Search

Immunological memory is a mechanism to protect us against reinfection. Antibodies produced by B cells are integral to this defense strategy and underlie virtually all vaccine success. Here, we explain how B cells memory is generated by infection and vaccination, what influences its efficacy and its persistence, and how characterizing these parameters in the immune response to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) will help achieve protective immunity through vaccination.

An important area of crop development is the introduction of new vegetable plants, one of which is the sweet potato Ipomoea batatas (L.) Lam. The aim of our research was genetic, biological and economic assessment of sweet potato accessions held in the collection of the Plant Introduction and Acclimatization Dept., Udmurt Federal Research Center, Ural Branch of the RAS (UdmFRC UB RAS).Within this experiment, DNA polymorphism of 16 accessions of I. batatas was tested using ISSR markers. All accessions were found to represent different genotypes; the VM 17 accession obtained as a result of a bud mutation differed significantly from the original accession in its genotype.Evaluation of 16 accessions of sweet potato cultivars was carried out in a small-plot field experiment. The results of biological and economic assessment witnessed to the prospects of sweet potato cultivation within the territory of the Udmurt Republic for marketable tuber production. The productivity of the accessions was 140–2700 g of tubers per plant. According to their productivity, the accessions were divided into clusters: the low-productivity group (up to 500 g), with ‘Betty’, Fioletovy, ‘Beauregard’, ‘Covington’ and Bezhevy; medium-productivity group (500–1000 g), with ‘Jewel’, Fioletovy Sochi, Brazilsky, Afgansky, Vinnitsky rozovy, Lyubitelsky and ‘Bayou Bell’; and high-productivity group (more than 1000 g), with Pobeda 100, ВM 17, Druzhkovsky and Bely NBS. On the basis of the evaluation, 11 sweet potato accessions were recommended for cultivation in the Middle Urals: Afgansky, ‘Bayou Bell’, Bely NBS, ВM 17, Brazilsky, Druzhkovsky, Fioletovy Sochi, ‘Jewel’, Lyubitelsky, Pobeda 100, and Vinnitsky rozovy.

Recent work by Kentaro Ohkuni and colleagues exemplifies how a series of molecular mechanisms contribute to a cellular outcome—equal distribution of chromosomes. Failure to maintain structural and numerical integrity of chromosomes is one contributing factor in genetic diseases such as cancer. Specifically, the authors investigated molecular events surrounding centromeric histone H3 variant Cse4 deposition—a process important for chromosome segregation, using Saccharomyces cerevisiae as a model organism. This study illustrates an example of a post-translational modification—sumoylation—regulating a cellular process and the concept of genetic interactions (e.g., synthetic dosage lethality). Furthermore, the study highlights the importance of using diverse experimental approaches in answering a few key research questions. The authors used molecular biology techniques (e.g., qPCR), biochemical experiments (e.g., Ni-NTA/8His protein purification), as well as genetic approaches to understand the regulation of Cse4. At a big-picture level, the study reveals how genetic changes can lead to subsequent molecular and cellular changes.

The way genes contribute to behavior is complicated. Although there are some single genes with large contributions, most behavioral differences are due to small effects from many interacting genes. This makes it hard to identify the genes that cause behavioral differences. Mutagenesis screens in model organisms, selective breeding experiments in animals, comparisons between related populations with different behaviors, and genome-wide association studies in humans are promising and complementary approaches to understanding the heritable aspects of complex behaviors. To connect genes to behaviors requires measuring behavioral differences, locating correlated genetic changes, determining when, where, and how these candidate genes act, and designing causative confirmatory experiments. This area of research has implications from basic discovery science to human mental health.

Human noroviruses (HuNoVs) are major foodborne pathogens that cause nonbacterial acute gastroenteritis worldwide. As the tissue-culture system for HuNoVs is not mature enough for routine detection of the virus, detection is mainly dependent on molecular approaches such as reverse transcription polymerase chain reaction (RT-PCR) and reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR). The widely used primers and probes for RT-qPCR were established in the early 2000s. As HuNoVs are highly variant viruses, viral genome mutations result in previously designed primers and/or probes that were perfectly matched working less efficiently over time. In this study, a new duplex RT-qPCR (ND-RT-qPCR) was designed for the detection of genogroup I (GI) and genogroup II (GII) HuNoVs based on an analysis of viral sequences added in the database after 2010. Using long transcribed viral RNAs, the results demonstrate that the sensitivity of ND-RT-qPCR is as low as one genomic copy for both GI and GII HuNoVs. The performance of ND-RT-qPCR was further evaluated by a comparison with the commonly used Kageyama primer/probe sets for RT-qPCR (Kageyama RT-qPCR) for 23 HuNoV-positive clinical samples. All five GI samples were registered as positive by ND-RT-qPCR, whereas only two samples were registered as positive by Kageyama RT-qPCR. All 18 GII samples were registered as positive by ND-RT-qPCR, while 17 samples were registered as positive by Kageyama RT-qPCR. The sensitivity reflected by the quantification cycle (Cq) value was lower in ND-RT-qPCR than in Kageyama RT-qPCR. Our data suggest that ND-RT-qPCR could be a good fit for the detection of current strains of HuNoVs.

