Search

Large amounts of bioaerosols are generated during the treatment of landfill leachate, which poses potential threat to public health safety. In this study, the concentrations, particle size distribution, and microbial community of bioaerosols emitted from the low-pH biofilter (LPB) and neutral-pH biofilter (NPB) used to treat the odors from landfill leachate, as well as the effect of the inlet flow rate (IFR) and water-containing rate (WCR) were investigated. The results showed that the removal efficiency of the LPB for heterotrophic bacteria and the NPB for fungi were higher when the IFR was higher. The outlet concentrations (OCs) of heterotrophic bacteria, neutral sulfur bacteria, ammonia-oxidizing bacteria, nitrite-oxidizing bacteria, NO2−, and NO3− were negatively correlated with the IFR in the LPB, whereas those of fungi and acidophilic sulfur bacteria were positively correlated with the IFR. Inverse correlation between the OCs and IFR was exhibited in the NPB. The proportions of dominant microorganisms with large particle size (> 3.3 μm) reduced significantly after both the LPB and NPB, which was aggravated under higher WCR. The analysis of microbial community illustrated that the dominant heterotrophic bacteria were different, while the dominant fungi were similar in the bioaerosols between the LPB and NPB, respectively. Due to the different emission characteristics, bioaerosols in the LPB and NPB outlet should be distinguished and taken seriously.

A novel combined bioreactor integrating anaerobic baffling and anaerobic filtration process was developed and operated for 210 days to treat low-strength rural wastewater. The effects of hydraulic residence time (HRT) and organic loading rate (OLR) on chemical oxygen demand (COD) removal and methane (CH4) production of the combined bioreactor were investigated. The combined bioreactor can start up successfully in 25 days and achieve enhanced performance. The COD removal rate and CH4 yield were influenced significantly by HRT and OLR. The influent COD was removed effectively through the synergistic effects of the anaerobic baffling and anaerobic filtration. The baffle zone played the main role in the degradation of the pollutants, and the filter zone mainly contributed to improve the resistance to shock loading. High-throughput sequencing technology was used to analyze the bacterial and archaeal community structure and diversity. Clostridium_sensu_stricto, Longilinea, Acetoanaerobium, Arcobacter, and Acinetobacter were found to be the dominant bacteria. While Methanothrix and Methanoregula were the dominant archaea, which were responsible for methane generation. This study not only highlights the good energy recovery and resource utilization potential of the combined bioreactor but also presents significant guidance for the application of the combined anaerobic process for low-strength rural wastewater treatment.

Objective: To investigate the diagnostic value of ERCP combined with CRP, CEA and IL-6 in serum in Occult Common bile duct stones (CBDS). Methods: 80 cases of patients with occult CBDS treated in our hospital were selected as the research subjects, and the diagnosis rates of ERCP alone or ERCP combined with CRP, CEA and IL-6 in serum were compared. Results: Versus ERCP alone, the diagnosis rate of combined diagnosis was clearly higher (P < 0.05). Versus patients without CBDS, the levels of CRP, CEA and IL-6 in serum in CBDS patients were apparently elevated (P < 0.05). The levels of CRP, CEA and IL-6 in serum were of high value in the diagnosis of CBDS in patients with occult CBDS (P < 0.05). Conclusion: ERCP combined with CRP, CEA and IL-6 in serum is of high value in re-diagnosis of Occult CBDS.

An increasing number of studies have related the mitochondrial DNA (mtDNA) content to embryo viability and transfer outcomes. However, previous studies have focused more on the relationship between mtDNA and embryo implantation, few studies have studied the effect of the mtDNA content on live birth. In the study, we investigated whether mtDNA content is a reliable screening biomarker for live birth after single blastocyst transfer. A total of 233 couples with 316 blastocyst stage embryos undergoing in vitro fertilization treatment and pre-implantation genetic testing analysis were included in the study. All embryos were chromosomally normal and had undergone single-embryo transfers. There was no significant difference observed in the blastocyst mtDNA content among the live birth, miscarriage and non-implanted groups (p=0.999), and the mtDNA content in blastocysts from the miscarriage and live birth groups was similar [median (interquartile range), 1.00*108(7.59*107- 1.39*108) vs 1.01*108 (7.37*107- 1.32*108)]. Similarly, no significant association was observed between mtDNA content and embryo implantation potential (p=0.965). After adjusting for multiple confounders in a logistic regression analysis with generalized estimating equations, no associations between mtDNA content and live birth were observed in all blastocysts, Day-5 and Day-6 blastocysts (p=0.567, p=0.673, p=0.165, respectively). The live birth rate was not significantly different between blastocysts with an elevated mtDNA content and blastocysts with a normal mtDNA content (26.7% vs 33.6% p=0.780). Additionally, there was no linear correlation between the mtDNA content and maternal age (p=0.570). In conclusion, the mtDNA content does not seem to be a potential biomarker for embryo transfer outcomes (i.e., implantation and live birth) based on the existing testing tools. Embryos with an elevated mtDNA content also have development potential for successful live birth.

A cadmium (Cd) stress test was carried out on Eisenia fetida in artificial soil. Six Cd concentration gradient solutions (0, 50, 100, 125, 250 and 500 mg/kg) were prepared. Two treatment groups, short-term stress and long-term stress, were established. The former lasted for 10 days, and the latter lasted for 30 days. The Biolog ECO-microplate culture method was used to determine the utilization of the 31 carbon sources by the microbes in earthworm homogenate. The total protein content (TP), peroxidase activity (POD), catalase activity (CAT), superoxide dismutase activity (SOD), glutathione peroxidase activity (GPX), glutathione-S-transferase activity (GST), malondialdehyde content (MDA) and acetylcholinesterase activity (AChE) in earthworm were determined in order to investigate the regulation of oxidative stress and the functional diversity of microbial communities in earthworms under Cd stress. By combining the entropy weight method (EW) and the technique for order preference by similarity to an ideal solution model (TOPSIS), the physiological functional indices of earthworms were assessed objectively and scientifically, and the physiological changes under the different stress periods were evaluated. The results showed that a Cd-tolerant dominant population appeared in the microbial community under Cd stress. In the short-term test, oxidative stress were more effective in coping with Cd stress than the microbial community, and oxidative stress regulated the microbial community functional diversity. Under long-term Cd stress, the regulatory effect was weak or non-existent. In this study, a new evaluation model was established to explore the regulation process of earthworm on its oxidation stress and the functional diversity of microbial communities under Cd stress, and provide a theoretical basis for revealing the detoxification mechanism of earthworms.

Alagille syndrome (ALGS), as known as congenital arteriohepatic dysplasia, is a rare autosomal dominant multi-systemic disorder. Mutations in JAG1 or more rarely NOTCH2 have been reported as the cause of ALGS. In this study, a 5-year old girl with typical ALGS feature and her pregnant mother came to our reproductive genetics clinic for counseling. We aimed to clarify the genetic diagnosis and provide prenatal genetic diagnosis for the pregnant. Next generation sequencing (NGS)-based multigene panel was used to identify pathogenic variant of the proband. Then the candidate variant was verified by using Sanger sequencing. RNA assay was performed to clarify splicing effect of the candidate variant. Amniocentesis, karyotyping, and Sanger sequencing were performed for prenatal testing. We found a novel de novo noncanonical JAG1 splicing variant (c.2917-8C > A) in the proband. Peripheral blood RNA assay suggested that the mutant transcript might escape nonsense-mediated messenger RNA (mRNA) decay (NMD) and encode a C-terminal truncated protein. Information of the variant has resulted in a successful prenatal diagnosis of the fetus. Our results clarified the genetic diagnosis of an ALGS patient and ensured utility of prenatal genetic testing.

