously described (2). Inoculated plants were maintained at 28°C and 90% relative humidity in a growth chamber with a daily 12-h photoperiod of fluorescent light. Five plants were used for inoculation. Sterilized distilled water was used as a control. The bacterial isolates induced necrosis in the infiltrated area within 3 to 5 days. Typical water-soaked spots appeared after 3 days of incubation and became gray to black after 6 days. The bacterium was successfully reisolated from the diseased lesions, thus completing Koch's postulates. A cell suspension (50 μl of 1 × 106 CFU/ml) was infiltrated with a syringe into the intercellular spaces of tobacco leaves to determine the hypersensitive reaction (HR). A typical HR developed 20 h after leaf infiltration. The 16S rDNA region of the isolates, amplified by using universal PCR primers, shared 99% sequence identity with an Acidovorax valerianellae strain (GenBank Accession No. AJ431731) (1). The resulting sequences of 1,424 bp were deposited in GenBank (Accession No. JN983471). The isolates we obtained in this study clustered with A. valerianellae on a phylogenetic tree generated by the neighbor-joining method implemented in MEGA Version 4.1. In the Biolog Microbial Identification System, Version 4.2 (Biolog Inc., Hayward, CA), all isolates were 63 to 77% similar with a match probability of 100% to A. konjaci. Fatty acid composition analysis of isolates based on the MIDI Library version TSBA 5.0 and Library Generation system software version 5.0 showed that the isolates were 52 and 72% similar to an Acidovorax sp., respectively. To our knowledge, this is the first report of bacterial black spot disease in watermelon caused by A. valerianellae in Korea. A. valerianellae is a causal agent of bacterial black spot in corn salad and is transmitted by inoculated seeds (3). Further studies are required to determine whether it is seed transmitted in watermelon. References: (1) L. Gardan et al. Int. J. Syst. Evol. Microbiol. 53:795, 2003. (2) C. Grondeau et al. Plant Pathol. 56:302, 2007. (3) C. Grondeau et al. Plant Pathol. 58:846, 2009.

Banana is the second largest cultivated fruit crop in Malaysia, and is cultivated for both the domestic market and also for export. Anthranose is a well-known postharvest disease of banana and with high potential for damaging market value, as infection commonly occurs during storage. Anthracnose symptoms were observed on several varieties of banana such as mas, berangan, awak, nangka, and rastali in the states of Perak and Penang between August and October 2011. Approximately 80% of the fruits became infected with initial symptoms characterized as brown to black spots that later became sunken lesions with orange or salmon-colored conidial masses. Infected tissues (5 × 5 mm) were surface sterilized by dipping in 1% sodium hypochlorite (NaOCl) for 3 to 5 min, rinsed with sterile distilled water, and plated onto potato dextrose agar (PDA). Direct isolation was done by transferring the conidia from conidial masses using an inoculation loop and plating onto PDA. For both methods, the PDA plates were incubated at 27 ± 1°C with cycles of 12 h light and 12 h darkness. Visible growth of mycelium was observed after 4 to 5 days of incubation. Twenty isolates with conidial masses were recovered after 7 days of incubation. The isolates produced grayish white to grayish green and grey to moss dark green colony on PDA, pale orange conidial masses, and fusiform to cylindrical and hyaline conidia with an average size of 15 to 19 × 5 to 6 μm. Appresoria were ovate to obovate, dark brown, and 9 to 15 × 7 to 12 μm and setae were present, slightly swollen at the base, with a tapered apex, and brown. The cultural and morphological characteristics of the isolates were similar to those described for C. gleosporioides (1,2,3). All the C. gloeosporioides isolates were deposited in culture collection at Plant Pathology Lab, University Sains Malaysia. For confirmation of the identity of the isolates, ITS regions were sequenced using ITS4 and ITS5 primers. The isolates were deposited in GenBank with accessions JX163228, JX163231, JX163201, JX163230, JX163215, JX163223, JX163219, JX163202, JX163225, JX163222, JX163206, JX163218, JX163208, JX163209, JX163210, JX431560, JX163212, JX163213, JX431540, and JX431562. The resulting sequences showed 99% to 100% similarity with multiple C. gloeosporioides isolates in GenBank. Pathogenicity tests were conducted using mas, berangan, awak, nangka, and rastali bananas. Fruit surfaces were sterilized with 70% ethanol and wounded using a sterile scalpel. Two inoculation techniques were performed separately: mycelia plug and conidial suspension. Mycelial disc (5 mm) and a drop of 20 μl spore suspension (106 conidia/ml) were prepared from 7-day-old culture and placed on the fruit surface. The inoculated fruits were incubated at 27 ± 1°C for 10 days at 96.1% humidity. After 3 to 4 days of inoculation, brown to black spotted lesions were observed and coalesced to become black sunken lesions. Similar anthracnose symptoms were observed on all banana varieties tested. C. gloeosporioides was reisolated from the anthracnose lesions of all the inoculated fruit in which the cultural and morphological characteristics were the same as the original isolates. To our knowledge, this is the first report of C. gloeosporioides causing anthracnose of Musa spp. in Malaysia. References: (1) P. F. Cannon et al. Mycotaxon 104:189, 2008. (2) J. E. M. Mordue. Glomerella cingulata. CMI Description of Pathogenic Fungi and Bacteria, No. 315. CAB International,1971. (3) H. Prihastuti et al. Fungal Diversity 39:89, 2009.