Background & objective Carbapenem-resistant Enterobacteriaceae is a growing concern worldwide including Iran. The emergence of this pathogen is worrying as carbapenem is one of the 'last-line' antibiotics for treatment of infections caused by multi drug resistant gram- negative bacteria. The main objective of this study was to determine the prevalence of carbapenem-resistant Enterobacteriaceae in a referral hospital in Tehran, Iran. Methods In this study, all positive isolates of Enterobacteriaceae recorded in blood, urine, and other body fluids were studied during April 2017 to April 2018 in a referral hospital in Tehran. All cases of resistance to carbapenems were first tested by modified Hodge test. All cases with positive or negative test, after gene extraction, were examined genotypically based on the primers designed for the three Klebsiella pneumoniae carbapenemase (KPC), New Delhi metallo-β-lactamase (NDM), and OXA-48 genes by conventional PCR method. Results 108 isolates (13.6%) were resistant to all cephalosporins as well as to imipenem and meropenem. In a genotypic study, including 45 isolates, 13 isolates were positive for OXA-48 gene, 11 isolates for OXA-48 and NDM genes, 11 isolates for OXA-48, NDM and KPC genes, 4 isolates for OXA-48 genes and KPC, 3 isolates for NDM, one isolate for KPC. On the other hand, two isolates were negative for all three genes examined. Conclusion OXA-48 gene was one of the most common genes resistant to carbapenems in Iran. According to studies, the prevalence of antibiotic resistance in Iran is rising dramatically, which reduces the choice of antibiotics to treat severe infections in the future.

Coxiella burnetii is an obligate intracellular pathogen and the causative agent of Q fever. In Ukraine, 28 human cases of Q fever were reported between 1997 and 2006; however, there are no state-approved, standardized molecular diagnostic assays that can be used systematically to investigate C. burnetii transmission to humans and its distribution throughout Ukraine. To address this deficiency, we followed the recommendation of the World Organization for Animal Health (OIE) and developed a confirmatory PCR for C. burnetii for veterinary diagnosis in Ukraine. The PCR assay targeted the outer membrane-associated gene com1 in C. burnetii. Oligonucleotide primers were selected that amplify a 689-bp DNA fragment of the com1 gene (primers: CoxF2 = 5′-ACYGCAGGCGTGGCGATAG-3′ and CoxR4 = 5′-TGAAGGTTTTGTTGTGAGGTGGC-3′). The assay proved highly sensitive and specific to C. burnetii DNA detection (LOD = 0.37 pg/μL). Reproducibility of the test was verified by comparing the PCR results with those of a different PCR protocol and qPCR. Using the CoxF2/CoxR4 primer set and reaction conditions described here, the PCR Diagnostic Kit C. burnetii-PCR-TEST was developed and officially registered for use in Ukraine by the State Scientific Control Institute of Biotechnology and Strains (Kyiv, Ukraine) for diagnostic purposes.

Flowers offer a wide variety of substrates suitable for fungal growth. However, the mycological study of flowers has only recently begun to be systematically addressed from an ecological point of view. Most research on the topic carried out during the last decade has focused on studying the prevalence and diversity of flower-inhabiting yeasts, describing new species retrieved from floral parts and animal pollinators, and the use of select nectar yeasts as model systems to test ecological hypotheses. In this primer article, we summarize the current state of the art in floral nectar mycology and provide an overview of some research areas that, in our view, still require further attention, such as the influence of fungal volatile organic compounds on the foraging behavior of pollinators and other floral visitors, the analysis of the direct and indirect effects of nectar-inhabiting fungi on the fitness of plants and animals, and the nature and consequences of fungal-bacterial interactions taking place within flowers. ispartof: Fungal Biology and Biotechnology vol:7 pages:1- ispartof: location:England status: published

Diagnose technique for detection Tryapanosoma evansi have been developed for many years, including Polymerase Chain Reaction (PCR). One of fundamental factors on this technique is primer desain which possess high sensitivity and specificity. The aim of the current study was to examine four primer sets for detection of T. evansi on mice. They were ITS 1, ESAG 6/7, RoTat 1.2 VSG, TBR1/2 and TR3/TR4. Balitvet Culture Collection (BCC) – Bangkalan isolate of T. evansi was was injected into two male mice DDY strain. Three days after infection, blood mice was collected and stored at -20oC. In addition, some blood was dropped on the filter paper and kept at 4oC. Another mice was killed and some tissues (brain, liver, lung, heart, spleen and kidney) were removed from mice and preserved into 80% Ethanol and then they were stored -20oC. All samples were amplified using five primer sets and repeated twice. The results demonstrated that all primers (ITS 1, ESAG 6/7, RoTat 1.2 VSG, TBR1/2 and TR3/TR4) were able to detect T. evansi on all samples (the blood, the filter paper and all tissues). In order to detect T. evansi in the field, primer ITS-1 is recommended because it is able to discriminate some spesies T. evansi in livestock and generate a good intensity of DNA band from tested samples.

Chitins and chitosans are among the most widespread and versatile functional biopolymers, with interesting biological activities and superior material properties. While chitins are evolutionary ancient and present in many eukaryotes except for higher plants and mammals, the natural distribution of chitosans, i.e. extensively deacetylated derivatives of chitin, is more limited. Unequivocal evidence for its presence is only available for fungi where chitosans are produced from chitin by the action of chitin deacetylases. However, neither the structural details such as fraction and pattern of acetylation nor the physiological roles of natural chitosans are known at present. We hypothesise that the chitin deacetylases are generating chitins and chitosans with specific acetylation patterns and that these provide information for the interaction with specific chitin‑ and chitosan‑binding proteins. These may be structural proteins involved in the assembly of the complex chitin‑ and chitosan‑containing matrices such as fungal cell walls and insect cuticles, chitin‑ and chitosan‑modifying and ‑degrading enzymes such as chitin deacetylases, chitinases, and chitosanases, but also chitin‑ and chitosan‑recognising receptors of the innate immune systems of plants, animals, and humans. The acetylation pattern, thus, may constitute a kind of 'ChitoCode', and we are convinced that new in silico, in vitro, and in situ analytical tools as well as new synthetic methods of enzyme biotechnology and organic synthesis are currently offering an unprecedented opportunity to decipher this code. We anticipate a deeper understanding of the biology of chitin‑ and chitosan‑containing matrices, including their synthesis, assembly, mineralisation, degradation, and perception. This in turn will improve chitin and chitosan biotechnology and the development of reliable chitin‑ and chitosan‑based products and applications, e.g. in medicine and agriculture, food and feed sciences, as well as cosmetics and material sciences., Finanziert über die DEAL-Vereinbarung mit Wiley 2019-2022.