Oligonucleotide (ON) concentrations employed for therapeutic applications vary widely, but in general are high enough to raise significant concerns for off target effects and cellular toxicity. However, lowering ON concentrations reduces the chances of a therapeutic response, since typically relatively small amounts of ON are taken up by targeted cells in tissue culture. It is therefore imperative to identify new strategies to improve the concentration dependence of ON function. In this work, we have identified ammonium ion (NH4+) as a non-toxic potent enhancer of ON activity in the nucleus and cytoplasm following delivery by gymnosis. NH4+ is a metabolite that has been extensively employed as diuretic, expectorant, for the treatment of renal calculi and in a variety of other diseases. Enhancement of function can be found in attached and suspension cells, including in difficult-to-transfect Jurkat T and CEM T cells. We have also demonstrated that NH4+ can synergistically interact with arsenic trioxide (arsenite) to further promote ON function without producing any apparent increased cellular toxicity. These small, inexpensive, widely distributed molecules could be useful not only in laboratory experiments but potentially in therapeutic ON-based combinatorial strategy for clinical applications.

Background and Purpose Elevated angiotensin II (Ang II) and sympathetic activity contributes to a high risk of ventricular arrhythmias in heart disease. The rapidly activating delayed rectifier K+ current (IKr) carried by the hERG channels plays a critical role in cardiac repolarization, and decreased IKr is involved in increased cardiac arrhythmogenicity. Stimulation of α1A-adrenoreceptors or angiotensin II AT1 receptors is known to inhibit IKr via PKC. Here, we have identified the PKC isoenzymes mediating the inhibition of IKr by activation of these two different GPCRs. Experimental Approach The whole-cell patch-clamp technique was used to record IKr in guinea pig cardiomyocytes and HEK293 cells co-transfected with hERG and α1A-adrenoreceptor or AT1 receptor genes. Key Results A broad spectrum PKC inhibitor Go6983 (not inhibiting PKCe), a selective cPKC inhibitor Go6976 and a PKCα-specific inhibitor peptide, blocked the inhibition of IKr by the α1A-adrenoreceptor agonist A61603. However, these inhibitors did not affect the reduction of IKr by activation of AT1 receptors, whereas the PKCe-selective inhibitor peptide did block the effect. The effects of angiotensin II and the PKCe activator peptide were inhibited in mutant hERG channels in which 17 of the 18 PKC phosphorylation sites were deleted, whereas a deletion of the N-terminus of the hERG channels selectively prevented the inhibition elicited by A61603 and the cPKC activator peptide. Conclusions and Implications Our results indicated that inhibition of IKr by activation of α1A-adrenoreceptors or AT1 receptors were mediated by PKCα and PKCe isoforms respectively, through different molecular mechanisms.

Porcine hemagglutinating encephalomyelitis virus (PHEV) displays neurotropism and induces atypical autophagy. However, the exact mechanisms mediating autophagy induced by PHEV remains uncharacterized. Transcription factor EB (TFEB) is a master transcriptional regulator playing a key role in autophagy and its activity is regulated by MTORC1 kinase on the surface of lysosomes. We first found that PHEV infection decreases TFEB expression, while it activates TFEB by inhibiting MTORC1 activation, indicating that TFEB plays a complex role in the process of PHEV-induced autophagy through opposite regulation of its expression and activity. Furthermore, this study preliminarily demonstrated that PHEV replication is dependent on TFEB expression.

Endoplasmic reticulum stress (ERS) activates an adaptive unfolded protein response (UPR) that facilitates cellular repair, however, under prolonged ER stress, the UPR can ultimately trigger apoptosis thereby terminating damaged cells. Recently, TSA has shown protective effects on ERS and its mechanisms related to ER pathway has been previously characterized. However, whether TSA exerts its protective role via metabolic events remain largely undefined. Objectives: To explore the possible involvement of the metabolic changes during ERS and to better understand how TSA influence mitochondrial function to facilitate cellular adaptation. Results: TSA is an inhibitor of histone deacetylase which could significantly inhibit H9c2 cell apoptosis induced by Thapsigargin (TG). It also intervene the decrease of mitochondrial membrane potential. By immunofluorescence staining, we have shown that GRP78 was concentrated in the perinuclear region and co-localized with ER. However, treatments with TG and TSA could let it overlap with the mitochondrial marker MitoTracker. Cellular fractionation also confirmed the location of GRP78 in mitochondrion. Conclusions: TSA decreases ERS-induced cell apoptosis and mitochondrial injury may related to enhance the location of GRP78 in mitochondrion. Keywords: GRP78, Endoplasmic reticulum stress, Mitochondrion, TSA

Powdery mildew (PM) is considered a major cause of yield losses and reduced quality in cucumber worldwide, but the molecular basis of PM resistance remains poorly understood. A segment substitution line, namely, SSL508-28, was developed with dominant PM resistance in the genetic background of PM-susceptible cucumber inbred line D8. The substituted segment contains 860 genes. An iTRAQ-based comparative proteomic technology was used to map the proteomes of PM-inoculated and untreated (control) D8 and SSL508-28. The number of differentially regulated proteins (DRPs) in SSL508-28 was almost three times higher than that in D8. Fourteen DRPs were located in the substituted segment interval. Comparative gene expression analysis revealed that nodulin-related protein 1 (NRP1) may be a good candidate for PM resistance. Gene Ontology enrichment analysis showed that DRPs functioning in tetrapyrrole biosynthetic process, sulfur metabolic process and cell redox homeostasis were specifically enriched in the resistant line SSL508-28. DRPs categorized in the KEGG term photosynthesis increased in both lines upon PM infection, suggesting that the strategies used by cucumber may be different from those used by other crops to react to PM attacks at the initial stage. The measurement of hydrogen peroxide and superoxide anion production and net photosynthetic rate were consistent with the changes in protein abundance, suggesting that the proteomic results were reliable. There was a poor correlation between DRPs measured by iTRAQ and the corresponding gene expression changes measured by RNA-seq with the same experimental design. Taken together, these findings improve the understanding of the molecular mechanisms underlying the response of cucumber to PM infection.