Curled dock (Rumex crispus L.) is a perennial flowering plant in family Polygonaceae, native to Europe and western Asia. Curled dock is a widespread naturalized species throughout the temperate world that has become a serious invasive species as a weed in many areas. In contrast, the plant has been widely used as a folk medicine for treatment of indigestion and dermatoses in Asia countries. The plant roots are known to have an antifungal effect against barley powdery mildew pathogens. In late October 2010 to 2011, plants showing typical symptoms of powdery mildew disease were observed in a river bank area located in Gwangju, South Korea. Symptoms included generally white, superficial mycelia and abundant necrotic black spots showing superficial chasmothecia. Mycelia were ectophytic with lobed appressoria. Conidiophores were cylindrical, straight, or slightly flexuous in foot cells and bore single conidia. The foot cell of the fungus had a greater range of size than Erysiphe polygoni. Conidia and conidiophores were 25.4 to 45.4 (36.5) μm long × 10.5 to 18.6 (15.0) μm wide and 34.7 to 126.0 (91.4) μm long × 8 to 10 (8.7) μm wide, respectively. The teleomorph included spherical to subspherical ascocarps that were (blackish) brown to yellow and formed hyphoid appendages. Appendages were slightly flexuous and 62.0 to 128.1 (71.6) μm wide. Mature chasmothecia were 75.1 to 140.9 (105) μm. The ascocarps contained multiple asci that were saccate, ellipsoidal and papillate in apices, bore 3 to 5 ascospores, and were 59.4 to 66.1 (60.9) μm long × 32.6 to 43.9 (38.3) μm wide. Ascospores were subhyaline, oval to ellipsoid, and 17.9 to 24.8 (21.1) μm long × 10.9 to 15.2 (13.3) μm wide. From extracted genomic DNA, the internal transcribed spacer (ITS) region inclusive of 5.8S and 28S rDNA were amplified with ITS1F (5′-TCCGTAGGTGAACCTGCGG-3′) and LR5F (5′-GCTATCCTGAGGGAAAC-3′), and LROR (5′-ACCCGCTGAACTTAAGC-3′) and LR5F primer sets, respectively. rDNA ITS (JX499184) and 28S (JX888470) homologies of the fungal strain (EML-RCPW1) via NCBI BLASTn search represented 99.7% (618/620) and 100% (667/667) identity values with E. heraclei AB104510 and AB103366, respectively. The identification of the fungus as E. heraclei was based on morphological data combined with the results of sequence analysis. Although there were no 28S sequence data from E. polygoni in GenBank, the phylogenetic tree based on ITS sequence data showed that our strain was differentiated from E. polygoni, forming a separate clade consisting of E. heraclei. So far, 26 records with respect to powdery mildews on curled dock represent those caused by only E. polygoni worldwide (1). E. heraclei has been reported to occur on various herbaceous plants including Angelica spp., Daucus spp., and Torilis japonica, and a woody plant such as Quercus myrsinaefolia in China, Japan, and Korea. To our knowledge, this is the first report of leaf powdery mildew caused by E. heraclei on curled dock in Korea or elsewhere in the world, although the fungus causes powdery mildew on various species of families Polygonaceae and Apiaceae with wide host range (2,3,4). References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases, Syst. Mycol. Microbiol. Lab., ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , June 22, 2012. (2) D. A. Glawe et al. Online. Plant Health Progress. PHP-2005-0114-01-HN, 2005. (3) M. J. Park et al. New Dis. Rep. 21:14, 2010. (4) G. Rodríguez-Alvarado et al. Plant Dis. 94:483, 2010.