The Michaelis constant KM describes the affinity of an enzyme for a specific substrate and is a central parameter in studies of enzyme kinetics and cellular physiology. As measurements of KM are often difficult and time-consuming, experimental estimates exist for only a minority of enzyme–substrate combinations even in model organisms. Here, we build and train an organism-independent model that successfully predicts KM values for natural enzyme–substrate combinations using machine and deep learning methods. Predictions are based on a task-specific molecular fingerprint of the substrate, generated using a graph neural network, and on a deep numerical representation of the enzyme’s amino acid sequence. We provide genome-scale KM predictions for 47 model organisms, which can be used to approximately relate metabolite concentrations to cellular physiology and to aid in the parameterization of kinetic models of cellular metabolism., To understand the action of an enzyme, we need to know its affinity for its substrates, quantified by Michaelis constants, but these are difficult to measure experimentally. This study shows that a deep learning model that can predict them from structural features of the enzyme and substrate, providing KM predictions for all enzymes across 47 model organisms.

The evolution of eukaryotic organisms starting with the last eukaryotic common ancestor was accompanied by lineage-specific expansion of gene families. A paper by Garge et al. provides an excellent opportunity to have students explore how expansion of gene families via gene duplication results in protein specialization, in this case in the context of eukaryotic cytoskeletal organization . The authors tested hypotheses about conserved protein function by systematic “humanization” of the yeast cytoskeletal components while employing a wide variety of methodological approaches. We outline several exercises to promote students’ ability to explore the genomic databases, perform bioinformatic analyses, design experiments for functional analysis of human genes in yeast and critically interpret results to address both specific and general questions.

Several lines of study suggest that peripheral metabolism of amyloid beta (Aß) is associated with risk for Alzheimer disease (AD). In blood, greater than 90% of Aß is complexed as an apolipoprotein, raising the possibility of a lipoprotein-mediated axis for AD risk. In this study, we report that genetic modification of C57BL/6J mice engineered to synthesise human Aß only in liver (hepatocyte-specific human amyloid (HSHA) strain) has marked neurodegeneration concomitant with capillary dysfunction, parenchymal extravasation of lipoprotein-Aß, and neurovascular inflammation. Moreover, the HSHA mice showed impaired performance in the passive avoidance test, suggesting impairment in hippocampal-dependent learning. Transmission electron microscopy shows marked neurovascular disruption in HSHA mice. This study provides causal evidence of a lipoprotein-Aß /capillary axis for onset and progression of a neurodegenerative process.

Antiviral defenses can sense viral RNAs and mediate their destruction. This presents a challenge for host cells since they must destroy viral RNAs while sparing the host mRNAs that encode antiviral effectors. Here, we show that highly upregulated interferon-stimulated genes (ISGs), which encode antiviral proteins, have distinctive nucleotide compositions. We propose that self-targeting by antiviral effectors has selected for ISG transcripts that occupy a less self-targeted sequence space. Following interferon (IFN) stimulation, the CpG-targeting antiviral effector zinc-finger antiviral protein (ZAP) reduces the mRNA abundance of multiple host transcripts, providing a mechanistic explanation for the repression of many (but not all) interferon-repressed genes (IRGs). Notably, IRGs tend to be relatively CpG rich. In contrast, highly upregulated ISGs tend to be strongly CpG suppressed. Thus, ZAP is an example of an effector that has not only selected compositional biases in viral genomes but also appears to have notably shaped the composition of host transcripts in the vertebrate interferome., Our cells are poised to combat viral infection through antiviral effectors. This study proposes that as well as targeting viral RNAs, antiviral effectors sometimes target host mRNAs too; over millions of years, this has selected for compositional biases in the host’s transcriptional response to virus infection.

Micropatterning encompasses a set of methods aimed at precisely controlling the spatial distribution of molecules onto the surface of materials. Biologists have borrowed the idea and adapted these methods, originally developed for electronics, to impose physical constraints on biological systems with the aim of addressing fundamental questions across biological scales from molecules to multicellular systems. Here, I approach this topic from a developmental biologist's perspective focusing specifically on how and why micropatterning has gained in popularity within the developmental biology community in recent years. Overall, this Primer provides a concise overview of how micropatterns are used to study developmental processes and emphasises how micropatterns are a useful addition to the developmental biologist’s toolbox., Summary: This Primer introduces micropatterning as a tool to study development and discusses what we have learnt so far with this technique.

The growing bacterial resistance to available β-lactam antibiotics is a very serious public health problem, especially due to the production of a wide range of β-lactamases. At present, clinically important bacteria are increasingly acquiring new elements of resistance to carbapenems and polymyxins, including extended-spectrum β-lactamases (ESBLs), carbapenemases and phosphoethanolamine transferases of the MCR type. These bacterial enzymes limit therapeutic options in human and veterinary medicine. It must be emphasized that there is a real risk of losing the ability to treat serious and life-threatening infections. The present study aimed to design specific oligonucleotides for rapid PCR detection of ESBL-encoding genes and in silico analysis of selected ESBL enzymes. A total of 58 primers were designed to detect 49 types of different ESBL genes. After comparing the amino acid sequences of ESBLs (CTX-M, SHV and TEM), phylogenetic trees were created based on the presence of conserved amino acids and homologous motifs. This study indicates that the proposed primers should be able to specifically detect more than 99.8% of all described ESBL enzymes. The results suggest that the in silico tested primers could be used for PCR to detect the presence of ESBL genes in various bacteria, as well as to monitor their spread.