Cucumis dipsaceus (hedgehog cucumber) belongs to the family of Cucurbitaceae and is widely spread in east tropical Africa and Asia (Geethakumary et al. 2015). The fruits serve as a source of food and have the potential to reduce the levels of human oxidative stresses (Urs et al. 2013). In May and June 2018, we observed that C. dipsaceus line PI504553 was infected with powdery mildew in a greenhouse located in Yangzhou University, Yangzhou, China (32.3988° N, 119.4294° E). Diffusely white powdery spots covering 5 to 40% of the surface of true leaves were observed. In later stages, the infected leaves became chlorotic and senesced. Two other lines of C. dipsaceus, PI441993 and PI390450, remained symptomless in the same greenhouse. Microscopic observations showed that conidia on infected leaves were ellipsoidal to cylindrical, contained fibrosin bodies, and were 24 to 38.4 × 16.2 to 24.5 μm (average 32.5 × 20.9 μm, n = 50). Conidiophores were unbranched, slightly roughened, 55 to 213 × 6.2 to 14.5 μm (average 132.5 × 10.4 μm, n = 50), with foot cells 40 to 90 μm long. Chasmothecia were not found in the collected infected tissues. Mycelium branched and grew superficially along plant surfaces. These characteristics fit the description of Podosphaera xanthii (Braun and Cook 2012). A pathogenicity test was carried out at the three-leaf stage by spraying a suspension of conidia (1 × 10⁶ conidia/ml) that had been collected from naturally infected leaves onto the healthy leaves of PI504553. The inoculated plants (50) and noninoculated plants (50) were grown in a growth chamber with 27/21°C (day/night) temperature, 85% relative humidity, and a 16-h/8-h (light/dark) photoperiod. Fifteen days after inoculation, powdery mildew symptoms were observed on all inoculated plants but not detectable on the noninoculated control. Further microscopic observations showed that the conidia were consistent with those on naturally infected plants, thus completing Koch’s postulates. The test was repeated once with a similar finding. To further confirm the identification, the internal transcribed spacer sequence was amplified from conidia on infected PI504553 leaves with the primer pair PxT/ITS4 (Rennberger et al. 2018). Sanger sequencing of the amplicon was performed by a commercial service (Sangon, Shanghai, China). BLASTn analysis of the resulting 459-bp sequence (GenBank accession no. MN227347) showed 100% identity with those of P. xanthii on melon from southeast China (KP980563), watermelon from Taiwan (KX369541), and Momordica charantia from Japan (AB774158). To our knowledge, this is the first report of P. xanthii on C. dipsaceus in China. This could cause significant yield losses and become a limiting factor for C. dipsaceus production with the spread of the powdery mildew. The present record also supports a wider host range of P. xanthii among Cucurbitaceae.

Breast cancer (BC) is the most common cancer in women. Estrogen, epidermal growth factor receptor 2 (ERBB2, HER2), and oxidative stress represent critical mechanistic nodes associated with BC. RLIP76 is a major mercapturic acid pathway transporter whose expression is increased in BC. In the quest of a novel molecule with chemopreventive and chemotherapeutic potential, we evaluated the effects of 2'-Hydroxyflavanone (2HF) in BC. 2HF enhanced the inhibitory effects of RLIP76 depletion and also inhibited RLIP76-mediated doxorubicin transport in BC cells. RNA-sequencing revealed that 2HF induces strong reversal of the gene expression pattern in ER+MCF7, HER2+ SKBR3 and triple-negative MDA-MB-231 BC cells with minimal effects on MCF10A normal breast epithelial cells. 2HF down regulated ERα and enhanced inhibitory effects of imatinib mesylate/Gleevec in MCF7 cells. 2HF also down regulated ERα and HER2 gene networks in MCF7 and SKBR3 cells, respectively. 2HF activated TP53 and inhibited TGFβ1 canonical pathway in MCF7 and MDA-MB-231 BC cells. 2HF also regulated the expression of a number of critical prognostic genes of MammaPrint panel and their upstream targets including TP53, CDKN2A and MYC. The collective findings from this study provide a comprehensive, direct and integrated evidence for the benefits of 2HF in targeting major and clinically relevant mechanistic regulators of BC.

Invasive mold infections (IMI) are life-threatening complications of allogeneic hematopoietic stem cell transplantation (HSCT) and are mostly caused by Aspergillus species and Mucorales. We examined whether elevated serum ferritin prior to HSCT was associated with increased risk of IMI after allogeneic HSCT. Elevated serum ferritin was defined as values ≥ 1000 ng/mL. Pretransplant ferritin levels were available for 477 transplants. Nine developed IMI at day 30 and 21 had IMI at day 100 for a cumulative incidence of 1.9% and 4.4%, respectively. Among the high ferritin group, eight of 220 transplant cases (3.6%) developed an IMI within 30 d after HSCT compared with one of 257 (0.4%) in the low ferritin group (P = 0.01). Fourteen of 220 (6.4%) and seven of 257 transplant cases (2.7%) in the high and low ferritin groups, respectively, had developed an IMI by day 100 after HSCT (P = 0.07). Nine of 53 (17%) patients with grades III and IV acute GVHD and iron overload experienced IMI, when compared to three of 37 (8.1%) with high-grade aGVHD, but no iron overload. Among patients without aGVHD, those with elevated ferritin had a 2.7% incidence of IMI compared with 0.9% for patients without elevated ferritin. There was a marginally significant difference in cumulative incidence function between high and low ferritin groups for IMI (P = 0.06). However, elevated serum ferritin (≥ 1000 ng/mL) was not a significant risk factor for IMI in a multivariate competing risk regression model after adjusting for aGVHD.

Prostate cancer incidence is increasing in younger men. We investigated whether men diagnosed with Gleason 7 (3+4) T2 prostate cancer at younger ages (≤ 45 years, young cohort) had different mRNA and miRNA expression profiles than men diagnosed at older ages (71–74 years, older cohort). We identified differentially expressed genes (DEGs) related to tumor-normal differences between the cohorts. Subsequent pathway analysis of DEGs revealed that the young cohort had significantly more pronounced inflammatory and immune responses to tumor development compared to the older cohort. Further supporting a role of inflammation-induced immune-suppression in the development of early-onset prostate cancer, we observed significant up-regulation of CTLA4 and IDO1/TDO2 pathways in tumors of the young cohort. Moreover, over-expression of CTLA4 and IDO1 was significantly associated with biochemical recurrence. Our results provide clues on the mechanisms of tumor development and point to potential biomarkers for early detection and treatment for prostate cancer in young men., Author Summary The incidence of prostate cancer is increasing in young men, and young men are more likely to develop more aggressive prostate cancers than older men. These findings suggest biological differences between prostate cancers that develop in young men and in older men; yet little data and few studies on men diagnosed under age 50 years exist. In this study, we investigated whether men diagnosed with prostate cancer at young ages (≤ age 45 years) had different gene expression profiles than men diagnosed at older ages (71–74 years). We found that inflammatory and immune-related pathways were up-regulated in the young group as compared to the older group, suggesting fundamental differences in tumor development. Moreover, 21% of the young group, compared to 8% of the older group, had biochemical recurrence of prostate cancer–a surprising result given that both groups were diagnosed in early stages of disease (all T2, Gleason 7 (3+4). The recurrence in the young group was associated with over-expression of two genes involved in immune regulation. After validation in a larger dataset, these may provide clues for potential biomarkers to test for monitoring which young patients are likely to progress.