Boxwood (Buxus spp.) are commercially important evergreen ornamental plants with an annual market value of over $103 million in the United States. The recent U.S. incursion of boxwood blight disease caused by the fungus Calonectria pseudonaviculata (syn. Cylindrocladium pseudonaviculatum, Cy. buxicola) threatens the health and productivity of boxwood in both landscape plantings and nurseries. The first confirmed U.S. reports of the disease were made from Connecticut and North Carolina in November 2011 (2,4), followed by diagnoses in 10 additional states during 2012 and 2013. By August 2013, symptoms consistent with boxwood blight had been observed from B. sempervirens in Delaware, Maryland, New Jersey, and southeastern New York. Affected plants showed rapid onset of disease symptoms: dark brown to black spots or diffuse dark areas on leaves, followed by defoliation. Narrow, elongate black cankers also formed on current season shoots. Symptomatic stems and leaves were placed in petri dishes with moistened filter paper at 22°C for 3 days under continuous light. Conidiophores were excised, then placed on potato dextrose agar amended with streptomycin and neomycin (0.3 g/l). Resultant colonies showed dark brown pigmentation at the colony center surrounded by tan to reddish brown rings with white mycelia at the advancing edge. Conidia (n = 30 per isolate) were hyaline, cylindrical, rounded at both ends, with a single septum (45 to 76 × 4 to 6 μm; avg. 63 × 5 μm). Conidiophores (n = 20 per isolate) comprised a stipe, a hyaline septate stipe extension (length 119 to 192 μm; avg. 150 μm) and a terminal ellipsoidal vesicle (diameter 4 to 10 μm; avg. 7 μm). Based on morphological characteristics, the causal agent was identified as C. pseudonaviculata (1,4). Voucher specimens were deposited in the U.S. National Fungus Collections (BPI 892698 to 701). To verify morphological diagnosis, genomic DNA was extracted from fungal biomass grown in liquid cultures of yeast extract peptone dextrose media. A portion of the β-tubulin gene (TUB2) was PCR amplified and sequenced bi-directionally using primers Bta/Bt2b (3). BLASTn searches of NCBI GenBank databases using the TUB2 sequences (Accession Nos. KF785808 to 11) demonstrated 96 to 100% sequence identity with other C. pseudonaviculata isolates. To confirm pathogenicity, 5-month-old B. sempervirens and B. microphylla seedlings were spray-inoculated with a spore suspension of 1 × 104 conidia/ml. One isolate from each state was independently tested with four replicates each. Non-inoculated water-sprayed plants served as negative controls. Plants were maintained in growth chambers at 22°C under constant light. Blight symptoms developed 4 to 5 days post inoculation. C. pseudonaviculata was re-isolated from inoculated plants; no symptoms or signs were observed from control plants. To our knowledge, this is the first report of C. pseudonaviculata in the states of Delaware, Maryland, New Jersey, and New York. This report demonstrates that C. pseudonaviculata is now widespread across the United States eastern seaboard, and represents a substantial threat to boxwood plants in North American landscapes and nurseries. References: (1) P. Crous et al. Sydowia 54:23, 2002. (2) D. F. Farr and A. Y. Rossman. Fungal Databases, USDA-ARS. Retrieved from http://nt.ars-grin.gov/fungaldatabases , 30 August 2013. (3) N. L. Glass and G. C. Donaldson. Appl. Environ. Microbiol. 61:1323, 1995. (4) K. L. Ivors et al. Plant Dis. 96:1070, 2012.

Rubber tree (Hevea brasiliensis Muell. Arg.) is an important industrial crop of tropical areas for natural rubber production. In October 2013, foliar spots (0.1 to 0.4 mm in diameter), black surrounded by a yellow halo, and with lesions slightly sunken were observed on the rubber tree leaf in a growing area in Heikou County of Yunnan Province. Lesion tissues removed from the border between symptomatic and healthy tissue were surface sterilized in 75% ethanol and air-dried, plated on PDA plates, and incubated at 28°C with alternating day/night cycles of light. The pathogen was observed growing out of many of the leaf pieces, and produced abundant conidia. Colonies 6.1 cm in diameter developed on potato carrot agar (PCA) after 7 days, with well-defined concentric rings of growth. Colonies on PCA were composed of fine, dark, radiating, surface and subsurface hyphae. Conidia produced in PCA culture were mostly solitary or in short chains of 2 to 5 spores, long ovoid to clavate, and light brown, 40 to 81.25 × 8 to 20 μm (200 colonies were measured), with 3 to 6 transverse septa and 0 to 2 longitudinal or oblique septa. Morphological characteristics were similar to those described for Alternaria heveae (3,4). A disease of rubber tree caused by Alternaria sp. had been reported in Mexico in 1947 (2). DNA of Ah01HK13 isolate was extracted for PCR and sequencing of the ITS region with ITS1 and ITS4 primers was completed. From the BLAST analysis, the sequence of Ah01HK13 (GenBank Accession No. KF953884), had 97% similarity to A. dauci, 96% identical to A. macrospora (AY154701.1 and DQ156342.1, respectively), indicating the pathogen belonged to Alternaria genus. According to morphological characteristics, this pathogen was identified as A. heveae. Pathogenicity of representative isolate, Ah01HK13 was confirmed using a field rubber tree inoculation method. Three rubber plants (the clone of rubber tree Yunyan77-4) were grown to the copper-colored leaf stage and inoculated by spraying spore suspension (concentration = 104 conidia/ml) to the copper-colored leaves until drops were equally distributed on it using manual pressure sprayer. Three rubber plants sprayed with sterile distilled water were used as controls. After inoculation, the plants were covered with plastic bags. The plastic bags were removed after 2 days post-inoculation (dpi) and monitored daily for symptom development (1). The experiment was repeated three times. The typical 0.1 to 0.4 mm black leaf spots were observed 7 dpi. No symptoms were observed on control plants. A fungus with the same colony and conidial morphology as A. heveae were re-isolated from leaf lesions on inoculated rubber plants, but not from asymptomatic leaves of control plants, fulfilling Koch's postulates. Based on these results, the disease was identified as black spot of rubber tree caused by A. heveae. To our knowledge, this is the first report of A. heveae on rubber tree in China. References: (1) Z. Y. Cai et al. Microbiol Res. 168:340, 2013. (2) W. J. Martin. Plant Dis. Rep. 31:155, 1947. (3) E. G. Simmons. Mycotaxon 50:262, 1994. (4) T. Y. Zhang. Page 111 in: Flora Fungorum Sinicorum: Alternaria, Science Press, Beijing, 2003.

