Search

Cucumber mosaic virus (CMV) is a generalist pathogen that infects many economically important crops in Greece. The present study was designed to evaluate the genetic variability of Greek CMV isolates in combination with their satellite RNAs (satRNAs). To achieve this goal, 77 CMV isolates were collected from symptomatic Greek vegetables, mainly tomatoes and cucurbits, alongside their neighboring crops, during a four-year period from 2015 to 2018. Phylogenetic analysis of a partial coat protein (CP) gene segment revealed that all of the isolates belong to CMV subgroups IA and IB and that they are closely related to previously reported Greek isolates. It should be noted, however, that the latter mainly included tomato isolates. Network analysis of the evolutionary relationships among the CP sequences of the Greek isolates in comparison to the corresponding sequences obtained from the GenBank database indicated two predominant common ancestors and at least three differentiated peripherals, and possibly host-associated (tomatoes, legumes, cucurbits) haplogroups (strain groups). More specifically, host-adaptive evolution can be postulated regarding the tomato isolates in subgroup IB. Necrogenic or non-necrogenic satRNAs were detected in four samples from tomato and melon, and this is the first report of non-necrogenic satRNAs in CMV in Greece.

Cassava brown streak disease (CBSD) is a destructive disease of cassava in Eastern and Central Africa. Because there was no source of resistance in African varieties to provide complete protection against the viruses causing the disease, we searched in South American germplasm and identified cassava lines that did not become infected with the cassava brown streak viruses. These findings motivated further investigations into the mechanism of virus resistance. We used RNAscope® in situ hybridization to localize cassava brown streak virus in cassava germplasm lines that were highly resistant (DSC 167, immune) or that restricted virus infections to stems and roots only (DSC 260). We show that the resistance in those lines is not a restriction of long-distance movement but due to preventing virus unloading from the phloem into parenchyma cells for replication, thus restricting the virus to the phloem cells only. When DSC 167 and DSC 260 were compared for virus invasion, only a low CBSV signal was found in phloem tissue of DSC 167, indicating that there is no replication in this host, while the presence of intense hybridization signals in the phloem of DSC 260 provided evidence for virus replication in companion cells. In neither of the two lines studied was there evidence of virus replication outside the phloem tissues. Thus, we conclude that in resistant cassava lines, CBSV is confined to the phloem tissues only, in which virus replication can still take place or is arrested.

Field surveys were conducted in Greek olive orchards from 2017 to 2020 to collect information on the sanitary status of the trees. Using a high-throughput sequencing approach, viral sequences were identified in total RNA extracts from several trees and assembled to reconstruct the complete genomes of two isolates of a new viral species of the genus Tepovirus (Betaflexiviridae), for which the name olive virus T (OlVT) is proposed. A reverse transcription–polymerase chain reaction assay was developed which detected OlVT in samples collected in olive growing regions in Central and Northern Greece, showing a virus prevalence of 4.4% in the olive trees screened. Sequences of amplified fragments from the movement–coat protein region of OlVT isolates varied from 75.64% to 99.35%. Three olive varieties (Koroneiki, Arbequina and Frantoio) were infected with OlVT via grafting to confirm a graft-transmissible agent, but virus infections remained latent. In addition, cucumber mosaic virus, olive leaf yellowing-associated virus and cherry leaf roll virus were identified.

Two-component plant defenses such as cyanogenic glucosides are produced by many plant species, but phloem-feeding herbivores have long been thought not to activate these defenses due to their mode of feeding, which causes only minimal tissue damage. Here, however, we report that cyanogenic glycoside defenses from cassava (Manihot esculenta), a major staple crop in Africa, are activated during feeding by a pest insect, the whitefly Bemisia tabaci, and the resulting hydrogen cyanide is detoxified by conversion to beta-cyanoalanine. Additionally, B. tabaci was found to utilize two metabolic mechanisms to detoxify cyanogenic glucosides by conversion to non-activatable derivatives. First, the cyanogenic glycoside linamarin was glucosylated 1–4 times in succession in a reaction catalyzed by two B. tabaci glycoside hydrolase family 13 enzymes in vitro utilizing sucrose as a co-substrate. Second, both linamarin and the glucosylated linamarin derivatives were phosphorylated. Both phosphorylation and glucosidation of linamarin render this plant pro-toxin inert to the activating plant enzyme linamarase, and thus these metabolic transformations can be considered pre-emptive detoxification strategies to avoid cyanogenesis.

Cucumber vein yellowing virus (CVYV) is a member of the genus Ipomovirus in the family Potyviridae. In the National Center for Biotechnology Information (NCBI) database, three complete genome sequences of CVYV isolates from Spain (NC_006941), Israel (KT276369), and Jordan (JF460793) are available. In this study, we report the complete sequence of an isolate of CVYV from Portugal (DSMZ PV-0776) along with the construction of an infectious full-length cDNA clone via Gibson assembly. The sequence of CVYV Portugal shows the closest relationship to a CVYV isolate from Spain (genome, 99.7% identity; polyprotein, 99.7% identity). The CVYV full-length cDNA clone was introduced by electroporation into Rhizobium radiobacter and infiltrated into the cotyledons of Cucumis sativus plantlets, resulting in symptoms resembling those of the wild-type virus. Transmission of the infectious CVYV full-length clone by the whitefly Bemisia tabaci was confirmed. This first report confirming the infectivity of a CVYV cDNA clone provides the opportunity to study gene functions in a consistent genomic background.

Following a request from the EU Commission, the Panel on Plant Health performed a categorisation of beet necrotic yellow vein virus (BNYVV), the causal agent of the sugar beet rhizomania disease. The virus is currently listed in Annex III as a protected zone (PZ) quarantine pest of the Commission Implementing Regulation (EU) 2019/2072. The identity of the BNYVV is well established. BNYVV is a soil‐borne virus transmitted by the obligate root plasmodiophorid endoparasite Polymyxa betae. BNYVV is widely distributed in the EU, but is not reported in the following EU PZs: Ireland, France (Brittany), Portugal (Azores), Finland and Northern Ireland. The virus may enter, become established and spread in the PZs via P. betae resting spores with soil and growing media as such or attached to machinery and with roots and tubercles of species other than B. vulgaris and with plants for planting. Introduction of BNYVV would have a negative impact on sugar beet and other beet crops in PZs, because of yield and sugar content reduction. Phytosanitary measures are available to reduce the likelihood of entry and spread in the PZs. Once the virus and its plasmodiophorid vector have entered a PZ, their eradication would be difficult due to the persistence of viruliferous resting spores in the soil. The main knowledge gaps or uncertainties identified concerning the presence of BNYVV in the PZs and the incidence and distribution of BNYVV in Switzerland, a country to which a range of specific requirements do not apply. BNYVV meets all the criteria that are within the remit of EFSA to qualify as a potential protected zone union quarantine pest. Plants for planting are not considered as a main means of spread, and therefore BNYVV does not satisfy all the criteria evaluated by EFSA to qualify as potential Union regulated non‐quarantine pest.

The following text summarizes the different perspectives of presenters participating in the section Plant Protection in the Tropics and Subtropics, 61st German Congress of Plant Protection, held on September 11, 2018, University of Hohenheim, Germany. The aim of the symposium was to develop a critical perspective on the status of the fight against the spreading of the fall armyworm (FAW) Spodoptera frugiperda in Africa. The results of the presentations and discussions are reported here.

Saffron (Crocus sativus L.), a highly valuable crop famous for the unique taste, aroma, colour and medicinal properties of the stigmas, is widely cultivated in Iran. During 2011–2016, a total of 965 samples were randomly collected from six important saffron growing provinces of Iran to test for the presence of viruses. Assays revealed the presence of a distinct species of the genus Potyvirus, which has been tentatively named saffron latent virus (SaLV). Phylogenetic analysis of the SaLV complete genome sequence, 9,693 nucleotides (nt) excluding poly(A) tail, revealed that this virus grouped into Bean common mosaic virus subgroup in the genus Potyvirus with the closest relative being Bean common mosaic necrosis virus. A number of distinct plant species were evaluated for the host range of SaLV; Chenopodium amaranticolor and Chenopodium quinoa were found to be systemic hosts of SaLV. There were no nucleotide sites that indicated any recombination events, and the analysis of the coat protein (CP) sequence of 50 samples, collected from different geographical origins, did not show spatially structured diversity. Overall, our data shows strong negative selection pressure in CP, estimated by nucleotide sequences. The relevance of SaLV for saffron production in Iran remains to be established.