Lotus (Nelumbo nucifera) is a perennial aquatic plant of the family Nelumbonaceae. Lotus root is one of the most important aquatic food and ornamental crops in China, Japan, India, and other regions. In 2015, we found lotus plants with late germination, early dormancy, decline growth, thin stems, and deep colored, spotted, and striped leaves in Jiangsu province of China. These symptoms seriously affected the quantity and quality of lotus. Several viruses including cucumber mosaic virus (CMV) and dasheen mosaic virus have been reported to infect lotus (Ding et al. 2011; Dong et al. 2017). To identify pathogens associated with lotus samples of cultivar Meirenhong that exhibited yellowing and mosaic symptoms during June to September 2015, bulked leaves of six symptomatic and asymptomatic plants were used for construction of small RNA (sRNA) libraries using Illumina Small RNA version 1.5 Sample Prep Kit. They were sequenced in a single lane on a Genome Analyzer IIx, and the output files were processed with Illumina’s CASAVA pipeline (version 1.8). The reads resulting from sRNA sequencing were processed by removing the adaptor and then assembled de novo into larger contigs using Velvet Software 0.7.31 with a k-mer of 17. BLAST search of the contigs against the GenBank virus reference database revealed the presence of 106 contigs with high similarities of 76.9 to 93.1% with the genomic regions of Apple stem grooving virus (ASGV), a member of the genus Capillovirus of the family Betaflexiviridae. CMV, one novel potyvirus, and badnaviruses were also identified (unpublished). To confirm the presence of ASGV in the plants, total RNA was extracted by TaKaRa MiniBEST Plant RNA Extraction Kit (TaKaRa, Dalian, China). First-strand cDNA was prepared by M-MLV reverse transcription (Invitrogen) using ASGV-specific primers. Two pairs of specific primer sets, ASGVF4641 (TTAGGTGAGAGGCTTTACAC)/ASGVR5784 (TGCAAAGAAGAAGGTAAAGCTC) and ASGVF4791 (CTATCGTCAACGTCAACC)/ASGVR5609 (TTCAATTCTAGCCGAGAG), were designed according to the sequences of contigs obtained in this study and used in nested reverse transcription polymerase chain reaction (RT-PCR), which amplified a 834-bp DNA fragment of the ASGV genome from six lotus plants. A single 834-bp DNA amplicon was randomly selected, purified by TIANgel Midi Purification Kit (Tiangen, Beijing, China), and cloned into the pMD19-T vector (TaKaRa). Three clones were sequenced (Genewiz, Suzhou, China), and analysis of the consensus sequence (GenBank accession no. MH507516) revealed the highest nucleotide sequence identity of 83% with a Japanese ASGV isolate (GenBank accession no. D14995) (Yoshikawa et al. 1992) in the movement protein gene. To investigate the occurrence and distribution of ASGV infection, 43 lotus samples (23 with mosaic and yellowing symptoms and 20 without any symptoms) were collected in different regions of the Jiangsu province and tested by the nested RT-PCR and double-antibody sandwich ELISA using an ASGV kit (Qiaodu, Shanghai). Both assays detected the virus in 27 of the 43 plants, indicating the ASGV infection is common in lotus. Among these 27 positive samples, 16 samples had mosaic or yellowing symptoms. To our knowledge, this is the first report of ASGV in lotus in China. This finding suggests that use of virus-free lotus seedlings will benefit the production of lotus in China.

The aim of this work was to study the effect of shake culture on microspore embryogenesis and embryonic development in Pakchoi ( Brassica rapa L. ssp. chinensis ). All of the seven genotypes screened responded positively to shake culture. The ideal culture shaking frequency was found to be between 40 rpm and 50 rpm, which increased embryo production by 11.6–69.37% and increased the rate of cotyledon shaped embryos by 3.14–22.67% in comparison to embryos not shaken. Results indicated that shaking promoted morphogenesis of the embryos, and shorten the culture time 1–4 days. The embryos with culture shaking reached a higher plant regeneration rate.

A novel twin-tailed gemini surfactant was synthesized with anhydrous piperazine, 4-nitrobenzyl chloride and 1-bromo octane as raw materials. Its structure was verified by infrared and 1H NMR. The optimum synthetic conditions were established by orthogonal array design. The sterilizing antimicrobial performance of the twin-tailed gemini surfactant was measured by using the disc diffusion method against 18 bacteria. The study indicated that the target twin-tailed gemini surfactant shows excellent inhibition against Pseudomonas aeruginosa, Bacillus thuringiensis, Sphaericus, Bacillus mucilginosus, and Penicillium chrysogenum compared with conventional gemini surfactant and dialkyl monomeric surfactant at the concentration of 10 mg/ml.

The diorganotin(IV) complexes of N-(3,5-dibromosalicylidene)-α-amino acid, R′2Sn(2-O-3,5-Br2C6H2CHNCHRCOO)(where R=H, Me, i-Pr, Bz; R′ =n-Bu, Cy), were synthesized by the reactions of diorganotin dichlorides with in situ formed potassium salt of N-(3,5-dibromosalicylidene)-α-amino acid and characterized by elemental analysis, IR and NMR (1H, 13C and 119Sn) spectra. The crystal structures of n-Bu2Sn(2-O-3,5-Br2C6H2CHNCHRCOO)(R=i-Pr, Bz) and Cy2Sn(2-O-3,5-Br2C6H2CHNCHRCOO)(R=Me, Bz) were determined by X-ray single crystal diffraction and showed that the tin atoms are in a distorted trigonal bipyramidal geometry to form five- and six-membered chelate rings with the tridentate ligand. Bioassay results indicated that the compounds possess better in vitro antitumour activity against three human tumour cell lines, HeLa, CoLo205 and MCF-7, than cis-platin and moderate anti-bacterial activity against two bacteria, E. coli and S. aureus.

A Brd2 allele suppresses heading date by altering the expression of heading date regulators such as OsMADS50 , and also negatively regulates chlorophyll biosynthesis. Heading date and plant height are important determinants of yield in rice (Oryza sativa L.). In this study, we characterized a late heading, dwarf mutant known as lhdd10 selected following ethyl methane sulfonate (EMS)-treatment of ssp. indica cultivar 93-11. lhdd10 showed late heading, dwarfness and slightly darker-green leaves than wild-type 93-11 under long-day and short-day conditions. We isolated lhdd10 by map-based cloning; it encoded a putative FAD-linked oxidoreductase protein (a brassinosteroid biosynthetic gene) that localized to the nucleus. LHDD10 was constitutively expressed in various tissues, but more so in shoot apices and panicles. Our data showed that lhdd10 influences heading date by controlling the expression of heading date regulators, such as OsMADS50 in both LD and SD conditions. lhdd10 also negatively regulated expression of chlorophyll biosynthetic genes to reduce the chlorophyll content. Our data indicated that BRs play important roles in regulating heading date and chlorophyll biosynthesis. This work provides material that will allow study of how BRs regulate heading date in rice.