Methods for data analysis in the biomedical, life, and social (BLS) sciences are developing at a rapid pace. At the same time, there is increasing concern that education in quantitative methods is failing to adequately prepare students for contemporary research. These trends have led to calls for educational reform to undergraduate and graduate quantitative research method curricula. We argue that such reform should be based on data-driven insights into within- and cross-disciplinary use of analytic methods. Our survey of peer-reviewed literature analyzed approximately 1.3 million openly available research articles to monitor the cross-disciplinary mentions of analytic methods in the past decade. We applied data-driven text mining analyses to the “Methods” and “Results” sections of a large subset of this corpus to identify trends in analytic method mentions shared across disciplines, as well as those unique to each discipline. We found that the t test, analysis of variance (ANOVA), linear regression, chi-squared test, and other classical statistical methods have been and remain the most mentioned analytic methods in biomedical, life science, and social science research articles. However, mentions of these methods have declined as a percentage of the published literature between 2009 and 2020. On the other hand, multivariate statistical and machine learning approaches, such as artificial neural networks (ANNs), have seen a significant increase in the total share of scientific publications. We also found unique groupings of analytic methods associated with each BLS science discipline, such as the use of structural equation modeling (SEM) in psychology, survival models in oncology, and manifold learning in ecology. We discuss the implications of these findings for education in statistics and research methods, as well as within- and cross-disciplinary collaboration., A quantitative survey of >1 million published research articles reveals that while classical statistical methods remain in widespread use, multivariate statistical and machine-learning approaches have seen a significant increase; statistics curricula should be revised to take full advantage of these new analytical tools.

Among over 150 distinct RNA modifications, N6-methyladenosine (m6A) and adenosine-to-inosine (A-to-I) RNA editing represent 2 of the most studied modifications on mammalian mRNAs. Although both modifications occur on adenosine residues, knowledge on potential functional crosstalk between these 2 modifications is still limited. Here, we show that the m6A modification promotes expression levels of the ADAR1, which encodes an A-to-I RNA editing enzyme, in response to interferon (IFN) stimulation. We reveal that YTH N6-methyladenosine RNA binding protein 1 (YTHDF1) mediates up-regulation of ADAR1; YTHDF1 is a reader protein that can preferentially bind m6A-modified transcripts and promote translation. Knockdown of YTHDF1 reduces the overall levels of IFN-induced A-to-I RNA editing, which consequently activates dsRNA-sensing pathway and increases expression of various IFN-stimulated genes. Physiologically, YTHDF1 deficiency inhibits virus replication in cells through regulating IFN responses. The A-to-I RNA editing activity of ADAR1 plays important roles in the YTHDF1-dependent IFN responses. Therefore, we uncover that m6A and YTHDF1 affect innate immune responses through modulating the ADAR1-mediated A-to-I RNA editing., A study of the epitranscriptomic landscape reveals a functional role of the RNA modification N6-methyladenosine in suppressing aberrant innate antiviral immune responses by modulating A-to-I RNA editing and RNA secondary structure.

As we uncover the ubiquity of hybridization in nature, determining how natural selection acts on hybrids has newfound importance for speciation. A study in PLOS Biology uses threespine stickleback to detect a genomic signature of ecological incompatibilities., As we uncover the ubiquity of hybridization in nature, determining how natural selection acts on hybrids has newfound importance for speciation. This Primer explores a study in PLOS Biology that uses threespine stickleback to detect a genomic signature of ecological incompatibilities.

Perceptual anomalies in individuals with autism spectrum disorder (ASD) have been attributed to an imbalance in weighting incoming sensory evidence with prior knowledge when interpreting sensory information. Here, we show that sensory encoding and how it adapts to changing stimulus statistics during feedback also characteristically differs between neurotypical and ASD groups. In a visual orientation estimation task, we extracted the accuracy of sensory encoding from psychophysical data by using an information theoretic measure. Initially, sensory representations in both groups reflected the statistics of visual orientations in natural scenes, but encoding capacity was overall lower in the ASD group. Exposure to an artificial (i.e., uniform) distribution of visual orientations coupled with performance feedback altered the sensory representations of the neurotypical group toward the novel experimental statistics, while also increasing their total encoding capacity. In contrast, neither total encoding capacity nor its allocation significantly changed in the ASD group. Across both groups, the degree of adaptation was correlated with participants’ initial encoding capacity. These findings highlight substantial deficits in sensory encoding—independent from and potentially in addition to deficits in decoding—in individuals with ASD., It is increasingly recognized that individuals with Autism Spectrum Disorder (ASD) show anomalies in perception, and these have been recently attributed to altered decoding (i.e. interpretation of sensory signals). This study reveals that independent of these changes, individuals with ASD show upstream deficits in sensory encoding (i.e., how samples are drawn from the environment).