Acanthus ilicifolius (family Acanthaceae) grows mainly in tropical coastal areas and is an important medicinal plant that can be used to treat asthma, rheumatism, etc. In July 2013, symptoms of black spots on the leaves of A. ilicifolius were observed in the Mangrove Conservation Area of Shenzhen Futian (22°32′ N, 114°03′ E) and Leizhou peninsula (20°12′~21°35′ N, 109°30′~110°55′ E), Guangdong Province, China. Initial symptoms of the disease were a small, dark brown spots (4 to 5 × 4 to 6 mm) surrounded by a yellow halo (1 to 2 mm in diameter), that would later extend to round or irregular black spots. Leaves eventually turned chlorotic and plants defoliated. Tissues from symptomatic leaves were excised, surface sterilized with 75% ethanol solution (v/v) for 20 s, soaked in 0.1% HgCl2 solution for 45 s, rinsed three times in sterile water, cut into small pieces (2 to 3 mm), plated on potato dextrose agar (PDA), and incubated 3 to 5 days at 28°C without light. Four isolates named from LSL-1 to LSL-4 with different morphological characteristics were obtained. To fulfill Koch's postulates, wounded and non-wounded leaves were inoculated. Fresh wounds were made with a sterile needle on detached leaves and on living plants. Mycelial plugs of each isolate were applied and covered with a piece of wet cotton to maintain moisture. For the control, the healthy leaves were inoculated with PDA plugs. All treatments were incubated at room temperature. Black spots were observed on the wounded leaves inoculated with isolate LSL-1 after 3 days, while the other three isolates and the control remained symptomless, and the pathogen similar to LSL-1 was re-isolated from the diseased leaves. Non-wounded leaves didn't become infected. The pathogenic test was repeated three times with the same conditions, and it was confirmed that LSL-1 was the pathogen causing the black spot of A. ilicifolius. Identification of the pathogen was conducted using morphological and molecular characteristics. Hyphal tips of LSL-1 were transferred to PDA medium in petri dishes for morphological observation. Two types of conidia were observed. The macroconidia were cylindrical to slightly curved, falciform shaped, with two to four septa, and measured 39 to 45 × 4.7 to 5.0 μm. The microconidia were oval to kidney shaped, single celled, 8 to 10 × 2.5 to 3.5 μm. Chlamydospores were also observed, produced singly or in pairs. Based on morphology (1,4), the isolate was tentatively identified as Fusarium solani. For molecular identification, the internal transcribed spacer (ITS) of ribosomal DNA, beta-tubulin gene, and translation elongation factor 1-alpha (EF-1α) gene was amplified using the ITS1/ITS4 (5), ITS4/ITS5 (5), T1/T2 (2) and EF1/EF2 (3) primer pairs. The gene sequences were deposited in GenBank (KJ720639 for the ITS1/ITS4 region, KF826493 for the ITS4/ITS5 region, KJ720638 for the beta-tubulin, and KF826492 for EF-1α region) and showed 99% identity to the F. solani strains (AY633746 for ITS1/ITS4 region, AM412637 for ITS4/ITS5 region, KF255996 for beta-tubulin region, DQ246859 for EF-1α region). According to these results, the pathogen of black spot of A. ilicifolius was identified as F. solani. To the best of our knowledge, this is the first report of F. solani causing black spot of A. ilicifolius in China. References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell, Ames, IA, 2006. (2) K. O'Donnell and E. Cigelnik. Mol. Phylogenet. Evol. 7:103, 1997. (3) K. O'Donnell et al. Proc. Natl. Acad. Sci. USA. 95:2044, 1998. (4) B. A. Pérez et al. Plant Dis. 91:1053, 2007. (5) A. W. Zhang et al. Plant Dis. 81:1143, 1997.