Brentuximab vedotin (BV) is an antibody–drug conjugate that specifically delivers the potent cytotoxic drug monomethyl auristatin E (MMAE) to CD30-positive cells. BV is FDA approved for treatment of relapsed/refractory Hodgkin lymphoma and anaplastic large cell lymphoma (ALCL); however, many patients do not achieve complete remission and develop BV-resistant disease. We selected for BV-resistant Hodgkin lymphoma (L428) and ALCL (Karpas-299) cell lines using either constant (ALCL) or pulsatile (Hodgkin lymphoma) exposure to BV. We confirmed drug resistance by MTS assay and analyzed CD30 expression in resistant cells by flow cytometry, qRT-PCR, and Western blotting. We also measured drug exporter expression, MMAE resistance, and intracellular MMAE concentrations in BV-resistant cells. In addition, tissue biopsy samples from 10 Hodgkin lymphoma and 5 ALCL patients who had relapsed or progressed after BV treatment were analyzed by immunohistocytochemistry for CD30 expression. The resistant ALCL cell line, but not the Hodgkin lymphoma cell line, demonstrated downregulated CD30 expression compared with the parental cell line. In contrast, the Hodgkin lymphoma cell line, but not the ALCL cell line, exhibited MMAE resistance and increased expression of the MDR1 drug exporter compared with the parental line. For both Hodgkin lymphoma and ALCL, samples from patients relapsed/resistant on BV persistently expressed CD30 by immunohistocytochemistry. One Hodgkin lymphoma patient sample expressed MDR1 by immunohistocytochemistry. Although loss of CD30 expression is a possible mode of BV resistance in ALCL in vitro models, this has not been confirmed in patients. MMAE resistance and MDR1 expression are possible modes of BV resistance for Hodgkin lymphoma both in vitro and in patients. Mol Cancer Ther; 14(6); 1376–84. ©2015 AACR.

Platelet-activating factor (PAF) is a potent endogenous mediator of bowel inflammation. It activates neutrophils that are needed to initiate the inflammatory response. Macrophage inflammatory protein-2 (MIP-2), a critical C-X-C chemokine secreted by macrophages and epithelial cells, is a potent chemoattractant for neutrophils. Whereas MIP-2 has been previously shown to mediate the injury in various organs, its role in acute intestinal injury has never been assessed. In this study, we first investigated the effect of PAF on MIP-2 expression in the intestine. Anesthetized young adult male Sprague-Dawley rats were injected intravenously with either PAF (1.5 μg/kg) or saline. Sixty minutes later, ileal MIP-2 gene expression was determined by semiquantitative RT-PCR, and plasma and ileal MIP-2 protein was determined by ELISA. In a second step, we assessed the role of MIP-2 in PAF-induced bowel injury. Rats were pretreated with rabbit anti-rat MIP-2 antibodies or control IgG for 90 min and then injected intravenously with PAF (2.5 μg/kg) for 90 min. We found that, in the rat intestine, 1) MIP-2 mRNA was only minimally expressed constitutively in sham-operated animals; 2) MIP-2 mRNA was significantly upregulated in response to PAF; 3) MIP-2 protein plasma levels and local production of MIP-2 in the ileum were markedly induced by PAF; 4) the administration of anti-rat MIP-2 IgG, but not control rabbit IgG, markedly reduced PAF-induced bowel injury (injury scores of 0.19 ± 0.09 vs. 1.12 ± 0.43, P < 0.05), hypotension, and leukopenia but did not reduce PAF-induced hemoconcentration. Thus we conclude that MIP-2 mediates PAF-induced intestinal injury.

Purpose: Epithelial cell adhesion molecule (EpCAM) is a widely expressed adhesion molecule in epithelial cancers. The purpose of this study is to determine the protein expression patterns of EpCAM in renal cell carcinoma (RCC) using tissue arrays linked to a clinicopathological database to evaluate both its predictive power in patient stratification and its suitability as a potential target for immunotherapeutic treatment strategies. Experimental Design: The University of California, Los Angeles kidney cancer tissue microarray contains specimens from 417 patients treated with nephrectomy. EpCAM protein expression in tumors and matched morphologically normal renal tissues was evaluated using anti-EpCAM immunohistochemistry. The resultant expression reactivity was correlated with clinicopathological variables. Results: EpCAM is consistently expressed in the distal nephron on normal renal epithelium. Clear cell RCCs show minimal and infrequent EpCAM expression, whereas chromophobe and collecting duct RCCs both demonstrate intense and frequent expression. Of 318 clear cell carcinomas used in the analysis, 10% were EpCAM positive in ≥50% of cells, and 8% of patients would be considered candidates for EpCAM-based therapy, based on high expression [≥moderate intensity and frequent (≥50%) expression] and the need for systemic treatment. EpCAM expression was an independent prognostic factor for improved disease-specific survival, with a multivariate hazard ratio of 0.63 (P = 0.017; 95% confidence interval, 0.43–0.92). Conclusions: EpCAM is a novel prognostic molecular marker in RCC patients, and its positive expression is an independent predictor associated with improved survival. However, high expression in morphologically normal renal tissues and minimal or absent expression in clear cell carcinomas will likely limit the utility of this epithelial marker in targeted treatments of this most common RCC type.

Summary 1. Inasmuch as virtually all studies on mortality and reproduction in insects are conducted under conditions in which food availability is constant, little is known about the demographic response of insects to variable food environments. For example, it is not known if and to what extent the life expectancy of insects subjected to shortages of high-quality food will increase and/or whether this increase is associated with major decreases in lifetime reproduction. 2. Therefore cohorts of 100 individual female medflies were subjected to different sets of conditions of protein availability (interspersed with sugar-only diets) including ad libitum sugar-only (no protein), ad libitum protein and full (protein) diet either every 2nd, 4th, 6th, 11th or 21st day, as well as two lag-treatments (1 day full diet followed by 30 days sugar-only, followed by one of two cyclical treatments). 3. Both life expectancy and lifetime reproduction were strongly affected by specific treatments. Specifically (i) mortality was inversely related to frequency of protein availability whereas lifetime reproduction was directly related; (ii) distinct cycles in reproduction began to appear when food pulse cycles were as short as every 4 days. However, egg-laying peaks and troughs were particularly pronounced in the 10- and 20-day food pulse cycles; (iii) the peak and trough levels were inversely related to cycle length; and (iv) the within-cycle height was independent of cycle length, occurring 4 days after protein food was made available to the cohort whether the cycle length was 5, 10 or 20 days. 4. The results shed new light on the within- and between-cycle and lifetime dynamics of reproduction when insects are subjected to variable food environments and indicate that medfly females track food level very closely.

Sarcomatoid metastatic renal cell carcinoma (mRCC) is associated with a poor prognosis, and the biology of the disease has been inadequately characterized. RNA sequencing (RNA-seq) was performed on adjacent benign, clear cell, and sarcomatoid components from clinical specimens with sarcomatoid mRCC. M phase and cell-cycle pathways were enriched in sarcomatoid versus adjacent clear cell components, suggesting greater cell proliferation. The expression of aurora kinase A (AURKA) was increased as part of these pathways, and its increased expression was validated by quantitative PCR (qPCR). Immunohistochemical (IHC) analysis revealed that AURKA levels were increased in sarcomatoid tissue compared with their benign or clear cell parts. The increase in AURKA correlated with increased mTOR pathway activity, as evidenced by increased expression of phosphorylated mTOR (S2448) and ribosomal protein S6K (T389). When AURKA was stably expressed in a RCC cell line (Renca), it resulted in increased expression and activity of mTOR, suggesting that overexpression of AURKA can activate the mTOR pathway. These results warrant the analysis of a larger clinical cohort and suggest that targeting AURKA and/or mTOR in patients with sarcomatoid mRCC should be explored. Implications: Comparative RNA-seq of adjacent sarcomatoid and clear cell histology of RCC indicates a proliferative phenotype and increased AURKA-dependent activation of mTOR signaling in sarcomatoid RCC, which could be targeted by available agents. Mol Cancer Res; 13(1); 130–7. ©2014 AACR.