The design of specific primers is an interesting research topic such that it offers selective, specific, and effective DNA analysis using real-time PCR. This research was intended to detect bovine DNA using real-time PCR and specific primers to ensure the halal authenticity of food products . Primers of bovine DNA sequences were designed in the NCBI and Primer-BLAST programs. The outcome validation was assessed using several parameters, namely specificity, repeatability, and linearity by real-time PCR. Primer specificity test was performed on fresh tissue (pork and negative control), while the repeatability test used six replications and was based on the calculated coefficient of variation (CV). In the linearity test, six different DNA concentrations (50000, 10000, 5000, 500, 100, and 50 pg/µL) were examined to obtain the efficiency value. Using the specific primer from Cytochrome-B, the real-time PCR could specifically identify the presence of bovine DNA at the optimum annealing temperature of 58.7 0 C. The repeatability analysis yielded a coefficient of variation (CV) of 0.57 %, while the linearity test produced an efficiency value of 206 %. These figures confirm that the method employed in this study is not only specific but also sensitive and reliable for detecting bovine DNA. Real-time PCR using specific primer targeting on the cytochrome-B region of bovine DNA (forward: CTACTGACACTCACATGAATTGG; reverse CACTAGGATGAGGAGAAAGTATAGG) can be used to identify bovine DNA and distinguish it from porcine DNA.

Mismatches between template sequences and reverse transcription (RT) or polymerase chain reaction (PCR) primers can lead to underestimation or false negative results during detection and quantification of sequence-diverse viruses. We performed an in silico inclusivity analysis of a widely used RT-PCR assay for detection of hepatitis A virus (HAV) in food, described in ISO 15216-1. One of the most common mismatches found was a single G (primer) to U (template) mismatch located at the terminal 3 '-end of the reverse primer region. This mismatch was present in all genotype III sequences available in GenBank. Partial HAV genomes with common or potentially severe mismatches were produced by in vitro transcription and analysed using RT-ddPCR and RT-qPCR. When using standard conditions for RT-qPCR, the mismatch identified resulted in underestimation of the template concentration by a factor of 1.7-1.8 and an increase in 95% limit of detection from 8.6 to 19 copies/reaction. The effect of this mismatch was verified using full-length viral genomes. Here, the same mismatch resulted in underestimation of the template concentration by a factor of 2.8. For the partial genomes, the presence of additional mismatches resulted in underestimation of the template concentration by up to a factor of 232. Quantification by RT-ddPCR and RT-qPCR was equally affected during analysis of RNA templates with mismatches within the reverse primer region. However, on analysing DNA templates with the same mismatches, we found that ddPCR quantification was less affected by mismatches than qPCR due to the end-point detection technique.

The flowering process in plants proceeds through the induction of an inflorescence meristem triggered by several pathways. Many of the genes associated with these pathways encode transcription factors of the MADS domain family. The MADS-domain transcription factor APETALA1 (AP1) is a key regulator of flower development. The first step to understand the molecular mechanisms under the function of each gene in a plant is identification, sequencing and phylogeny analysis of that gene. For this purpose, total RNA was isolated from flower bud of garden cress (Lepidium sativum L.) and was used for cDNA synthesis. The specific primers were designed based on nucleotide sequence alignment of AP1 homologus genes from plants of the same family Brassicaceae and were used in RT-PCR. After observing its electrophoretic pattern and ensuring the quality of PCR product, the amplicon was sent for sequencing. After receiving the results of sequencing, the sequence examined with BLAST, MUSCLE, Gene Runner and MEGA6 softwares. The results indicated amplification of 787 nucleotides fragment that named LsAP1 and was recorded by accession number KP070728 in NCBI database. The studies show high similarity and overlapping of gene bank sequences with LsAP1 illative protein. According to these results, LsAP1 may play a similar role as AP1 in flower induction and could act as a flower meristem identity gene in Lepidium sativum L.

Background Local communities in the South Eastern Lowveld of Zimbabwe have adopted the feeding of livestock with Neorautanenia brachypus (Harms) C.A. tuber to mitigate against climate change. Differences within Neorautanenia brachypus (Harms) tuber flesh colour and preferences by cattle have been observed, suggesting possible diversity within the N. brachypus plant community. This study aimed at distinguishing the N. brachypus wild plant species through phenotypic and genetic characterization using morphological descriptors and random amplified polymorphic (RAPD) markers respectively. Leaf samples were selected using judgmental sampling techniques from wards 11–15 in Sengwe (Chiredzi district) for leaf morphology and molecular characterization. RAPD-PCR analysis was done using 18-screened random decamer primers to confirm the diversity in the plant population. The similarity of the biotypes was evaluated using binary coding on the basis of the presence or absence of a morphological indicator as well as distinct DNA amplicon fragments. Primer 7.0.13 was used to estimate morphological and genetic similarities using the unweighted pair group method with arithmetic average (UPGMA). The cluster number was estimated using the Elbow method part of the R package. Results Initially, 14 biotype groups were identified from 96 accessions visually characterized basing of leaf characteristics. All the leaf biotypes displayed arcuate venation with differences observed for leaf shape, tip shape and leaf margins. The 14 biotypes clustered into six groups based on the binary data of the morphological characteristics. RAPD primers generated three hundred and sixty eight distinct amplicons with 77.5% being polymorphic from the 14 biotypes. The number of bands produced per primer ranged from four (OPF-02) to 44 (UBC-746). The PIC value ranged from 0.1327 to 0.1873 for the RAPD primers. Use of molecular markers collapsed the biotypes into five clusters. Both the leaf descriptors and RAPD markers showed the existence of genetic diversity within the wild accessions of N. brachypus. Conclusions A combination of morphological and RAPD markers effectively refined the resolution of the genetic diversity within the N. brachypus wild accessions to nine biotypes. These findings have indicated to the existence of more than one biotype of N. brachypus with potentially different properties. The favorable biotypes can further be promoted through incorporation in pastures as alternative feed or complementary feed to livestock. As such the output of this study will serve as a guide for N. brachypus germplasm management and improvement. Electronic supplementary material The online version of this article (10.1186/s12898-019-0229-9) contains supplementary material, which is available to authorized users.