A survey to identify the distribution of virus diseases of maize was made in major maize growing regions of Ethiopia. Four surveys were conducted between 2015 and 2017. A total of 284 maize fields have been surveyed, of which 846 leaf samples with virus like disease symptoms were collected from 191 fields. There were no symptoms indicating for virus presence in maize grown in 93 fields which were exempted from sampling, while in contrast up to 100% disease incidence was recorded in maize grown in the Benishangul-Gumuz, Oromia and South Nations, Nationalities and People (SNNP) regions. Symptoms varied in maize ranging from the most common mosaic and streak to severe leaf mottling and necrosis as well as stunting and pre-mature plant death. Double or triple antibody sandwich (DAS or TAS) enzyme-linked immuno-sorbent assay (ELISA) to test for eight common maize viruses such as Maize chlorotic mottle virus (MCMV), Sugarcane mosaic virus (SCMV), Maize streak virus (MSV), Maize dwarf mosaic virus (MDMV), Maize mosaic virus (MMV), Maize stripe virus (MSpV), Wheat streak mosaic virus (WSMV) and Johnsongrass mosaic virus (JGMV) confirmed the presence of MCMV, SCMV and MSV in the leaf samples. Single or mixed infections with MCMV and SCMV frequently occurred and triple infections of MCMV, SCMV and MSV were found in 1% of samples from SNNP region. Sequence analysis of the coat protein genes of randomly selected seropositive samples of the three viruses showed little variability within the studied isolates and those retrieved from the GenBank. Our results indicated maize lethal necrosis disease (MLND) caused by MCMV and SCMV co-infection was the most important disease in SNNP and Oromia while maize streak disease was the predominant virus infecting maize in Benishangul-Gumuz.

Electron microscopy of leaf samples displaying streak symptoms from enset (Ensete ventricosum), a banana‐like plant widely cultivated in Ethiopia, showed the presence of bacilliform shaped virions as known for badnaviruses. DNA extracts subjected to rolling circle amplification (RCA), polymerase chain reaction (PCR) and cloning and sequence analysis revealed that the virus has a circular double‐stranded DNA genome of 7,163 nucleotides encoding predicted proteins of 21.5 kDa, 14.5 kDa and 202.5 kDa, a genome organization known for badnaviruses. The virus is phylogenetically most closely related to Sugarcane bacilliform Guadeloupe D virus with a nucleotide sequence identity of 77.2% at the conserved RT/RNase‐H region and 73.6% for the whole genome. Following the current species demarcation criteria, the virus should be considered as an isolate of a new species in the genus Badnavirus for which the name Enset leaf streak virus (ELSV) is suggested. Leaf samples from enset and banana were screened using virus‐specific primers, and ELSV was detected in six of 40 enset but not found in any of 61 banana samples. On the other hand, Banana streak OL virus (BSOLV) was detected from the majority (60%) of symptomatic banana samples but not from enset samples. This paper reports the first full‐genome sequence of a putative new badnavirus species infecting plants in the genus Ensete. In addition, this is the first report of the occurrence of BSOLV in Ethiopia.

Viral diseases are a major constraint to cucurbit production worldwide. In 2014 rainy and dry cropping seasons, cross-sectional surveys were conducted in farmers’ cucurbits fields in six agro-ecological zones (AEZs) of Cote d’Ivoire to assess prevalence and distribution of viral diseases. A total of 757 leaf samples were collected from melon, squash, cucumber, watermelon, gourd calabash, and pumpkin plants showing various virus-like symptoms. Enzyme linked immunosorbent assay (ELISA) using antisera against cucumber mosaic virus (CMV), zucchini yellow mosaic virus (ZYMV), papaya ringspot virus (PRSV), watermelon mosaic virus (WMV) and Moroccan watermelon mosaic virus (MWMV) were performed to detect viruses in the samples collected. Results revealed that viral diseases were prevalent in all the agro-ecological zones, with significantly higher mean prevalence in the dry season (53.6%) than in the rainy season (29.35%). The overall mean disease severity index was also significantly higher in the dry season (47.58%) than in the rainy season (28.17%). CMV, ZYMV and PRSV were found in all AEZs at varying rates between the rainy and dry seasons, whereas WMV and MWMV were not detected. CMV was more prevalent in the dry season (32%) whereas ZYMV was more prevalent in the rainy season (34%). This study has revealed that viruses infecting cucurbits are widespread and occurred in mixed infection which poses a potential threat to cucurbit crops production in Cote d’Ivoire.

Three field experiments were conducted to assess the effect of planting date on the incidence of viral diseases and the severity and the susceptibility of the cultivars. Two cultivars of cucumber (Hybrid Tokyo F1 and Poinsett) and one local variety of zucchini (Bolle) were used for the evaluation in May-July 2014, September-November 2014, and February-April 2015. A randomized complete block design with three replications was used for the experiments. Data were collected on disease incidence, severity, and time until first symptoms occurred. Area under severity index progress curve (AUSIPC) and area under disease progress curve (AUDPC) were calculated respectively for disease severity as well as the incidence on each cultivar. The results demonstrate the susceptibility of all cultivars to the tested viral diseases. The effect of planting dates on cultivars was significantly different (P 0.05) in planting date-variety interaction.

Background Cassava brown streak disease is emerging as the most important viral disease of cassava in Africa, and is consequently a threat to food security. Two distinct species of the genus Ipomovirus (family Potyviridae) cause the disease: Cassava brown streak virus (CBSV) and Ugandan cassava brown streak virus (UCBSV). To understand the evolutionary relationships among the viruses, 64 nucleotide sequences from the variable P1 gene from major cassava producing areas of east and central-southern Africa were determined. Methods We sequenced an amplicon of the P1 region of 31 isolates from Malawi and Tanzania. In addition to these, 33 previously reported sequences of virus isolates from Uganda, Kenya, Tanzania, Malawi and Mozambique were added to the analysis. Results Phylogenetic analyses revealed three major P1 clades of Cassava brown streak viruses (CBSVs): in addition to a clade of most CBSV and a clade containing all UCBSV, a novel, intermediate clade of CBSV isolates which has been tentatively called CBSV-Tanzania (CBSV-TZ). Virus isolates of the distinctive CBSV-TZ had nucleotide identities as low as 63.2 and 63.7% with other members of CBSV and UCBSV respectively. Conclusions Grouping of P1 gene sequences indicated for distinct sub-populations of CBSV, but not UCBSV. Representatives of all three clades were found in both Tanzania and Malawi.

The EFSA Journal is a publication of the European Food Safety Authority, an agency of the European Union. Requestor: European Commission. Question number: EFSA‐Q‐2020‐00126 Following a request from the European Commission, the Panel on Plant Health performed a pest categorisation on tomato leaf curl New Delhi virus (ToLCNDV). ToLCNDV is a well-defined bipartite Begomovirus species, sometimes associated with satellite molecules. It is transmitted by Bemisia tabaci to a wide range of hosts. ToLCNDV is reported from Estonia, Greece, Italy, Portugal and Spain, with limited distribution. The prevalent strain (ToLCNDV-ES) in these countries is particularly adapted to cucurbits and is different from isolates reported outside the EU, which are better adapted to solanaceous crops and could therefore pose additional risk for EU agriculture. The virus is regulated under Commission Implementing Regulation (EU) 2019/2072. The main pathway of entry identified is plants for planting of susceptible hosts, even if entry could also occur via commodities carrying viruliferous B. tabaci and possibly by seeds. While establishment and local spread rely on B. tabaci, the virus can also be dispersed over long distances by movement of infected plants for planting. Establishment and spread are limited to regions with ecoclimatic conditions suitable for the establishment of vector populations (southern regions of Europe) or can occur as outbreaks wherever crops are grown under protected cultivation. The main uncertainties associated with this pest categorisation are the distribution and prevalence of ToLCNDV in the EU, the magnitude of the virus impact particularly on hosts different from Cucurbitaceae, and seed transmission. ToLCNDV meets all the criteria evaluated by EFSA to qualify as potential Union Quarantine Pest (QP); conversely, ToLCNDV does not meet the criterion of being widespread in the EU to qualify as a Regulated Non-Quarantine Pest (RNQP). Should new data show that ToLCNDV is widespread in the EU, the possibility would exist for non-EU isolates to qualify as QP, while ToLCNDV EU isolates (ToLCNDV-ES) could qualify as RNQP.