We previously showed that group II phospholipase A2(PLA2-II), a secretory, bactericidal, and proinflammatory protein in intestinal crypts, is upregulated after lipopolysaccharide (LPS) and platelet-activating factor (PAF) challenge. Here we examined whether germ-free environment (GF) or antibiotic treatment (ABX) affects the pathophysiological responses and intestinal PLA2-II activity after PAF (1.5 μg/kg) or LPS (8 mg/kg) injection. We found that LPS and PAF induced hypotension and mild intestinal injury in conventionally fed (CN) rats; these changes were milder in ABX rats, whereas GF rats showed no intestinal injury. PLA2-II enzyme activity was detected in normal rat small intestine; the basal level was not diminished in ABX or GF rats. PAF and LPS caused an increase in PLA2-II activity, which was abrogated in GF and ABX rats. Recolonization of GF rats by enteral contamination restituted their PLA2-II response to PAF and LPS and susceptibility to bowel injury. We conclude that PAF- and LPS-induced increases in PLA2-II activity are dependent on gut bacteria, and ABX and GF rats are less susceptible to LPS-induced injury than CN rats.

Feeding a Western high-fat diet (HFD) to C57BL/6 mice induces obesity, associated with a chronic inflammatory state, lipid transport, and metabolic derangements, and organ system effects that particularly prominent in the kidneys. Here, we report that RLIP76 homozygous knock-out (RLIP76−/−) mice are highly resistant to obesity as well as these other features of metabolic syndrome caused by HFD. The normal increase in pro-inflammatory and fibrotic markers associated with HFD induced obesity in wild-type C57B mice was broadly and nearly completely abrogated in RLIP76−/− mice. This is a particularly striking finding because chemical markers of oxidative stress including lipid hydroperoxides and alkenals were significantly higher in RLIP76−/− mice. Whereas HFD caused marked suppression of AMPK in wild-type C57B mice, RLIP76−/− mice had baseline activation of AMP-activated protein kinase, which was not further affected by HFD. The baseline renal function was reduced in RLIP76−/− mice as compared with wild-type, but was unaffected by HFD, in marked contrast to severe renal impairment and glomerulopathy in the wild-type mice given HFD. Our findings confirm a fundamental role of RLIP76 in regulating the function of obesity-promoting pro-inflammatory cytokines, and provide a novel mechanism for targeted therapy of obesity and metabolic syndrome. Background: RLIP76 homozygous knock-out mice (RLIP76−/−) display a partially anti-metabolic syndrome phenotype characterized by insulin sensitivity, hypoglycemia, and hypolipidemia. Results: RLIP76−/− mice are highly resistant to obesity as well as these other features of metabolic syndrome (MetS) caused by a high-fat diet. Conclusion: Our findings confirm a fundamental role of RLIP76 in regulating the function of obesity-promoting pro-inflammatory cytokines. Significance: Present studies provide a novel mechanism for targeted therapy of obesity and MetS.

Background Several previous studies have identified a strong association between T-cell infiltration and clinical outcome in ovarian cancer. The role of B-cells remains controversial, however. Methods Forty-nine paraffin-embedded omental specimens derived from patients with high grade epithelial ovarian cancer were assessed. Immunohistochemical analyses were performed to characterize expression of CD19+ B-cells and pSTAT3 as high (>50% positively staining cells [PSCs]) or low (

SUMMARY Time course gene microarray is an important tool to identify genes with differential expressions over time. Traditional analysis of variance (ANOVA) type of longitudinal investigation may not be applicable because of irregular time intervals and possible missingness due to contamination in microarray experiments. Functional principal components analysis is proposed to test hypotheses in the change of the mean curves. A permutation test under a mild assumption is used to make the method more robust. The proposed method outperforms the recently developed extraction of differential gene expression and a 2-way mixed effects ANOVA under reasonable gene expression models in simulation. Real data on transcriptional profiles of blood cells microarray from treated and untreated individuals were used to illustrate this method.

Despite tremendous efforts in developing cancer vaccines and monoclonal antibodies (mAbs), only a few passive or active immunotherapeutic modalities have succeeded. The failure may be due to the existence of immunosuppressive factors, which caused anergy of patients' immune system. In this study, we discovered that CA19.9 is one such immunosuppressive factor, which could inhibit the proliferation of activated human lymphocytes. However, this inhibition could be reversed by a mAb, LC44, which was specifically generated against CA19.9. An in vitro cytotoxic experiment showed that mAb LC44 could form an immunocomplex with CA19.9, which subsequently induced the production of cytotoxic T-cells reacting to CA19.9-positive cancer cells. In addition, mAb LC44 could mediate the complement-dependent cytotoxicity to CA19.9-positive cancer cells. mAb LC44 showed an antitumor effect in immunodeficient mice with colon cancer burden in the presence or absence of CA19.9. Based on the observations from this study, we postulated that the mAb, LC44, could be a promising antitumor agent for gastrointestinal cancer and worthy of further investigation.

Background Genes that control circadian rhythms in organisms have been recognized, but have been difficult to detect because circadian behavior comprises periodically dynamic traits and is sensitive to environmental changes. Method We present a statistical model for mapping and characterizing specific genes or quantitative trait loci (QTL) that affect variations in rhythmic responses. This model integrates a system of differential equations into the framework for functional mapping, allowing hypotheses about the interplay between genetic actions and periodic rhythms to be tested. A simulation approach based on sustained circadian oscillations of the clock proteins and their mRNAs has been designed to test the statistical properties of the model. Conclusion The model has significant implications for probing the molecular genetic mechanism of rhythmic oscillations through the detection of the clock QTL throughout the genome.

CXCL2 (macrophage inflammatory protein-2 (MIP-2)), a critical chemokine for neutrophils, has been shown to be produced in the rat intestine in response to platelet-activating factor (PAF) and to mediate intestinal inflammation and injury. The intestinal epithelium, constantly exposed to bacterial products, is the first line of defence against micro-organisms. It has been reported that enterocytes produce proinflammatory mediators, including tumour necrosis factor (TNF) and PAF, and we showed that lipopolysaccharide (LPS) and TNF activate nuclear factor (NF)-kappaB in enterocytes. However, it remains elusive whether enterocytes release CXCL2 in response to LPS and TNF via a NF-kappaB-dependent pathway and whether this involves the endogenous production of TNF and PAF. In this study, we found that TNF and LPS markedly induced CXCL2 gene expression in IEC-6 cells, TNF within 30 min, peaking at 45 min, while LPS more slowly, peaking after 2 hr. TNF- and LPS- induced CXCL2 gene expression and protein release were completely blocked by pyrrolidine dithiocarbamate (PDTC) and helenalin, two potent NF-kappaB inhibitors. NEMO-binding domain peptide, a specific inhibitor of inhibitor protein kappaB kinase (IKK) activation, a major upstream kinase mediating NF-kappaB activation, significantly blocked CXCL2 gene expression and protein release induced by LPS. WEB2170 (PAF antagonist) and anti-TNF antibodies had no effect on LPS-induced CXCL2 expression. In conclusion, CXCL2 gene is expressed in enterocytes in response to both TNF and LPS. LPS-induced CXCL2 expression is dependent on NF-kappaB activation via the IKK pathway. The effect of LPS is independent of endogenous TNF and PAF.