International audience

There are currently limited Food and Drug Administration (FDA)-approved drugs and vaccines for the treatment or prevention of Coronavirus Disease 2019 (COVID-19). Enhanced understanding of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) infection and pathogenesis is critical for the development of therapeutics. To provide insight into viral replication, cell tropism, and host-viral interactions of SARS-CoV-2, we performed single-cell (sc) RNA sequencing (RNA-seq) of experimentally infected human bronchial epithelial cells (HBECs) in air-liquid interface (ALI) cultures over a time course. This revealed novel polyadenylated viral transcripts and highlighted ciliated cells as a major target at the onset of infection, which we confirmed by electron and immunofluorescence microscopy. Over the course of infection, the cell tropism of SARS-CoV-2 expands to other epithelial cell types including basal and club cells. Infection induces cell-intrinsic expression of type I and type III interferons (IFNs) and interleukin (IL)-6 but not IL-1. This results in expression of interferon-stimulated genes (ISGs) in both infected and bystander cells. This provides a detailed characterization of genes, cell types, and cell state changes associated with SARS-CoV-2 infection in the human airway.

Rotifers are a small-sized but key group of freshwater zooplankters with high species richness, linking primary producers to higher consumers in aquatic food webs. DNA barcoding has been widely used in exploring its biodiversity, cryptic speciation and phylogeny. However, the inefficiency of universal primers to amplify COI of rotifers hinders our understanding of their species richness and genetic diversity. Here, we develop a new pair of primers, 30 F and 885 R, to amplify the COI gene of rotifers. We used 22 species to test their PCR success rate and found that the new pair of primers was more efficient (86%) than two pairs of universal primers, namely, dgLCO and dgHCO (32%), and Folmer primers (59%). The new primers will allow the barcoding of groups that were so far difficult to sequence and will contribute to clarify species diversity and phylogeny of rotifers.

MicroRNAs (miRNAs) play important roles in regulating flowering and reproduction of angiosperms. Mature miRNAs are encoded by multiple MIRNA genes that can differ in their spatiotemporal activities and their contributions to gene regulatory networks, but the functions of individual MIRNA genes are poorly defined. We functionally analyzed the activity of all 5 Arabidopsis thaliana MIR172 genes, which encode miR172 and promote the floral transition by inhibiting the accumulation of APETALA2 (AP2) and APETALA2-LIKE (AP2-LIKE) transcription factors (TFs). Through genome editing and detailed confocal microscopy, we show that the activity of miR172 at the shoot apex is encoded by 3 MIR172 genes, is critical for floral transition of the shoot meristem under noninductive photoperiods, and reduces accumulation of AP2 and TARGET OF EAT2 (TOE2), an AP2-LIKE TF, at the shoot meristem. Utilizing the genetic resources generated here, we show that the promotion of flowering by miR172 is enhanced by the MADS-domain TF FRUITFULL, which may facilitate long-term silencing of AP2-LIKE transcription, and that their activities are partially coordinated by the TF SQUAMOSA PROMOTER-BINDING-LIKE PROTEIN 15. Thus, we present a genetic framework for the depletion of AP2 and AP2-LIKE TFs at the shoot apex during floral transition and demonstrate that this plays a central role in floral induction., Flowering of plants is repressed by microRNA 172; this study shows that three genes encoding miR172 act redundantly at the shoot apex to reduce expression of the transcription factor APETALA2, a repressor of flowering. Dual repression of APETALA2 at the transcriptional level by FRUITFULL and the post-transcriptional level by miR172 enables rapid and stable transition to the reproductive state.

As the SARS-CoV-2 pandemic has progressed, increasing attention has focused on establishing natural and vaccine-induced immunity against this coronavirus and the disease, COVID-19, that it causes. In this Primer, we explain the fundamental features of T cell memory and their potential relevance for effective immunity to SARS-CoV-2.

Ciliates are unicellular eukaryotes with both a germline genome and a somatic genome in the same cytoplasm. The somatic macronucleus (MAC), responsible for gene expression, is not sexually transmitted but develops from a copy of the germline micronucleus (MIC) at each sexual generation. In the MIC genome of Paramecium tetraurelia, genes are interrupted by tens of thousands of unique intervening sequences called internal eliminated sequences (IESs), which have to be precisely excised during the development of the new MAC to restore functional genes. To understand the evolutionary origin of this peculiar genomic architecture, we sequenced the MIC genomes of 9 Paramecium species (from approximately 100 Mb in Paramecium aurelia species to >1.5 Gb in Paramecium caudatum). We detected several waves of IES gains, both in ancestral and in more recent lineages. While the vast majority of IESs are single copy in present-day genomes, we identified several families of mobile IESs, including nonautonomous elements acquired via horizontal transfer, which generated tens to thousands of new copies. These observations provide the first direct evidence that transposable elements can account for the massive proliferation of IESs in Paramecium. The comparison of IESs of different evolutionary ages indicates that, over time, IESs shorten and diverge rapidly in sequence while they acquire features that allow them to be more efficiently excised. We nevertheless identified rare cases of IESs that are under strong purifying selection across the aurelia clade. The cases examined contain or overlap cellular genes that are inactivated by excision during development, suggesting conserved regulatory mechanisms. Similar to the evolution of introns in eukaryotes, the evolution of Paramecium IESs highlights the major role played by selfish genetic elements in shaping the complexity of genome architecture and gene expression., A comparative genomics study of nine Paramecium species reveals successful invasion of genes by transposable elements in their germline genomes, showing that the internal eliminated sequences (IESs) followed an evolutionary trajectory remarkably similar to that of spliceosomal introns.