RNAscope has been recently introduced by Advanced Cell Diagnostics (Newark, CA, USA) for in situ hybridization (ISH) of target RNAs using a proprietary technology for probe design and hybridization assay. The method has been extensively used as a basis for sensitive diagnostic assays in the medical field, while applications of this technique in plant sciences are still rare. Here, we describe a multiplex ISH protocol for detection of two plant viruses in formalin-fixed paraffin-embedded tissue sections from cassava. The dual-color protocol described can be used as reference for virus/host interaction studies including the visualization of virus nucleic acids and plant endogenous mRNAs. RNAscope provides a specificity and sensitivity of target detection that otherwise cannot be reached.

Following a request from the EU Commission, the Panel on Plant Health addressed the pest categorisation of the viruses and viroids of Vitis L. determined as being either non-EU or of undetermined standing in a previous EFSA opinion. These infectious agents belong to different genera and are heterogeneous in their biology. With the exclusion of grapevine virus 101-14.N.23.9.1/South Africa/2009 for which very limited information exists, the pest categorisation was completed for 30 viruses or viroids having acknowledged identities and available detection methods. All these viruses are efficiently transmitted by vegetative propagation techniques, with plants for planting representing the major pathway for long-distance dispersal and thus considered as the major pathway for potential entry. Depending on the virus, additional pathway(s) can also be seeds, pollen and/or vector(s). Most of the viruses categorised here are known to infect only one or few plant genera, but some of them have a wide host range, thus extending the possible entry pathways. Grapevine yellow speckle viroid 2, blueberry leaf mottle virus, grapevine Ajinashika virus, grapevine Anatolian ringspot virus, grapevine berry inner necrosis virus, grapevine deformation virus, grapevine fabavirus, grapevine red blotch virus, grapevine stunt virus, grapevine Tunisian ringspot virus, grapevine vein-clearing virus, temperate fruit decay-associated virus, peach rosette mosaic virus, tobacco ringspot virus, tomato ringspot virus meet all the criteria evaluated by EFSA to qualify as potential Union quarantine pests (QPs). With the exception of impact for the EU territory, on which the Panel was unable to conclude, blackberry virus S, grapevine geminivirus A, grapevine leafroll-associated virus 7, grapevine leafroll-associated virus 13, grapevine satellite virus, grapevine virus E, grapevine virus I, grapevine virus J, grapevine virus S, summer grape enamovirus, summer grape latent virus satisfy all the other criteria to be considered as potential Union QPs. Australian grapevine viroid, grapevine cryptic virus 1, grapevine endophyte endornavirus and wild vitis virus 1 do not meet all the criteria evaluated by EFSA to be regarded as potential Union QPs because they are not known to cause an impact on Vitis. For several viruses, especially those recently discovered, the categorisation is associated with high uncertainties mainly because of the absence of data on their biology, distribution and impact. Since this opinion addresses specifically non-EU viruses, in general these viruses do not meet the criteria assessed by EFSA to qualify as a potential Union regulated non-quarantine pests.

The Panel on Plant Health of EFSA conducted a pest categorisation of 17 viruses of Rubus L. that were previously classified as either non-EU or of undetermined standing in a previous opinion. These infectious agents belong to different genera and are heterogeneous in their biology. Blackberry virus X, blackberry virus Z and wineberry latent virus were not categorised because of lack of information while grapevine red blotch virus was excluded because it does not infect Rubus. All 17 viruses are efficiently transmitted by vegetative propagation, with plants for planting representing the major pathway for entry and spread. For some viruses, additional pathway(s) are Rubus seeds, pollen and/or vector(s). Most of the viruses categorised here infect only one or few plant genera, but some of them have a wide host range, thus extending the possible entry pathways. Cherry rasp leaf virus, raspberry latent virus, raspberry leaf curl virus, strawberry necrotic shock virus, tobacco ringspot virus and tomato ringspot virus meet all the criteria to qualify as potential Union quarantine pests (QPs). With the exception of impact in the EU territory, on which the Panel was unable to conclude, blackberry chlorotic ringspot virus, blackberry leaf mottle-associated virus, blackberry vein banding-associated virus, blackberry virus E, blackberry virus F, blackberry virus S, blackberry virus Y and blackberry yellow vein-associated virus satisfy all the other criteria to be considered as potential QPs. Black raspberry cryptic virus, blackberry calico virus and Rubus canadensis virus 1 do not meet the criterion of having a potential negative impact in the EU. For several viruses, the categorisation is associated with high uncertainties, mainly because of the absence of data on biology, distribution and impact. Since the opinion addresses non-EU viruses, they do not meet the criteria to qualify as potential Union regulated non-quarantine pests. (C) 2020 European Food Safety Authority. EFSA Journal published by John Wiley and Sons Ltd on behalf of European Food Safety Authority.

Following a request from the EU Commission, the Panel on Plant Health addressed the pest categorisation of the viruses and viroids of Fragaria L. determined as being either non‐EU or of undetermined standing in a previous EFSA opinion. These infectious agents belong to different genera and are heterogeneous in their biology. With the exclusion of strawberry latent virus and strawberry latent C virus for which very limited information exists, the pest categorisation was completed for 12 viruses having acknowledged identities and available detection methods. All these viruses are efficiently transmitted by vegetative propagation techniques, with plants for planting representing the major pathway for long‐distance dispersal and thus considered as the major pathway for entry. Depending on the virus, additional pathway(s) can also be Fragaria seeds, pollen and/or vector(s). Most of the viruses categorised here are known to infect only one or few plant genera, but some of them have a wide host range, thus extending the possible entry pathways. Strawberry chlorotic fleck‐associated virus, strawberry leaf curl virus, strawberry necrotic shock virus, strawberry pallidosis‐associated virus, strawberry vein banding virus (SVBV) and tomato ringspot virus meet all the criteria evaluated by EFSA to qualify as potential Union quarantine pests (QPs). For SVBV, the Panel considered that following its entry and establishment into the EU territory, an impact of uncertain magnitude is expected mainly because a synergistic effect may occur in strawberry in case of mixed infections with viruses already present in the EU . Strawberry crinivirus 3, strawberry crinivirus 4 and strawberry polerovirus 1 meet all criteria for being considered as potential Union QPs, except for the impact in the EU territory, on which the Panel was unable to conclude. Fragaria chiloensis cryptic virus, Fragaria chiloensis latent virus and strawberry pseudo mild yellow edge virus do not meet the criterion of having potential negative impact in the EU. For several viruses, especially those recently discovered, the categorisation is associated with high uncertainties mainly because of the absence of data on their biology, distribution and impact. Since this opinion addresses specifically the non‐EU viruses, in general, these viruses do not meet the criteria assessed by EFSA to qualify as potential Union regulated non‐quarantine pests., This publication is linked to the following EFSA Journal articles: http://onlinelibrary.wiley.com/doi/10.2903/j.efsa.2019.5501/full, http://onlinelibrary.wiley.com/doi/10.2903/j.efsa.2019.5590/full, http://onlinelibrary.wiley.com/doi/10.2903/j.efsa.2019.5735/full, http://onlinelibrary.wiley.com/doi/10.2903/j.efsa.2019.5769/full

Following a request from the EU Commission, the Panel on Plant Health performed a pest categorisation of 17 viruses and viroids, herein called viruses, of Cydonia Mill., Malus Mill. and Pyrus L. determined as being either non‐EU or of undetermined standing in a previous EFSA opinion. These viruses belong to different genera and are heterogeneous in their biology. They can be detected by available methods and are efficiently transmitted by vegetative propagation techniques, with plants for planting representing a major long‐distance spread mechanism and, potentially, a major entry pathway. Depending on the viruses, additional pathway(s) can also be seed, pollen and/or vector transmission. Most of the viruses categorised here are known to infect only one of few related plant genera, but some of them have a wider host range, thus extending the possible entry pathways. Three viruses (apple necrotic mosaic virus, cherry rasp leaf virus, temperate fruit decay‐associated virus) and one viroid (apple fruit crinkle viroid) satisfy all the criteria to be considered as Union quarantine pests. Five viruses (apple green crinkle‐associated virus, blackberry chlorotic ringspot virus, eggplant mottled crinkle virus, tobacco ringspot virus and tomato ringspot virus) and one viroid (apple scar skin viroid), satisfy the criteria to be considered as Union quarantine pests with the possible exception of being absent from the EU territory or having a restricted presence and being under official control. The remaining six viruses (apple geminivirus, apple latent spherical virus, apple‐associated luteovirus, Pyrus pyrifolia cryptic virus, Pyrus pyrifolia partitivirus 2 and Tulare apple mosaic virus) and one viroid (apple hammerhead viroid) were not found to satisfy one or more of these criteria. The Panel highlights that for several viruses, especially those recently discovered, the categorisation is associated with high uncertainties mainly linked to the absence of data on biology and distribution. Since this opinion addresses specifically the non‐EU viruses, in general these viruses do not meet the criteria assessed by EFSA to qualify as a potential Union regulated non‐quarantine pests., This publication is linked to the following EFSA Journal articles: http://onlinelibrary.wiley.com/doi/10.2903/j.efsa.2019.5501/full, http://onlinelibrary.wiley.com/doi/10.2903/j.efsa.2019.5669/full, http://onlinelibrary.wiley.com/doi/10.2903/j.efsa.2019.5735/full, http://onlinelibrary.wiley.com/doi/10.2903/j.efsa.2019.5766/full