Withania somnifera (family solanaceae) commonly known as ashwagandha and Indian ginseng, originated in India is one of the most powerful medicinal plants for more than 3,000 years (1). It is commercially cultivated for its roots, a natural rich source of glycowithanolides, tannins, potassium nitrate, etc., which are an anti-inflammatory, anti-tumor, anti-oxidant, anti-ulcer, and regulator of the nervous system and sleep (2). During the monsoon of July 2011, black spots on the leaves of infected plants were observed in the ashwagandha growing Lucknow, Raibareilly, and adjoining areas of Uttar Pradesh province with 10 to 20% disease incidence. Early stage of disease were characterized by the presence of light chlorotic spots on both sides of old leaves that later turned into dark black spots resulting in early defoliation. About 27 samples were collected from different locations of the fields for isolation of the causal organism and microscopic studies. Infected leaves were cut into small pieces, surface sterilized with 1% sodium hypochlorite for 1 min, rinsed thrice with sterilized distilled water, and placed onto potato dextrose agar (PDA) plates. After 21 days of dark incubation at 25°C, 8- to 10-mm grayish-brown colonies were observed. Microscopic studies at early and mature stages of infection showed production of conidia in conidiophores. Conidiophores were mostly 5 to 9, few dense pale brown, simple unbranched, septate, geniculate and 14 to 55 × 3 to 5.5 μm. Conidia were subhyline, obclavate to cylindrical, some were straight to slightly curved, multiseptate, base long obconic to long obconically truncate, and 12 to 85 × 3.5 to 5 μm. On the basis of cultural and morphological studies, the pathogen was identified as Pseudocercospora fuligena (3). The pathogen identity was further confirmed at molecular level using universal primers ITS1/ITS4 through PCR (4). An amplification of the expected size (~550 bp) was generated, eluted from agarose gel by QIAquick gel extraction kit (Qiagen), cloned into pGEM-T Easy vector (Promega), sequenced, and deposited in GenBank (Accession No. KF881898). NCBI BLASTn showed 99% identity with P. fuligena (GU214675) strain CPC 12296, isolated from Lycopersicon sp. Pathogenicity test was carried out on 10 plants of W. somnifera cv. Poshita through two approaches, one using mycelia from culture and another using spore suspension from naturally infected leaves. In the first approach, fungal mycelia were applied onto the healthy ashwagandha leaves, whereas in the second approach, infected leaves were washed with distilled water and spore suspension of 106 spores/ml was sprayed on healthy plants. Plants sprayed with sterilized distilled water served as controls. Inoculated plants were placed in a growth chamber at 28°C under 90% humidity for 3 days. After, pots were placed in the glasshouse at 27 ± 2°C with 70 to 80% humidity for 21 days. Initial symptoms appeared on the 7th day while typical symptoms appeared on all the inoculated plants after 12 to 17 days. Control plants remained free of infection. Re-isolation of the pathogen on PDA fulfilled Koch's postulates. Black leaf mold caused by P. fuligena has been reported on tomato (5). This is the first report of black leaf mould caused by P. fuligena on W. somnifera from India. P. fuligena has the potential to reduce yield of W. somnifera. References: (1) Anonymous. Alt. Med Rev. 9:211, 2004. (2) B. D. Basu and K. R. Kirtikar. Indian Medicinal Plants: Plates, vol. 1-4. Bishen Singh Mahendra Pal Singh, Dehradun, India, 1991. (3) T. C. Wang et al. Plant Dis. 79:661, 1995. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990. (5) S. Yamada. Ann. Phytopathol. Soc. Jpn. 15:13, 1951.