The Androgen Receptor (AR) Gene’s expression is essential during puberty and testes maturation, which is also used as a reference for Turkey’s breeding program. Therefore, this study aims to develop and optimize two primer sets for studying relative expression using qPCR technology. The primers were designed to amplify specific regions in the AR gene as the main target, and the β-actin gene as an internal control. They were tested using in-silico and amplicon sequencing, as well as efficiency calculation with a constructed standard curve from serially diluted reactions. Based on the sequencing methods, the primers amplified the corresponding regions of the respective targets. The primer for AR gene had an efficiency of 98.03%, a slope of -3.37, and an R2 of 0.995, while that of the β-actin gene had an efficiency of 98.01%, a slope of -3.371, and an R2 of 0.999. The two efficiencies exceeded the standard (93 -103%) value and the melting curve analysis showed that no non-specific amplification was discovered for both primers. According to the tests, the primers are suggested as acceptable to be used for the relative expression study of the AR gene in Turkey.

The apical complex is the instrument of invasion used by apicomplexan parasites, and the conoid is a conspicuous feature of this apparatus found throughout this phylum. The conoid, however, is believed to be heavily reduced or missing from Plasmodium species and other members of the class Aconoidasida. Relatively few conoid proteins have previously been identified, making it difficult to address how conserved this feature is throughout the phylum, and whether it is genuinely missing from some major groups. Moreover, parasites such as Plasmodium species cycle through 3 invasive forms, and there is the possibility of differential presence of the conoid between these stages. We have applied spatial proteomics and high-resolution microscopy to develop a more complete molecular inventory and understanding of the organisation of conoid-associated proteins in the model apicomplexan Toxoplasma gondii. These data revealed molecular conservation of all conoid substructures throughout Apicomplexa, including Plasmodium, and even in allied Myzozoa such as Chromera and dinoflagellates. We reporter-tagged and observed the expression and location of several conoid complex proteins in the malaria model P. berghei and revealed equivalent structures in all of its zoite forms, as well as evidence of molecular differentiation between blood-stage merozoites and the ookinetes and sporozoites of the mosquito vector. Collectively, we show that the conoid is a conserved apicomplexan element at the heart of the invasion mechanisms of these highly successful and often devastating parasites., Proteomic characterisation of the invasion-related conoid structure in Toxoplasma reveals that this structure is ubiquitous in apicomplexan parasites, including the malaria parasite Plasmodium, where it was previously thought to be absent.

Abtract As DNA metabarcoding has become an emerging tool for surveying biodiversity, including its application in legally binding assessments, reliable and efficient barcodes are requested, especially for the highly diverse group of zooplankton. This study focuses on comparing the efficiency of two mitochondrial COI barcodes based on the internal primers mlCOIintF and mlCOIintR utilizing mesozooplankton samples collected in a Mediterranean lagoon. Our results indicate that after a slight adjustment, the mlCOIintR primer performs in combination with jdgLCO1490 (herein) very comparably to the much more widely used primer system mlCOIintF/jgHCO2198+dgHCO2198, in terms of level of taxonomic resolution, species detection and their relative abundance in terms of numbers of reads. As for some groups, like Ctenophora, this barcode is not suitable; a combination of them may be the best option to rely on the Folmer region in its entirety without the risk of losing information for a limited primer match.

In plants, nucleotide-binding domain and leucine-rich repeat (NLR)-containing proteins can form receptor networks to confer hypersensitive cell death and innate immunity. One class of NLRs, known as NLR required for cell death (NRCs), are central nodes in a complex network that protects against multiple pathogens and comprises up to half of the NLRome of solanaceous plants. Given the prevalence of this NLR network, we hypothesised that pathogens convergently evolved to secrete effectors that target NRC activities. To test this, we screened a library of 165 bacterial, oomycete, nematode, and aphid effectors for their capacity to suppress the cell death response triggered by the NRC-dependent disease resistance proteins Prf and Rpi-blb2. Among 5 of the identified suppressors, 1 cyst nematode protein and 1 oomycete protein suppress the activity of autoimmune mutants of NRC2 and NRC3, but not NRC4, indicating that they specifically counteract a subset of NRC proteins independently of their sensor NLR partners. Whereas the cyst nematode effector SPRYSEC15 binds the nucleotide-binding domain of NRC2 and NRC3, the oomycete effector AVRcap1b suppresses the response of these NRCs via the membrane trafficking-associated protein NbTOL9a (Target of Myb 1-like protein 9a). We conclude that plant pathogens have evolved to counteract central nodes of the NRC immune receptor network through different mechanisms. Coevolution with pathogen effectors may have driven NRC diversification into functionally redundant nodes in a massively expanded NLR network., PLoS Biology, 19 (8), ISSN:1544-9173, ISSN:1545-7885

Transcriptomic approaches have provided a growing set of powerful tools with which to study genome-wide patterns of gene expression. Rapidly evolving technologies enable analysis of transcript abundance data from particular tissues and even single cells. This Primer discusses methods that can be used to collect and profile RNAs from specific tissues or cells, process and analyze high-throughput RNA-sequencing data, and define sets of genes that accurately represent a category, such as tissue-enriched or tissue-specific gene expression., Summary: This Primer gives an overview of the considerations required when planning and conducting transcriptome profiling experiments, from sample isolation to data analysis and display, and discusses best practice in defining gene sets for use in addressing biological questions.