The dehydration process is a prerequisite to preserve saffron for a long time. According to this process, saffron shows differences in the main compounds responsible for its quality (colour, taste, aroma, and flavonol content). At present, the freeze-drying method obtains dried products with the highest quality. Viruses can modify the physiology and metabolism of plants, being able to affect the activities of several enzymes. For this reason, the main compounds of saffron have been analyzed under two different dehydrating processes, freeze-drying and dark-drying, considering their infection status with the Saffron latent virus (SaLV). Results showed that the picrocrocin and safranal content enables to differ dark-dried samples from freeze-dried ones. Besides, the kaempferol-3-O-sophoroside-7-O-glucoside content allows differentiating between SaLV-infected (SaLV+) and uninfected (SaLV-) saffron samples. Moreover, our data suggest that the freeze-drying would decrease crocins content, and dark-drying can nullify the adverse effect of SaLV on crocins content.

The Panel on Plant Health performed a listing of non-EU viruses and viroids (reported hereinafter as viruses) of Cydonia Mill., Fragaria L., Malus Mill., Prunus L., Pyrus L., Ribes L., Rubus L. and Vitis L. A systematic literature review identified 197 viruses infecting one or more of the host genera under consideration. Viruses were allocated into three categories (i) 86 non-EU viruses, known to occur only outside the EU or having only limited presence in the EU (i.e. reported in only one or few Member States (MSs), known to have restricted distribution, outbreaks), (ii) 97 viruses excluded at this stage from further categorisation efforts because they have significant presence in the EU (i.e. only reported so far from the EU or known to occur or be widespread in some MSs or frequently reported in the EU), (iii) 14 viruses with undetermined standing for which available information did not readily allow to allocate to one or the other of the two above groups. Comments provided by MSs during consultation phases were integrated in the opinion. The main knowledge gaps and uncertainties of this listing concern (i) the geographic distribution and prevalence of the viruses analysed, in particular when they were recently described; (ii) the taxonomy and biological status of a number of poorly characterised viruses; (iii) the host status of particular plant genera in relation to some viruses. The viruses considered as non-EU and those with undetermined standing will be categorised in the next steps to answer a specific mandate from the Commission to develop pest categorisations for non-EU viruses. This list does not imply a prejudice on future needs for a pest categorisation for other viruses which are excluded from the current categorisation efforts. (C) 2019 European Food Safety Authority. EFSA Journal published by John Wiley and Sons Ltd on behalf of European Food Safety Authority.

Cassava brown streak disease (CBSD) is a severe virus disease of cassava and prevalent in the eastern regions of Africa. The disease is characterized by distinct vein chlorosis and streak symptoms on leaves and stems and necrosis of storage roots. This necrosis can encompass large areas of the root, rendering it inedible so that the entire cassava harvest can be lost. African cassava varieties are susceptible to either of the two viruses causing the disease, cassava brown streak virus (CBSV) and Uganda cassava brown streak virus, and while there are less sensitive varieties, all cassava eventually succumb to the disease. The lack of CBSD resistance in African cassava varieties prompted this search for new sources of virus resistance in the diversity of South American cassava germplasm held in the collection at International Center for Tropical Agriculture, Columbia. Our search for CBSD resistance in South American cassava germplasm accessions revealed that most of the 238 South American cassava lines infected with CBSV established systemic virus infections with moderate to severe disease symptoms on leaves and stems. Fifteen cassava accessions did not become virus infected, remained free of symptoms, and CBSV was undetected by qRT-PCR. When tuberous roots of those lines were examined, necrotic tissue was found in eight lines and CBSV was detected. The remaining seven cassava accessions remained clear of symptoms on all tissues and organs and were virus free. A broad spectrum of virus resistance also including other virus isolates was confirmed for the breeding lines DSC167 and DSC118. While detailed infection experiments with other cassava lines selected for resistance are still ongoing, this indicates that the resistance identified may also hold against a broader diversity of CBSVs. Taken together, we present the results of a comprehensive study on CBSV resistance and susceptibility in cassava germplasm accessions from South America. The virus resistance in cassava germplasm identified provides compelling evidence for the invaluable contribution of germplasm collections to supply the genetic resources for the improvement of our crops.

Mungbean (Vigna radiata (L.) Wilczek) is an important pulse crop in India. A major constraint for improved productivity is the yield loss caused by mungbean yellow mosaic disease (MYMD). This disease is caused by several begomoviruses which are transmitted by the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae). The objective of this study was to identify the predominant begomoviruses infecting mungbean and the major cryptic species of B. tabaci associated with this crop in India. The indigenous B. tabaci cryptic species Asia II 1 was found dominant in Northern India, whereas Asia II 8 was found predominant in Southern India. Repeated samplings over consecutive years indicate a stable situation with, Mungbean yellow mosaic virus strains genetically most similar to a strain from urdbean (MYMV-Urdbean) predominant in North India, strains most similar to MYMV-Vigna predominant in South India, and Mungbean yellow mosaic India virus (MYMIV) strains predominant in Eastern India. In field studies, mungbean line NM 94 showed a high level of tolerance to the disease in the Eastern state of Odisha where MYMIV was predominant and in the Southern state of Andhra Pradesh where MYMV-Vigna was predominant, but only a moderate level of tolerance in the Southern state of Tamil Nadu. However, in Northern parts of India where there was high inoculum pressure of MYMV-Urdbean during the Kharif season, NM 94 developed severe yellow mosaic symptoms. The identification of high level of tolerance in mungbean lines such as ML 1628 and of resistance in black gram and rice bean provides hope for tackling the disease through resistance breeding.

The honey bee industry is of immense importance to global agriculture. In many countries beekeepers are migratory and move their hives between flowering events. Predicting such flowering events is particularly difficult in Australia due to the irregular flowering of eucalypts. We have developed a web-based application for Victorian beekeepers to visualise patterns of growth in floral resources using MODIS and other data, and thus make remote predictions about whether flowering will occur at their apiary sites. We demonstrate the use of this application through comparing ironbark (Eucalyptus tricarpa) growth patterns with flowering and honey production records. While the scientific community as a whole has embraced the use of satellite imagery as a tool for phenological studies, our prototype represents the first attempt to make this same information available to a more general audience. Commercial beekeeping in Australia is underpinned by the need to predict eucalypt flowering events from observations of budding and growth.Freely available satellite data, especially MODIS vegetation indices, can be used to remotely observe eucalypt growth.We have developed a web-based application, BeeBox, for beekeepers to make predictions of flowering across regions of interest.We use BeeBox to demonstrate agreement of growth, flowering and honey production data for Eucalyptus tricarpa.

The whitefly Bemisia tabaci (Gennadius) is one of the most threatening pests to crop production in tropical and subtropical regions. Severe damage results from its effective transmission of plant viruses; the most serious are members of the genus Begomovirus. B. tabaci is a complex of at least 34, species with Middle East-Asia Minor 1 (MEAM1) and Mediterranean being the most aggressive due to their broad host range and enhanced resistance to pesticides. Because invasion of these species into new areas is often linked with severe outbreaks of new virus diseases, a comprehensive knowledge of the abundant whitefly species is a prerequisite for efficient and sustainable crop management. Species distribution of this important pest and plant virus vector is barely known, and therefore a study was undertaken to elucidate distribution and prevalence of B. tabaci in major crops of Thailand and Vietnam. In Thailand the indigenous B. tabaci Asia1 was the dominant species throughout the regions and none of the invasive species was present. In contrast, a high abundance of MEAM1 was observed in Vietnam. From its distribution in the North of the country an invasion from Southern China and replacement of indigenous whitefly species could be delineated. Laboratory experiments showed that MEAM1 was able to replace the Asia II 1 species indigenous to this region within four generations. In virus transmission studies MEAM1 also showed higher rates of Tomato yellow leaf curl virus transmission compared to the Tomato leaf curl Hainan virus also indigenous to Vietnam.