Background: Burkitt lymphoma typically involves the bone marrow in advanced stage disease. Pure leukemic presentation of Burkitt lymphoma (pure Burkitt leukemia) with negative radiographic findings is uncommon but considered clinically as stage IV disease. The WHO classification clearly distinguishes Burkitt leukemia (formerly classified as FAB-L3) from B lymphoblastic leukemia, as the former has a mature B-cell phenotype (expresses surface immunoglobulin) and characteristically harbors a MYC translocation with an immunoglobulin partner. There is limited prognostic information on patients with pure Burkitt leukemia (PBL) because they are typically combined with Burkitt lymphoma patients with widespread disease (WBL). Methods: We performed a multicenter retrospective analysis of newly-diagnosed Burkitt lymphoma cases involving the bone marrow at four academic medical centers from 2000-2013. Inclusion criteria included availability of clinical information and follow-up data, MYC rearrangement, and treatment with intensive chemotherapy (Hyper-CVAD or ALL-like regimens). Pediatric patients were excluded (age < 21 years). Diagnosis was established by the institutions' expert hematopathologist in conjunction with cytogenetic, flow cytometric, and radiographic findings. Patients were placed in the pure Burkitt leukemia (PBL) group if they had bone marrow involvement but were otherwise radiographically negative (i.e. PET negative). Kaplan-Meier analysis was used to examine the difference in overall survival between the WBL and PBL groups. We also determined prognostic factors associated with survival in univariate and multivariate Cox regression analyses. Results: We identified 51 patients with bone marrow involvement by Burkitt lymphoma. Of these patients, 24 were excluded because of a lack of clinical or follow-up information (15), pediatric age group (7), no treatment initiated (1), or misdiagnosed and given inadequate treatment (1). Of the 27 patients that met our inclusion criteria, 11 patients had pure Burkitt leukemia (PBL) and 16 had tissue involvement with bone marrow disease (WBL). The male-to-female ratio in the PBL group was 4.5:1 and in the WBL 4:1 (p=0.23). The median age for the PBL was 46 years vs 47 years in the WBL (p=0.34). CSF involvement was similar in both groups (30% PBL vs. 38.5% WBL; p=0.14); with elevated LDH levels in all patients in both groups (PBL median 3399 IU/L, WBL 2550 IU/L; p=0.81). In general, the WBL group had more complex karyotypes and a significantly greater number of cases with chromosome 1q abnormalities (5/7, 71%) compared to the PBL group (1/5, 20%). In the survival analysis, patients with PBL exhibited significantly better survival with a 5-year-overall survival of 79.5% (95% CI: 57.7-100%) vs. 18.4% (95% CI: 5.3-63.3%) in the WBL group (p=0.002). Conclusion: To the best of our knowledge, this is the largest series comparing adults with pure Burkitt leukemia and Burkitt lymphoma with widespread disease. Within the limitations of a retrospective analysis, the 5-year overall survival for the widespread Burkitt lymphoma (WBL) group is inferior compared to pure Burkitt leukemia (PBL) treated with intensive chemotherapy. Interestingly, the WBL group had more complex karyotypes compared to the PBL group. Figure 1. Overall Survival of Burkitt Leukemia versus Widespread Burkitt Lymphoma (BL). Figure 1. Overall Survival of Burkitt Leukemia versus Widespread Burkitt Lymphoma (BL). Disclosures No relevant conflicts of interest to declare.

We tested the hypothesis that relatively symmetrical flies live longer. Vein measurements on the left and right wings from the same individual were used to characterize bilateral symmetry in relationship to age-specific survival in defined cohorts. A longitudinal cohort study supported the hypothesis of a correlation between bilateral symmetry and longevity. For another type of experiment, wings were removed from females and males at approximately the beginning of adult life. Thus, there would be no effect of wings per se on adult survival. These wings were measured to characterize bilateral asymmetry, and the day of death of each dewinged individual was determined. Wing symmetry of females and males proved to be a statistically significant predictor of life span, especially for males.

The triorganotin 2-phenyl-1,2,3-triazole-4-carboxylates, 2-PhC 2 N 3 CO 2 SnR 3 (R = C 6 H 5 , 1 ; c -C 6 H 11 , 2 ; C 6 H 5 C(CH 3 ) 2 CH 2 , 3 ), have been prepared and characterized by means of elemental analysis, IR and NMR ( 1 H, 13 C and 119 Sn) spectroscopy. The crystal structures of 1 and 3 have been determined. Compound 1 is polymeric in nature with a trigonal bipyramidal configuration, and compound 3 shows a tetrahedral geometry. Bioassay results have shown that these compounds have good antibacterial and antitumor activity. The activity against three human tumor cell lines (HeLa, CoLo205 and MCF-7) decreased in the order 1 > 2 > 3 .

Purpose: An accurate system for predicting survival for patients with solid tumors will allow for better patient selection for both established and novel therapies. We propose a staging system for clear cell variants of renal cell carcinoma (RCC) that includes molecular predictors and standard clinical predictors such as tumor-node-metastasis (TNM) stage, histological grade, and performance status (PS). Experimental Design: A custom tissue array was constructed using clear cell RCC from 318 patients, representing all stages of localized and metastatic RCC, and immunohistochemically stained for molecular markers Ki67, p53, gelsolin, CA9, CA12, PTEN, EpCAM, and vimentin. We present a strategy for evaluating individual candidate markers for prognostic information and integrating informative markers into a multivariate prognostic system. Results: The overall median follow-up and the median follow-up for surviving patients were 28 and 55 months, respectively. A prognostic model based primarily on molecular markers included metastasis status, p53, CA9, gelsolin, and vimentin as predictors and had high discriminatory power: its statistically validated concordance index (C-index) was found to be 0.75. A prognostic model based on a combination of clinical and molecular predictors included metastasis status, T stage, Eastern Cooperative Oncology Group PS, p53, CA9, and vimentin as predictors and had a C-index of 0.79, which was significantly higher (P < 0.05) than that of prognostic models based on grade alone (C = 0.65), TNM stage alone (C = 0.73), or the University of California Los Angeles integrated staging system (C = 0.76). Conclusions: Protein expressions obtained using widely available technology can complement standard clinical predictors such as TNM stage, histological grade, and PS.