A survey to identify pathogens causing peony diseases in southern Chile (37°95′ to 40°58′S) was conducted from 2008 to 2011. A noticeable symptom consisted of small red spots on leaves, stems, sepals, and first petals of the bud. The central part of the lesions (1 cm) enlarged, darkened, and became necrotic, coincident with rainy and cold weather, including frosts. Lesions grew but never coalesced completely. At the edges of leaves, the infected tissues cracked and produced a twisted and corrugated appearance. Rhizome symptoms were also observed and consisted of black spots, which enlarged to elongated lesions. Small pieces (~1 × 1 mm) of symptomatic leaves, previously washed with 2% NaOCl for 2 min were cultured on potato dextrose agar (PDA) and V8 juice agar (20%) media. The cultures were incubated in growth chambers at 20°C (dark) and 5°C (dark)/20°C (light) for 12/12 h (dark/light). Sporulation was obtained only with V8 under the dark and light regime. Mycelia growth was superficial and immersed in the media; hyphae were septate with thick black walls. Conidiophores were flexuous, not branched, and produced a single spore. Spores were elongate, multiseptate, with a long, strongly curved beak. After one week, sporulation decreased and thick-walled, round black clamydospores formed in the media. Spores ranged from 125 to 235 μm long and most frequently were 170 to 220 μm. The number of septa ranged from 5 to 12. Morphological and cultural characteristics fit the description of Mycocentrospora acerina (Harting) Deighton (1,2). DNA was obtained from fungal culture. The internal transcribed spacer (ITS) region was amplified using ITS1/ITS4 primers (3), and part of the amplicon (502 of 550 pb) was sequenced. The sequence was deposited in GeneBank (Accession No. KF015599) and showed 100% identity values with sequences of similar regions from M. acerina (strain ATCC 16259, Accession No. KF278454). Healthy leaves and rhizome pieces were washed with sterile distilled water and placed on sterile moist paper towel. A small agar disc with mycelium was placed on the leaves and rhizomes with and without wounding before inoculation. The inoculated materials were kept in closed boxes with high humidity at 5 to 20°C. Tests were positive in leaves and rhizomes with and without wounds. Seven days after leaf inoculations, necrotic symptoms developed. A second inoculation test in peony leaves of plants bagged with plastic under field conditions corroborated the in vitro test. Inoculated rhizomes developed dark orange lesions initially, then turned black with a watery consistency, similarly to affected rhizomes in the field. In both tests, controls showed no symptoms. To our knowledge, this is the first report of M. acerina on P. lactiflora globally (4). In an evaluation at Carillanca (38°41′S, 72°25′W), using a scale from 0 (no symptoms) to 7 (necrotic lesions covering >60% of foliage, with death of stems), 11 out of 31 peony varieties scored 0–1. As a reference, a score of 3 is the maximum damage allowed on peonies for export. These varieties might help to keep Chilean peonies in the market without an economic impact. References: (1) M. B. Ellis. Dematiaceous Hyphomycetes. CMI. Surrey, England, 1971. (2) B. C. Sutton and I. A. S Gibson. M. acerina. CMI. Descriptions of Pathogenic Fungi and Bacteria, No. 537.1977. (3) T. J. White et al. PCR Protocols. Academic Press, San Diego, CA, 1990. (4) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab., ARS, USDA. Retrieved April 16, 2014.

Black spot, also known as Ascochyta blight, is the most important disease on field pea (Pisum sativum). It is caused by a complex of pathogens, the most important of which in Australia include Didymella pinodes, Phoma pinodella, and P. koolunga. The relative proportions of these and other component pathogens of the complex fluctuate widely across time and geographic locations in Australia, limiting the ability of breeders to develop varieties with effective resistance to black spot. To address this, 40 field pea genotypes were tested under controlled environment conditions for their individual stem and leaf responses against these three pathogens. Disease severity was calculated as area under disease progress curve (AUDPC), and subsequently converted to mean rank (MR). The overall rank (OR) for each pathogen was used to compare response of genotypes under inoculation with each pathogen. The expressions of host resistance across the field pea genotypes were largely dependent upon the individual test pathogen and whether the test was on stem or leaf. Overall, P. koolunga caused most severe stem disease; significantly more severe than either D. pinodes or P. pinodella. This is the first report of the host resistance identified in field pea to P. koolunga; the five genotypes showing highest resistance on stem, viz. 05P778-BSR-701, ATC 5338, ATC 5345, Dundale, and ATC 866, had AUDPC MR values

‘Rojo Brillante’ is currently the most important persimmon cultivar in Spain. The incidence and etiology of postharvest diseases affecting this cultivar were determined under local conditions. Latent and wound pathogens were assessed for two consecutive seasons on commercially grown persimmons from two orchards. Healthy persimmons were either surface-disinfested or artificially wounded on the rind and placed in humid chambers at 20 or 25°C for up to 9 weeks. Additionally, decay was assessed on commercially handled persimmons stored at 1°C for up to 20 weeks. In all cases, the most frequent disease was alternaria black spot (ABS) caused by Alternaria alternata and an ABS severity index specific for ‘Rojo Brillante’ persimmons was established. Other minor pathogens causing latent infections, mostly stem-end rots, included Botrytis cinerea, Lasiodiplodia theobromae, Neofusicoccum spp., Pestalotiopsis clavispora, and Colletotrichum gloeosporioides. Penicillium expansum and, to much a lesser extent, Cladosporium cladosporioides were other pathogens causing wound infections. These two fungi and A. alternata and B. cinerea were also isolated from cold-stored fruit. Common isolates were identified by macroscopic and microscopic morphology and/or DNA amplification and sequencing. Pathogenicity of selected isolates was demonstrated by fulfilling Koch’s postulates. Disease development at 20 and 5°C was characterized on artificially inoculated persimmons.