Damage to agricultural crops by tospoviruses has occurred sporadically in Iran in the past; however, since 2000, outbreaks of tospoviruses have been recorded every year. The most affected ornamental crops were surveyed in two main cultivation areas in provinces of Markazi (Mahallat) and Tehran in 2000-01 and 2001-02. A few weed species also were collected. In all, 513 samples (with or without any conspicuous virus symptoms) were collected and analyzed by double- and triple-antibody sandwich enzyme-linked immunosorbent assay (ELISA) with polyclonal antibodies to Tomato spotted wilt virus (TSWV), Impatiens necrotic spot virus (INSV), and Tomato Varamin virus (ToVV), a new Tospovirus sp. from Iran. These viruses frequently were detected in samples of many different ornamentals and often in mixed infections, whereas Iris yellow spot virus (IYSV) was detected in only four samples. ToVV also was found in weeds growing in Chrysanthemum fields and in a Cuscuta sp. Applying double-antibody sandwich ELISA, no positive reactions were found with Tomato chlorotic spot virus (TCSV). Of the total of 513 samples tested, 345 samples did not react with any Tospovirus antisera. In Tehran, INSV was identified in 21 samples (10%), IYSV in 4 samples (2%), TSWV in 16 samples (8%), and ToVV in 22 samples (11%). In Markazi province, INSV was identified in 24 samples (8%), IYSV in 1 sample (0.5%), TSWV in 40 samples (13%), and ToVV in 36 samples (12%). ToVV was found to prevail in Tehran province and TSWV in Markazi. Thrips spp. present at the plant sampling sites also were collected and identified.

Carrot motley dwarf (CMD) affects carrot and other apiaceous plants by causing leaf yellowing or reddening as well as plant stunting and leads often to serious economic losses wherever these crops are grown (2). CMD has been reported from Australia, Europe, Japan, Israel, and North America and is known to result from a mixed infection by at least two viruses, the polerovirus, Carrot red leaf virus (CtRLV), and one of the umbraviruses, Carrot mottle virus (CMoV) or Carrot mottle mimic virus (CMoMV). The viruses are transmitted in a circulative persistent manner by aphid species (Cavariella spp.). In November of 2008, symptoms typical of CMD were observed in carrot (Daucus carota) and coriander (Coriandrum sativum) plantations in the region of Henrietta in the central part of Mauritius. Carrot cultivars affected were Victoria, Sigma, and Namdhari. Incidences of up to 50% were recorded in some fields. Symptoms were observed mainly on plants near the edges of fields and were initially attributed to physiological factors. However, following RNA extraction from affected carrot plants and reverse transcription (RT)-PCR, fragments of the expected sizes (CtRLV; 377 bp: CMoV; 549 bp) were obtained. For CtRLV, a pair of degenerate primers (S2/AS3 [1]) for poleroviruses, and for the above mentioned umbraviruses, a universal primer pair (UmbraCS: CTTTGGAGTACACAACAACTCC and UmbraCAS: GCA/GTCIAGICCIACACAA/GACTGG, I = Inosin; unpublished) was used. Direct sequencing of one PCR product for each virus (Eurofins MWG Operon GmbH, Martinsried, Germany) and comparison with sequences retrieved from GenBank resulted in nucleotide and amino acid sequence identities of 93 and 90% (coat protein) to the CtRLV strain UK-1 (Accession No. AY695933) and 86 and 96% (replicase) to the German CMoV isolate (Accession No. FJ188473), respectively. Carrot samples also tested CtRLV-positive in triple-antibody sandwich-ELISA using polyclonal IgGs to CtRLV for trapping and a mixture of two CtRLV-specific monoclonal antibodies (CtRLV-2-3A9 and CtRLV 3-4B9) as detecting antibodies (all from the stock of the Julius Kuehn Institute; H. J. Vetten, Braunschweig, Germany). The presence of CMoV was confirmed by sap transmission to Nicotiana benthamiana and N. occidentalis ‘P1’, which resulted in vein yellowing/etching symptoms. In addition, agarose gel electrophoresis of the dsRNA extract of a primary infected carrot sample revealed major dsRNAs of approximately 4.2 and 1.4 kbp, which represent the genomic and subgenomic RNAs of an umbravirus. Thus, sequence analysis, as well as serological and biological data, demonstrates that CMD-affected carrot plants from Mauritius were infected with CtRLV and CMoV isolates closely related to those from Europe. The sequences obtained in this study for CtRLV and CMoV have been deposited in GenBank under Accession Nos. FJ969849 and FJ969848, respectively. To our knowledge, this is the first report of CMD in Mauritius and the Indian Ocean Region. Future works comprise an island wide survey across carrot-growing regions to determine the incidence of the virus complex and the natural host range of the viruses in Mauritius. References: (1) A. D. Abraham et al. Plant Dis. 91:1059, 2007. (2) A. F. Murant. No 137 in: Descriptions of Plant Viruses. Assoc. Appl. Biol. Kew, England, 1974.

In summer 2009, a survey for virus diseases in cucurbits was conducted in open fields and plastichouses in Khartoum State, the most important growing area for cucurbits in Sudan. Chlorosis and yellowing symptoms on middle and lower leaves were observed on many muskmelon (Cucumis melo L.) plants grown in open fields in the Assilat agricultural scheme and on approximately 80% of the cucumber (Cucumis sativus L.) plants grown in plastichouses in Khartoum North. Large populations of whiteflies (Bemisia tabaci L.) were present in both locations. Leaf symptoms that were observed were similar to those caused by Cucurbit chlorotic yellows virus (CCYV), a recently described new Crinivirus species infecting cucurbits in Japan (4), indicating presence of this virus previously only reported from Japan, Taiwan (2), and China (1). Samples from seven symptomatic muskmelon leaves were collected from individual plants grown in different open fields in Assilat and from a symptomatic cucumber plant grown in a plastichouse. Total RNA was extracted from these samples with the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) to amplify putative CCYV sequences with primers (Crini-s2 5′-CATTCCTACCTGTTTAGCCA and Crini-as2 5′-TGCACTTATAATCTGCTGGTAC) designed from CCYV sequences available at GenBank. A 353-bp DNA fragment of the HSP70 gene was amplified by reverse transcription (RT)-PCR for all samples. Further analysis by direct sequencing of two PCR products showed 99 to 100% nt sequence identity to Asian CCYV isolates. Amplification of the coat protein sequence with the primer pair (CCYV-CPs 5′-ATGGAGAAGACTGACAATAAACAA and CCYV-CPas 5′-TTTACTACAACCTCCCGGTG) followed by cloning and sequencing yielded a 760-bp fragment having 99% nucleotide sequence identity to all Asian isolates. For confirmation, dsRNA preparations of symptomatic muskmelon tissue (collected in June 2010) were made, showing dsRNA patterns typical for criniviruses after separation on agarose gels. This dsRNA was used as template for random RT-PCR followed by sequencing of the cloned PCR products (3). Comparison with sequences available at GenBank revealed that cDNA sequences from dsRNA also were 99 to 100% identical to the CCYV genome sequence (AB523788.1). Whitefly transmission of the virus was confirmed by giving a population of B. tabaci an acquisition access period of 24 h and a further 24 h on muskmelon and cucumber seedlings. Symptoms were observed after 5 to 7 days, and the presence of CCYV was confirmed by RT-PCR. In conclusion, symptoms, RT-PCR, and dsRNA sequencing results confirm the presence and establishment of CCYV in cucurbit crops in Sudan. It is remarkable that the sequences obtained from the Sudanese samples show only negligible sequence differences from Asian isolates. Because of the large whitefly vector populations, the spread of CCYV to neighboring countries in Africa and potentially southern Europe, or wherever cucurbits are grown, can be expected. To our knowledge, this is the first report of CCYV in Sudan and outside Eastern Asia. The sequences obtained in this study have been submitted to GenBank under Accession Nos. JF807053 to JF807055. References: (1) Q. S. Gu et al. Plant Dis. 95:73, 2011. (2) L. H. Huang et al. Plant Dis. 94:1168, 2010. (3) W. Menzel et al. Arch. Virol. 154:1343, 2009. (4) M. Okuda et al. Phytopathology 100:560, 2010.