Motivation: The study of the dynamics of regulatory processes has led to increased interest for the analysis of temporal gene expression level data. To address the dynamics of regulation, expression data are collected repeatedly over time. It is difficult to statistically represent the resulting high-dimensional data. When regulatory processes determine gene expression, time-warping is likely to be present, i.e. the sample of gene expression trajectories reflects variation not only in terms of the expression amplitudes, but also in terms of the temporal structure of gene expression. Results: A non-parametric time-synchronized iterative mean updating technique is proposed to find an overall representation that corresponds to a mode of a sample of expression profiles, viewed as a random sample in function space. The proposed algorithm explores the application of previous work of Hall and Heckman to genome-wide expression data and provides an extension that includes random time-warping with the aim to synchronize timescales across genes. The proposed algorithm is universally applicable for the construction of modes for functional data with time-warping. We demonstrate the construction of mode functions for a sample of Drosophila gene expression data. The algorithm can be applied to define clusters among the observed trajectories of gene expression, without any kind of prior non-time-warped clustering, as illustrated in the numerical example.

Over 97% of the 203 male medflies monitored in a lifetime study of their behaviour exhibited what we term supine behaviour (temporary upside-down orientation) starting an average of 16.1 days prior to their death (mean lifespan of 61.7 days). Supine onset increased the mortality risk by 39.5-fold and a unit increase in supine level increased mortality by 26.3%. The discovery that behavioural traits in insects can be used as biomarkers of their health and to predict their time to death has important implications regarding research on morbidity dynamics, behavioural neuroethology and gerontology, and the interpretation of longevity extension in model organisms.

Triple-negative breast cancer (TNBC) is one of the hardest subtypes of breast cancer to treat due to the heterogeneity of the disease and absence of well-defined molecular targets. Emerging evidence has shown the role of cohesin in the formation and progression of various cancers including colon and lung cancer but the role of cohesin in breast cancer remains elusive. Our data showed that structural maintenance of chromosome 1 (SMC1), a subunit of the cohesin protein complex, is differentially overexpressed both at RNA and protein level in a panel of TNBC cell lines as compared to normal epithelial or luminal breast cancer cells, suggesting that the amplified product of this normal gene may play role in tumorigenesis in TNBC. In addition, our results show that induced overexpression of SMC1 through transient transfection enhanced cell migration and anchorage independent growth while its suppression with targeted small interfering RNA (siRNA) reduced the migration ability of TNBC cells. Increased expression of SMC1 also lead to increase in the mesenchymal marker vimentin and decrease in the normal epithelial marker, E-cadherin. Immunocytochemical studies along with flow cytometry and cell fractionation showed the localization of SMC1 in the nucleus, cytoplasm and also in the plasma membrane. The knockdown of SMC1 by siRNA sensitized the TNBC cells towards a PARP inhibitor (ABT-888) and IC₅₀ was approximately three fold less than ABT-888 alone. The cytotoxic effect of combination of SMC1 suppression and ABT-888 was also confirmed by the colony propagation assay. Taken together, these studies report for the first time that SMC1 is overexpressed in TNBC cells where it plays a role in cell migration and drug sensitivity, and thus provides a potential therapeutic target for this highly invasive breast cancer subtype.

475 Background: Consistent with other retrospective analyses, data from our institutional experience indicates that patients (pts) with sarcomatoid mRCC have a poorer outcome as compared to pts that lack sarcomatoid features (Pal SK, et al. Urol Oncol 2012). The preponderance of correlative studies to date focused on epithelial-to-mesenchymal transition (EMT) as a driver of sarcomatoid disease; however, the role of vascular endothelial growth factor (VEGF) and mammalian target of rapamycin (mTOR) signaling is poorly understood. Methods: Of 270 pts with mRCC in our institutional database, 21 pts were noted to have sarcomatoid features. Thirteen of these pts had available tissue from nephrectomy or diagnostic biopsy. An additional 13 pts with mRCC and available tissue were identified from the database who had a similar MSKCC risk stratification but lacked sarcomatoid features. Immunohistochemical staining were performed for moieties related to VEGF-mediated signaling (pS6K) and EMT (Twist, E-cadherin and N-cadherin). Results: Among matched pts with and without sarcomatoid features (n=13 for each group), 9 pts (69.2%) in each group had poor risk disease by MSKCC criteria, while the remainder had intermediate risk disease. Given our risk-matching approach, median survival was similar in both groups (6 mos in pts with no sarcomatoid features vs. 9 mos in pts with sarcomatoid features, p = NS). In evaluable specimens from pts with no sarcomatoid features, the proportion of cell staining positively for pS6K was 24.4%. A higher proportion of pS6K staining was found in pts with sarcomatoid mRCC, both in sarcomatoid components (60.0%) and non-sarcomatoid components (52.5%). Staining for N-cadherin, E-cadherin, and Twist were highly variable, and no observable differences between groups were identified. Conclusions: Although chemotherapeutic strategies are a common 1st-line approach to sarcomatoid mRCC, the finding of higher pS6K staining in this population suggest the potential for currently approved targeted therapies in this disease. Prospective assessment of VEGF- and mTOR-directed therapies for sarcomatoid mRCC, as in ECOG 1808 (NCT01164228), should be encouraged.

8089 Background: Increased immune responses post autologous HCT may be of benefit in long term disease control. Responses may be mediated by NK cell function and possibly other alternate pathways, including costimulatory molecule pathways. This pilot study assesses the expression of inhibitory (PD-1 and CTLA-4) and stimulatory (OX-40, ICOS, 4-1BB, and CD28) molecules on NK cells after auto-HCT in MM patients and evaluates the effect of lenalidomide treatment on these pathways. Methods: 17 patients with MM undergoing HCT, median age 56.7 years (36 – 67), were included in the study. Peripheral blood samples were taken 3 days prior to HCT and 14, 30, 60, 90, 180 days after HCT. At d180 post-HCT, 13/17 patients were receiving lenalidomide with d91 as median start date. NK cells and their costimulatory molecules were evaluated by flowcytometry using 2 six color panels of antibodies. One way ANOVA test and Kruskal-Wallis test (non-parametric) were applied to analyze the data using the Graphpad Software. Results: See table below. NK cell number was highest (median: 26% of total lymphocytes) at d14 (p: < 0.0001) compared to pre and post HCT levels. At d180, TNF-R OX40 expression was significantly increased in ≤PR group (n=5) (median: 9.5% of NK cells) compared to ≥VGPR (n=12) (0.8%; p=0.0084). In addition, NK cell number was higher in the lenalidomide group (n=13) (median: 15.15 % of total lymphocytes) compared to the no lenalidomide group (n=4) (6.74%; p=0.0108) at d180 post HCT. Significantly lower level of CTLA-4 expression was also found in the lenalidomide group (0.33% vs. 2.54%; p=0.0362). Conclusions: We observed NK cell recovery to baseline values at 60 days after HCT. At d180 post-HCT, OX-40 expression in NK cells was higher in ≤PR group than ≥VGPR group. Lenalidomide treatment was associated with higher NK cells number and decreased expression of CTLA-4. This observation could be a possible marker of enhanced host NK cell immune response against MM. Future clinical trials will explore therapies that increase NK cell responses. [Table: see text]

7572 Background: MM-10-001 is a bioactive agent exported from Shiitake Mycelium in aqueous medium. The beta-glucan in MM-10-001 binds to a lectin site within the complement receptor 3 on leukocytes...