Brown spot, caused by Cladosporium spp., is becoming a problematic postharvest disease of late season table grape (Vitis vinifera) in the California central valley, and management is hindered by knowledge gaps in disease etiology and epidemiology. Brown spot is herein described as a pre- and postharvest dry rot typified by an external brown to black spot or black mycelium which encases the placenta. Isolates in the Cladosporium herbarum and C. cladosporioides species complexes were recovered from 85 and 5% of brown-spot affected berries, respectively. Five isolates in the C. herbarum species complex, representing three phylogenetically distinct species (C. limoniforme, C. ramotenellum, and C. tenellum), and one C. cladosporioides isolate all caused brown spot symptoms under cold-storage conditions, with and without mechanical wounding. Isolate virulence was similar (P > 0.05) based on disease incidence and severity on intact berries but severity varied on wounded berries (P < 0.001). Surface disinfestation reduced severity of cluster rot development following 2 weeks in cold storage (P = 0.027) but incidence was not affected (P = 0.17). This work provides foundational information on brown spot pathosystem etiology and biology in late-harvest table grape, which can be used to improve management.

Cactoblastis cactorum Berg (Lepidoptera: Pyralidae) has been extensively studied since its initial use as a biological control agent for invasive populations of Opuntia Mill. The moth is native to several South American countries including Argentina where the exotic Opuntia ficus-indica (L.) Mill. (Cactaceae) is grown as a commercial crop. Recently C. cactorum has attracted considerable attention following its non-intentional establishment in Florida, because it now threatens the highly diverse and economically important Opuntia taxa of the southern USA and Mexico. To elucidate several aspects of this system, we recorded phenological data and parasitoid activity from Argentina across an annual cycle. We reared several generations of moths to better document the life cycle, described several formerly unpublished larval stages and morphological characters, and compared developmental parameters from samples collected from different sites. We found that C. cactorum has 3 overlapping generations across a 9 mo growth period with winter quiescence at the larval VI instar or pupal stage. The most common natural enemy of larvae was the parasitoid Apanteles opuntiarum (Martínez and Berta) (Hymenoptera: Braconidae). Information is given on its development and percentages of parasitism throughout the year. No egg parasitoids were found in field-collected eggsticks or on experimental eggsticks. There were no significant differences between developmental stages and times of C. cactorum from Tucumán and Córdoba in Argentina. We found intermediate C. cactorum damage on low-density cultivated Opuntia, but much lower damage in commercial plantations with high densities of plants. Surprisingly, we found that a “black spot” fungal infection (Alternaria Nees) (Pleosporaceae) produced a higher level of damage in commercial plantations in Córdoba, as well as in natural settings in Tucumán. Cactoblastis cactorum Berg (Lepidoptera: Pyralidae) ha sido extensamente estudiada desde su uso incial como un agente de control biológico de las poblaciones invasoras de Opuntia Mill. Su larva es nativa de Sud América, incluyendo la Argentina, donde el cactus exótico Opuntia ficus-indica (L.) Mill (Cactaceae) se cultiva comercialmente. C. cactorum ha atraído la atención recientemente, después de su establecimiento accidental en Florida, dado que amenaza a la gran diversidad de especies de Opuntia que son económicamente importantes y nativas de Estados Unidos y México. Con el objeto de dilucidar varios aspectos de este sistema hemos registrado datos fenológicos y la actividad de parasitoides en el campo a lo largo de un año. Hemos criado varias generaciones de polillas para documentar mejor el ciclo de vida, para describir estadios larvales y caracteres morfológicos previamente no publicados, y para comparar parámetros de desarrollo de muestras colectadas de diferentes sitios. Hemos encontrado que C. cactorum tiene 3 generaciones superpuestas a lo largo de 9 meses de crecimiento con una quiescencia invernal de la larva VI o pupa. El enemigo natural más común fue el parasitoide de larvas Apanteles opuntiarum (Martínez and Berta) (Hymenoptera: Braconidae). Se presenta información sobre su desarrollo y porcentaje de parasitismo a lo largo del año. No se hallaron parasitoides de huevo en muestras de campo ni en ristras de huevo colocadas experimentalmente. No se encontraron diferencias significativas en los estadios de desarrollo ni en sus tiempos entre muestras provenientes de los sitios de Córdoba y Tucumán. Registramos intermedio daño por C. cactorum en la especie de Opuntia cultivada en baja densidad pero mucho menor daño en plantaciones comerciales con alta densidad de plantas. Sorpresivamente, encontramos un alto nivel de daño producido por un hongo que genera la “mancha negra”, tanto en plantaciones comerciales de Córdoba como en situaciones naturales de Tucumán. Fil: Folgarait, Patricia Julia. Universidad Nacional de Quilmes. Departamento de Ciencia y Tecnología. Laboratorio de Hormigas; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina Fil: Albioni Montenegro, Gloria. Universidad Nacional de Quilmes. Departamento de Ciencia y Tecnología. Laboratorio de Hormigas; Argentina Fil: Plowes, Robert. University of Texas; Estados Unidos Fil: Gilbert, L. E.. University of Texas; Estados Unidos