This article describes the incidence and etiology of a viral disease of passion fruit in Uganda. Symptoms, including those characteristic of passion fruit woodiness disease (PWD), were observed on 32% of plants in producing areas. Electron microscopic observations of infected tissues revealed flexuous filaments of ca. 780 nm. Enzymelinked immunosorbent assays indicated a serological relationship with Cowpea aphid-borne mosaic virus (CABMV) and Passion fruit ringspot virus (PFRSV). In host range studies, only species in the families Solanaceae and Chenopodiaceae were susceptible, and neither Vigna unguiculata nor Phaseolus vulgaris became infected. Coat protein (CP) gene sequences of eight isolates exhibited features typical of potyviruses and were highly similar (88 to 100% identity). However, the sequences had limited sequence identity with CP genes of two of the three potyviruses reported to cause PWD: East Asian Passiflora virus and Passion fruit woodiness virus (PWV). Deduced amino acid sequences for the CP of isolates from Uganda had highest identity with Bean common mosaic necrosis virus (BCMNV) (72 to 79%, with evolutionary divergence values between 0.17 and 0.19) and CABMV (73 to 76%, with divergence values between 0.21 and 0.25). Based on these results and in accordance with International Committee for Taxonomy of Viruses criteria for species demarcation in the family Potyviridae, we conclude that a previously unreported virus causes viral diseases on passion fruit in Uganda. The name “Ugandan Passiflora virus” is proposed for this virus.

Saffron is appreciated by its colour, taste, and aroma. To examine the effect of abiotic and biotic stress on these main properties, in the span of 2014-2016, saffron stigmas were collected from major different saffron cultivation areas of Iran and saffron quality was estimated. The quality of saffron was assessed by ultraviolet-visible spectroscopy following the ISO3632:2011 standard. However, the composition and concentration of crocetin esters, picrocrocin, safranal, and kaempferols, the most critical compounds determining the properties and quality of saffron can vary with the geographical origin and virus effects, being more accurate High-Performance Liquid Chromatography and Diode Array Detection (HPLC-DAD) methods were used to analyze saffron quality. Using HPLC-DAD we analyzed saffron plants grown at various conditions (considering altitude, temperature, and precipitation/rainfall) and in presence/absence of virus infections; we found that edaphoclimatic and cultivation conditions significantly determine the quality of the spice and the presence of virus modifies the content of its metabolites.

International audience; Using next-generation sequencing to characterize agents associated with a severe stunting disease of parsley from Germany, we identified a hitherto undescribed virus. We sequenced total RNA and rolling-circle-amplified DNA from diseased plants. The genome sequence of the virus shows that it is a member of the genus Nanovirus, but it lacks DNA-U4. In addition to the seven genomic DNAs of the virus, we identified a second DNA-R and seven distinct alphasatellites associated with the disease. We propose the name "parsley severe stunt associated virus" (PSSaV) for this novel nanovirus.

International audience; Subterranean clover stunt virus (SCSV) is a type species of the genus Nanovirus in the family Nanoviridae. It was the first single-stranded DNA plant virus with a multipartite genome, of which genomic DNA sequences had been determined. All nanoviruses have eight genome components except SCSV, for which homologs of two genome components present in all other nanovirus genomes, DNA-U2 and DNA-U4, were lacking. We analysed archived and more recent samples from SCSV-infected legume plants to verify its genome composition and found the missing genome components. These results indicated that SCSV also has eight genome components and is a typical member of the genus Nanovirus.

Background Cassava brown streak disease (CBSD) has a viral aetiology and is caused by viruses belonging to the genus Ipomovirus (family Potyviridae), Cassava brown streak virus (CBSV) and Ugandan cassava brown streak virus (UCBSV). Molecular and serological methods are available for detection, discrimination and quantification of cassava brown streak viruses (CBSVs) in infected plants. However, precise determination of the viral RNA localization in infected host tissues is still not possible pending appropriate methods. Results We have developed an in situ hybridization (ISH) assay based on RNAscope® technology that allows the sensitive detection and localization of CBSV RNA in plant tissues. The method was initially developed in the experimental host Nicotiana rustica and was then further adapted to cassava. Highly sensitive and specific detection of CBSV RNA was achieved without background and hybridization signals in sections prepared from non-infected tissues. The tissue tropism of CBSV RNAs appeared different between N. rustica and cassava. Conclusions This study provides a robust method for CBSV detection in the experimental host and in cassava. The protocol will be used to study CBSV tropism in various cassava genotypes, as well as CBSVs/cassava interactions in single and mixed infections.

Following a request from the European Commission, the EFSA Panel on Plant Health performed a pest categorisation of Chrysomyxa arctostaphyli, a well-defined and distinguishable fungal species of the family Coleosporiaceae. The pathogen is regulated in Council Directive 2000/29/EC (Annex IAI) as a harmful organism whose introduction into the EU is banned. C. arctostaphyli is native to North America and is the causal agent of spruce broom rust. C. arctostaphyli is a heteroecious rust with a 2-year life cycle alternating between the aecial host Picea spp. and the telial host Arctostaphylos spp. The main reported aecial host is P. engelmannii, but also P. abies, P. pungens, P. sitchensis, P. glauca, P. mariana and P. rubens (as well as Picea as a genus) are reported as hosts. The fungus is not known to occur in the EU but could enter via host plants for planting and cut branches. It could establish in the EU, as hosts are present and climatic conditions are favourable. The extent of overlap between the ranges of the telial and aecial hosts is greater in the EU than in North America. The pathogen would be able to spread following establishment by dissemination of spores and human movement of infected host plants. Should the pathogen be introduced in the EU, impacts can be expected in spruce woodland, plantations and on ornamental spruce trees, leading to reduced tree growth and associated ecosystem service provision. The main uncertainty concerns the level of susceptibility of P. abies and P. sitchensis under European conditions. The criteria assessed by the Panel for consideration as a potential quarantine pest are met. As the pest is not present in the EU, not all criteria for consideration as a regulated non-quarantine pest are met

Following a request from the European Commission, the EFSA Plant Health Panel performed a pest categorisation of Lopholeucaspis japonica (Hemiptera: Diaspididae), an armoured scale which preferentially feeds on smooth barked woody trees and shrubs. The pest occurs in Asia, North America and non-EU Europe (Caucasus region and Ukraine). The pest is regulated in Council Directive 2000/29/EC as Leucaspis japonica, a junior synonym. Its introduction into the EU is banned on plants of Citrus, Fortunella, Poncirus and their hybrids, other than fruit and seeds. Additional host plants comprise 60 species in 35 botanical families, including deciduous fruit trees, ornamental and forest plants. L. japonica could enter the EU via host plants for planting (excluding seeds) and cut branches. It has been intercepted on plants for planting from China, including artificially dwarfed plants. Spread is most likely via plants for planting, rather than via natural spread as most diaspidid life stages are sessile. Impacts could occur in citrus, other fruit crops, ornamentals and forest trees. Sourcing plants from pest-free areas, pest-free places of production or pest-free production sites would decrease the likelihood of introduction. Because suitable hosts occur across the EU in climatic areas matching those where the pest is known to occur, biotic and abiotic conditions are conducive to establishment. The main uncertainty concerns its current distribution in the EU. L. japonica was found in Greece in 1983, but there have been no other reports since then. L japonica satisfies the criteria assessed by EFSA that enable it to be considered a potential quarantine pest. L. japonica does not satisfy the criteria assessed by EFSA for it to be considered a potential regulated non-quarantine pest (RNQP).

Following a request from the European Commission, the EFSA Plant Health Panel performed a pest categorisation of Pantoea stewartii subsp. stewartii (hereafter P. s. subsp. stewartii). P. s. subsp. stewartii is a Gram-negative bacterium that causes Stewart’s vascular wilt and leaf blight of sweet corn and maize, a disease responsible for serious crop losses throughout the world. The bacterium is endemic to the USA and is now present in Africa, North, Central and South America, Asia and Ukraine. In the EU, it is reported from Italy with a restricted distribution and under eradication. The bacterium is regulated according to Council Directive 2000/29/EC (Annex IIAI) as a harmful organism whose introduction and spread in the EU is banned on seeds of Zea mays. Other reported potential host plants include various species of the family Poaceae, including weeds, rice (Oryza sativa), oat (Avena sativa) and common wheat (Triticum aestivum), as well as jackfruit (Artocarpus heterophyllus), the ornamental Dracaena sanderiana and the palm Bactris gasipaes, but there is uncertainty about whether these are hosts of P. s. subsp. stewartii or of the other subspecies. The pest could enter the EU via host plants for planting (including seed) and via insect vectors from neighbouring countries. Host plants are widely distributed and climatic conditions are conducive in the EU. P. s. subsp. stewartii could spread by movement of host plants for planting (including seeds) and insect vectors. Impacts could occur on maize and rice. Methods to certify pest freedom of maize seeds are available. The main knowledge gaps concern the availability of vectors in the EU, the level of susceptibility of the maize cultivars grown in the EU, the virulence of strains in recent outbreaks, and the host range of the bacterium. The criteria assessed by the Panel for consideration as a potential quarantine pest are met.

Following a request from the European Commission, the EFSA Plant Health Panel updated its pest categorisation of Xylella fastidiosa, previously delivered as part of the pest risk assessment published in 2015. X. fastidiosa is a Gram‐negative bacterium, responsible for various plant diseases, including Pierce's disease, phony peach disease, citrus variegated chlorosis, olive quick decline syndrome, almond leaf scorch and various other leaf scorch diseases. The pathogen is endemic in the Americas and is present in Iran. In the EU, it is reported in southern Apulia in Italy, on the island of Corsica and in the Provence‐Alpes‐Côte d'Azur region in France, as well as in the Autonomous region of Madrid, the province of Alicante and the Balearic Islands in Spain. The reported status is ‘transient, under eradication’, except for the Balearic Islands, Corsica and southern of Apulia, where the status is ‘present with a restricted distribution, under containment’. The pathogen is regulated under Council Directive 2000/29/EC and through emergency measures under http://eur-lex.europa.eu/legal-content/EN/TXT/?uri=CELEX:32015D0789 (as amended http://eur-lex.europa.eu/legal-content/EN/TXT/?uri=CELEX:32017D2352). The pest could enter the EU via host plants for planting and via infectious insect vectors. The host range includes hundreds of host species listed in the EFSA host plant database. In the EU, host plants are widely distributed and climatic conditions are favourable for its establishment. X. fastidiosa can spread by movement of host plants for planting and infectious insect vectors. X. fastidiosa is known to cause severe direct damage to major crops including almonds, citrus, grapevines, olives, stone fruits and also forest trees, landscape and ornamental trees, with high impacts. The criteria assessed by the Panel for consideration as a potential Union quarantine pest are met (the pathogen is present in the EU, but it has a restricted distribution and is under official control). X. fastidiosa is not considered as a regulated non‐quarantine pest (RNQP) as the pathogen may spread also via insect vector transmission.

The Panel on Plant Health performed a pest categorisation of the non-EU Pissodes spp. (Coleoptera: Curculionidae). They constitute a well-defined taxon, with non-EU species distributed in the USA, Canada, Mexico, Guatemala, El Salvador, China, Japan, Korea, Russia and South Africa, some of which are recognised as severe pests of conifers, mainly Pinus spp. and Picea spp., or vector pathogens. The immature stages either live in the phloem and cambium of healthy, weakened or dead trees, or in the terminal shoots of living trees. They are listed as quarantine pests in Annex IAI of Directive 2000/29/EC. Plants for planting, branches of conifers and non-squared wood are considered as pathways. The pest can also disperse by hitchhiking, and fly over kilometres. The adults are long-lived (up to 4 years). They feed by puncturing the bark of stems or shoots. Females lay eggs in chewed-out cavities in the bark. The life cycle varies with species and local climatic conditions. At the end of the larval stage, the larva excavates a pupal cell between the sapwood and the bark, in the sapwood or in terminal shoots. Pissodes spp. overwinter as adults in the litter or as larvae or teneral adults in the galleries or pupal cells. The current geographic range of the non-European Pissodes spp. suggests that many of them may establish in the EU territory, where their hosts are widely present. We list some species which, if introduced to the EU, would most probably have an economic impact on plantations or may interfere with forest ecosystem processes although they are mainly abundant and damaging in intensively managed monocultures. All criteria for considering those non-EU Pissodes spp. as potential quarantine pests are met. The criteria for considering them as non-regulated quarantine pests are not met because they are absent from the EU territory.

Following a request from the European Commission, the EFSA Panel on Plant Health performed a pest categorisation of Coniferiporia sulphurascens and Coniferiporia weirii, two well-defined and distinguishable fungal species of the family Hymenochaetaceae. The pathogens are regulated in Council Directive 2000/29/EC (Annex IAI, under the previous name Inonotus weirii for both species) as a harmful organism whose introduction into the EU is banned. The two pathogens are native to North America, where C. sulphurascens causes laminated root rot primarily in Douglas fir (Pseudotsuga menziesii) and grand fir (Abies grandis), while C. weirii causes cedar laminated root and butt rot mainly in cedars (Thuja plicata and Cupressus nootkatensis). C. weirii has been reported from Japan and China, and C. sulphurascens from China, Russia and Turkey. Neither species has been reported from the EU. C. sulphurascens may infect all conifers, while C. weirii is reported to mainly cause disease in tree species of Thuja spp. and Cupressus spp. The two pathogens could enter the EU mainly via wood with bark, isolated bark and plants for planting (including artificially dwarfed plants) of Pinaceae and Cupressaceae. Both fungi could establish in the EU, as hosts are present and climatic conditions are favourable. The two pathogens would be able to spread following establishment by the pathways mentioned for entry and also by dissemination of basidiospores and root contact with infected root/wood. Should the pathogen be introduced in the EU, impacts can be expected on coniferous woodlands, plantations and ornamental trees, thus leading to reduced tree growth and ecosystem service provision. The key uncertainties concern (i) the distribution of the two pathogens in Asia, (ii) the level of susceptibility of conifers native to Europe and (iii) the role of plants for planting as a pathway of entry and spread. For both pathogens, the criteria assessed by the Panel for consideration as a potential quarantine pest are met. As the two pests are not present in the EU, not all the criteria for consideration as regulated non-quarantine pests are met.

The Panel on Plant Health performed a pest categorisation of the Siberian moth, Dendrolimus sibiricus Tschetverikov (Lepidoptera: Lasiocampidae). D. sibiricus is a well-defined and distinguishable species, native to Asian Russia and northern regions of Kazakhstan, Mongolia, China and North Korea, and recognised as a severe pest of Pinaceae conifers, mainly larch (Larix spp.), fir (Abies spp.), spruce (Picea spp.), five-needle pines (Pinus spp.). It has also a potential to develop on non-native Pinaceae: Cedrus, Pseudotsuga, Tsuga. It defoliates healthy trees and kills thousands of hectares of forests. It is absent from the EU and is listed as a quarantine pest in Annex IAI of Directive 2000/29/EC. Plants for planting, branches of conifers and non-squared wood from its distribution range are considered as pathways for the pest, which can also disperse by flight over tens of kilometres. The females produce sex pheromones. Adults do not feed and can survive for about 2 weeks. One female lays up to 400 eggs, attaching them to needles. One generation usually develops in 2–3 years, with larvae passing winter diapause and some undergoing facultative summer diapause. Exceptionally, 1-year generations may occur if the number of degree-days above 10°C is higher than 2,200. Larvae feed on needles through 5–6 instars and pupate in a cocoon on tree branches. Mature larvae have urticating setae on thoracic segments that protect them from enemies and may cause allergic reactions in humans and animals. The contradictory studies regarding the climatic requirements of D. sibiricus make the issue of its establishment in most of the EU territory uncertain, although its host trees are widely present. All criteria for considering D. sibiricus as a potential quarantine pest are met. The species is presently absent from the EU, and thus, the criteria for consideration as a potential regulated non-quarantine pest are not met.