In this work, two experiments were set up in order to select papaya hybrids and verify heterosis expression for black spot (Asperisporium caricae) and phoma spot (Stagonoparopsis caricae) resistance. Experiments were set up in randomized blocks with two replications. Black spot and phoma spot incidence and severity on leaves were evaluated, and fruit damaged area by black spot was estimated. These characteristics were used to estimate genetic distance with complement of Jaccard’s Index. For black spot resistance, 77 % of hybrids showed heterosis for at least one of three evaluated characteristics and 58 % of hybrids showed heterobeltiosis effect. For phoma spot severity, there was heterosis manifestation in 56 % of hybrids, and 30 % of them showed heterobeltiosis effect. Therefore, heterosis was found in most of the hybrids, emphasizing the possibility of using hybridization to develop resistant genotypes. We observed that the best estimates of heterotic effects were obtained by crossing genetically distant individuals, indicating the existence of a positive relationship between genetic distance and hybrid performance. Together, the results highlight the hybrid ‘Americano’ x ‘Waimanalo’ as having a strong potential to reduce the intensity of these two diseases.

In year of 2013, anthracnose disease symptoms were observed on stem of stonecrop in a plant resource field, Southern Forest Resource Research Center, Jinju, South Korea. The disease symptoms were appeared 2-5 cm smudged irregular black spot color on the plant stems. Suspected pathogen was isolated from the lesion with surface sterilization method and identified it as Colletotrichum gloeosporioides by morphological characteristics and phylogenetic analyses. Artificially inoculated the isolated pathogen led to the similar disease symptom as originally observed in the field. The fungal pathogen was re-isolated from the inoculated lesion and it exhibited the same characteristics compared to the original isolate. This is the first report of anthracnose of stonecrop grown in open fields, caused by Colletotrichum gloeosporioides in Korea.

The species of Salix herbacea L. and Salix lapponum L. are the rare relicts within the genus of Salix. With respect to their phylogeography, they are classified into the taxa of the Arctic-Alpine distribution. They can be found in the Arctic zone (Greenland, Scandinavia, Spitsbergen) as well as in such geographically separated areas as the mountains of lower latitudes like the Alps, the Sudetes or the Carpathians. Another species of willow occurring in the mountains of Europe, and more specifically on montane positions of the Balkan-Carpathian distribution is S. silesiaca. The aim of the study was to determine the severity of the diseases of the willows growing in selected locations in the Karkonosze Mountains. The research was conducted in the years 2014 and 2015 in the Kociol Łomniczki [the Łomniczka Cirque] and the Wielki and Maly Śniezny Kociol, [the Great and Small Snowy Cirques] at intervals of 4 weeks, from April to October. Field observations included the species of the genera Salix: S. herbacea, S. silesiaca and S. lapponum. Disease symptoms were identified with the percentage of infected plants at selected locations, as well as the percentage of infected leaves, recorded. In the course of the research, symptoms of rust caused by Melampsora epitea and M. alpina (S. herbacea and S. silesiaca), black spot blight caused by Rhytisma salicinum (S. silesiaca) and leaf spot, probably caused by a complex of fungal taxa (S. herbacea), were detected on the leaves of Salix spp. growing in post glacial cirques. During the study period, there were no disease symptoms on S. lapponum. A total of 13 species of fungi were isolated from the infected leaves of S. herbacea. In the first year, the highest share in the fungal assembly was taken by Penicillium notatum, followed by Alternaria alternata and an unidentified species of the genus Ceuthospora. In the second year of the research, Ceuthospora spp. and A. alternata predominated in the species assembly of fungi in the infected leaves of the herb willow.

A novel species of Curvularia was identified as a foliar pathogen of Cynodon dactylon (bermudagrass) and Zoysia matrella (zoysiagrass), two important warm-season turfgrasses in the southeastern United States. Field symptoms were conspicuous chocolate brown to black spots in turf of both species on golf course putting greens and fairways. Leaves of plants within these spots exhibited prominent, black eyespot lesions from which a darkly pigmented fungus was consistently isolated. The fungus produced gray- to black-olivaceous mycelium within 10 d on potato dextrose agar at 25 C but never produced conidia despite numerous attempts to induce them. Field symptoms were reproduced in inoculated plants of both grasses, and re-isolation of the pathogen from symptomatic tissues confirmed its pathogenicity in fulfillment of Koch's postulates. A phylogenetic analysis was performed using sequence markers of internal nuclear ribosomal transcribed spacer region (ITS), glyceralde-hyde-3-phosphate dehydrogenase (GPD1) and translation elongation factor 1-α (TEF 1). The concatenated phylogenetic tree showed strong support for a new species within Curvularia that is distinctly divergent from other Curvularia spp. Therefore, the darkly pigmented pathogen of warm-season turfgrasses is described and illustrated as a new species, Curvularia malina.