The EFSA Panel on Plant Health performed a pest categorisation of ‘ Blight and blight-like ’ for the EU territory. Blight is a major disease of citrus. Similar ‘ blight-like ’ diseases are also known (e.g. declinio, declinamiento) and are addressed simultaneously with Blight in the present categorisation. The causal agent(s) remain(s) unknown and the potential role of a recently identi fi ed citrus endogenous pararetrovirus (Citrus Blight-associated pararetrovirus, CBaPRV) remains to be established. Transmissibility and ability to produce consistent (although poorly speci fi c) symptoms have been demonstrated and a combination of indirect approaches is used, with limits, for diagnosis. There are large uncertainties on the biology of the causal agent(s) and on the epidemiology of the disease, including the transmission mechanism(s) responsible for the observed fi eld spread. Blight has been reported from North, Central and South America, Africa and Oceania but is not known to occur in the EU. It is listed in Annex IIA of Directive 2000/29EC. It has the potential to enter, establish and spread in the EU territory. The main entry pathway (citrus plants for planting) is closed by existing legislation and entry is only possible on minor pathways (such as illegal import). Blight is a severe disease and a negative impact is expected should it be introduced in the EU, but the magnitude of this negative impact is very dif fi cult to estimate. ‘ Blight and blight like ’ satis fi es all criteria evaluated by EFSA to qualify as a Union quarantine pest. It does not meet the criterion of being present in the EU to qualify as a Union regulated non-quarantine pest (RNQP). Since the identity of the causal agent(s) of the Blight and blight-like disease(s) and the existence and ef fi ciency of natural spread mechanism(s) remain unknown, large uncertainties affect all aspects of the present pest categorisation.

Luffa aphid-borne yellows virus (LABYV) was proposed as the name for a previously undescribed polerovirus based on partial genome sequences obtained from samples of cucurbit plants collected in Thailand between 2008 and 2013. In this study, we determined the first full-length genome sequence of LABYV. Based on phylogenetic analysis and genome properties, it is clear that this virus represents a distinct species in the genus Polerovirus. Analysis of sequences from sample TH24, which was collected in 2010 from a luffa plant in Thailand, reveals the presence of two different full-length genome consensus sequences.

The complete genome sequence of an isolate of euphorbia ringspot virus (EuRSV) was determined by deep sequencing and rapid amplification of cDNA ends (RACE) RT-PCR. It has an RNA genome of 10,154 nucleotides in size, excluding the poly(A) tail, and encodes a polyprotein of 3265 amino acids. Phylogenetic analysis from this study supports the earlier taxonomic assignment to the genus Potyvirus; however, a gene encoding the HAM1h protein, inserted between NIb and CP of the EuRSV genome, which was previously only observed for cassava brown streak virus and Ugandan cassava brown streak virus of the genus Ipomovirus, is an unusual feature of this potyvirus, which otherwise has typical potyvirus genome features.

The Panel on Plant Health performed a pest categorisation of the gall midge Aschistonyx eppoi Inouye (1964) (Diptera, Cecidomyiidae), for the EU. A. eppoi is a well-de fi ned and distinguishable species, native to Japan and Korea, and recognised as a pest of Juniperus chinensis , although our knowledge is solely based on one unique publication. A. eppoi is absent from the EU, and is listed in Annex IIAI of Directive 2000/29/EC. Its host plants, Juniperus spp. are also listed in Annex III of Directive 2000/29/EC. Plants for planting and branches are considered as pathways for this pest. A. eppoi has been intercepted twice (1974; 1975) in the EU and has been eradicated. The pest is likely to affect bonsai plants of J. chinensis if it were to establish in the EU territory. However, as it is unknown whether A. eppoi would attack the Juniperus spp. that occur in the EU, its potential impact on the wild vegetation is also unknown. As the pest originates from areas with warm climates, impact outdoors would affect the southern parts of the EU. Cultural control (destruction of infested material) and chemical control are the major control methods. All criteria assessed by EFSA for consideration as a potential quarantine pest are met, although there are high uncertainties regarding impact. The species is presently absent from the EU, and thus the criteria for consideration as a potential regulated non-quarantine pest are not met.

The Panel on Plant Health performed a pest categorisation of the South African citrus thrips, Scirtothrips aurantii Faure (Thysanoptera: Thripidae), for the European Union (EU). This is a well-de fi ned and distinguishable species, recognised as a pest of citrus and mangoes in South Africa, which has been cited on more than 70 different plants, including woody and herbaceous species. It feeds exclusively on young actively growing foliage and fruit. S. aurantii is not known to occur in the EU and is listed in Annex IIAI of 2000/29/EC as a harmful organism presenting a risk to EU plant health. The international trade of hosts as either plants for planting or cut fl owers provide potential pathways into the EU. However, current EU legislation prohibits the import of citrus plants. Furthermore, measures aimed at the import of plants for planting in a dormant stage (no young foliage or fruits present) with no soil/growing medium attached, decreases the likelihood of the pest entry with such plants. Interceptions have occurred on Eustoma grandi fl orum cut fl owers. Considering climatic similarities between some of the countries where S. aurantii occurs (South Africa, Australia) and the EU, its thermal biology and host distribution in the EU, S. aurantii has the potential to establish, especially in citrus-growing regions of the EU. S. aurantii would most probably breed all year long around the Mediterranean and could cause crop losses in citrus, especially oranges. Phytosanitary measures are available to inhibit the introduction of S. aurantii . Considering the criteria within the remit of EFSA to assess its status as a potential Union quarantine pest (QP) or as a potential regulated non-quarantine pest (RNQP), S. aurantii meets with no uncertainties the criteria assessed by EFSA for consideration as a potential Union QP

The Panel on Plant Health performed a pest categorisation of Tecia solanivora (Lepidoptera: Gelechiidae) the Guatemalan potato tuber moth, for the EU. T. solanivora is a well-de fi ned species which feeds exclusively on Solanum tuberosum . It was fi rst described from Costa Rica in 1973 and has spread through Central America and into northern South America via trade of seed potatoes. It has also spread to Mexico and the Canary Islands and most recently to mainland Spain where it is under of fi cial control in Galicia and Asturias. Potatoes in the fi eld and storage can be attacked. Some authors regard T. solanivora as the most important insect pest of potatoes globally. T. solanivora is currently regulated by Council Directive 2000/29/EC, listed in Annex II/AI as Scrobipalpopsis solanivora . Larvae feed and develop within potato tubers; infested tubers therefore provide a pathway for pest introduction and spread, as does the soil accompanying potato tubers if it is infested with eggs or pupae. As evidenced by the ongoing outbreaks in Spain, the EU has suitable conditions for the development and potential establishment of T. solanivora . The pest could spread within the EU via movement of infested tubers; adults can fl y and disperse locally. Larval feeding destroys tubers in the fi eld and in storage. In the warmer southern EU, where the development would be fastest, yield losses would be expected in potatoes. Measures are available to inhibit entry via traded commodities (e.g. prohibition on the introduction of S. tuberosum ). T. solanivora satis fi es all of the criteria assessed by EFSA to satisfy the de fi nition of a Union quarantine pest. It does not satisfy EU regulated non- quarantine pest (RNQP) status because it is under of fi cial control. There are uncertainties over the effectiveness of preventing illegal imports via passenger baggage and the magnitude of potential impacts in the cool EU climate.

The Panel on Plant Health performed a pest categorisation of Grapholita packardi Zeller, (Lepidoptera: Tortricidae), for the EU. G. packardi is a well-defined and distinguishable species. It is widely distributed in the USA and has a restricted distribution in Canada and Mexico. It is recognised as a pest of blueberry and cherry, and has occasionally been reported in apple, pear and plum. It is cited on quince and wild rosaceous plants such as Crataegus. Larvae feed on blueberry and cherry fruits internally and overwinter in pruned twigs. External evidence of infestation of cherries by young larvae is occasionally not detectable. In apple, fruit damage is less common; rather, the pest bores into terminal shoots of nursery stock and young orchard trees. Feeding damage spoils fruit quality and marketability and reduces crop yield. G. packardi is not known to occur in the EU and is listed in Annex IIAI of Council Directive 2000/29/EC under the synonym Enarmonia packardi. Host plants for planting and infested fruit could potentially provide a pathway into the EU. Considering the climatic similarities between North America and Europe, and that wild and commercial hosts occur widely within the EU, G. packardi has the potential to establish within the EU. There would be one to three generations per year, as in North America. Based on literature, blueberries and cherries are likely to be impacted more than apples and pears. Phytosanitary measures are available to reduce the likelihood of introduction of G. packardi. All criteria assessed by EFSA for consideration as a potential Union quarantine pest are met. As G. packardi is not known to occur in the EU, this criterion assessed by EFSA to consider it as a Union regulated non-quarantine pest is not met.