Tumor necrosis factor-alpha (TNF-α) plays an important pathogenic role in cardiac hypertrophy and heart failure (HF); however, anti-TNF is paradoxically negative in clinical trials and even worsens HF, indicating a possible protective role of TNF-α in HF. TNF-α exists in transmembrane (tmTNF-α) and soluble (sTNF-α) forms. Herein, we found that TNF receptor 1 (TNFR1) knockout (KO) or knockdown (KD) by short hairpin RNA or small interfering RNA (siRNA) significantly alleviated cardiac hypertrophy, heart dysfunction, fibrosis, and inflammation with increased tmTNF-α expression, whereas TNFR2 KO or KD exacerbated the pathological phenomena with increased sTNF-α secretion in transverse aortic constriction (TAC)- and isoproterenol (ISO)-induced cardiac hypertrophy in vivo and in vitro, respectively, indicating the beneficial effects of TNFR2 associated with tmTNF-α. Suppressing TNF-α converting enzyme by TNF-α Protease Inhibitor-1 (TAPI-1) to increase endogenous tmTNF-α expression significantly alleviated TAC-induced cardiac hypertrophy. Importantly, direct addition of exogenous tmTNF-α into cardiomyocytes in vitro significantly reduced ISO-induced cardiac hypertrophy and transcription of the pro-inflammatory cytokines and induced proliferation. The beneficial effects of tmTNF-α were completely blocked by TNFR2 KD in H9C2 cells and TNFR2 KO in primary myocardial cells. Furthermore, we demonstrated that tmTNF-α displayed antihypertrophic and anti-inflammatory effects by activating the AKT pathway and inhibiting the nuclear factor (NF)-κB pathway via TNFR2. Our data suggest that tmTNF-α exerts cardioprotective effects via TNFR2. Specific targeting of tmTNF-α processing, rather than anti-TNF therapy, may be more useful for the treatment of hypertrophy and HF., In contrast to detrimental effects of soluble tumor necrosis factor-alpha (TNF-α) via TNFR1, this study shows that transmembrane TNF-α protects the heart by suppressing pressure overload-induced cardiac hypertrophy and inflammation via TNFR2. Targeting tmTNF-α processing may be more useful than TNF-antagonist for treatment of hypertrophy and heart failure.

Asexuality was considered to be a common feature of a large part of fungi, including those of the genusAspergillus. However, recent advances and the available genomic and genetic engineering technologies allowed to gather more and more indications of a hidden sexuality in fungi previously considered asexual. In parallel, the acquired knowledge of the most suitable conditions for crossings was shown to be crucial to effectively promote sexual reproduction in the laboratory. These discoveries not only have consequences on our knowledge of the biological processes ongoing in nature, questioning if truly asexual fungal species exist, but they also have important implications on other research areas. For instance, the presence of sexuality in certain fungi can have effects on their pathogenicity or on shaping the ecosystem that they normally colonize. For these reasons, further investigations of the sexual potential ofAspergillusspecies, such as the industrially importantA. niger, will be carried on.

The heart is an essential organ with a fascinating developmental biology. It is also one of the organs that is most often affected in human disease, either during development or in postnatal life. Over the last few decades, insights into the development of the heart have led to fundamental new concepts in gene regulation, but also to genetic and mechanistic insights into congenital heart defects. In more recent years, the lessons learned from studying heart development have been applied to interrogating regeneration of the diseased heart, exemplifying the importance of understanding the mechanistic underpinnings that lead to the development of an organ.

Environmental toxicants are chemicals that negatively affect human health. Although there are numerous ways to limit exposure, the ubiquitous nature of certain environmental toxicants makes it impossible to avoid them entirely. Consequently, scientists are continuously working toward developing strategies for combating their harmful effects. Using the nematode Caenorhabditis elegans, a model with many genetic and physiological similarities to humans, researchers in the Colaiácovo laboratory have identified several molecular mechanisms by which the toxic agent bisphenol A (BPA) interferes with reproduction. Here, we address their recent discovery that a widely available compound, Coenzyme Q10 (CoQ10), can rescue BPA-induced damage. This work is significant in that it poses a low-cost method for improving reproductive success in humans. The goal of this primer is to assist educators and students with navigating the paper entitled “Antioxidant CoQ10 Restores Fertility by Rescuing Bisphenol A-Induced Oxidative DNA Damage in the Caenorhabditis elegans Germline.” It is ideally suited for integration into an upper-level undergraduate course such as Genetics, Cell and Molecular Biology, Developmental Biology, or Toxicology. The primer provides background information on the history of BPA, the utility of the C. elegans germ line as a model for studying reproductive toxicity, and research methods including assessment of programmed cell death, fluorescent microscopy applications, and assays to quantify gene expression. Questions for deeper exploration in-class or online are provided. Related article in GENETICS: Hornos Carneiro MF, Shin N, Karthikraj R, Barbosa F Jr, Kannan K, Colaiácovo MP. Antioxidant CoQ10 restores fertility by rescuing bisphenol A-induced oxidative DNA damage in the Caenorhabditis elegans Germline. Genetics 214:381–395.

Toxoplasma gondii is a protozoan parasite with a complex life cycle and a cosmopolitan host range. The asexual part of its life cycle can be perpetually sustained in a variety of intermediate hosts through a combination of carnivory and vertical transmission. However, T. gondii produces gametes only in felids after the predation of infected intermediate hosts. The parasite changes the behavior of its intermediate hosts by reducing their innate fear to cat odors and thereby plausibly increasing the probability that the definitive host will devour the infected host. Here, we provide a short description of such parasitic behavioral manipulation in laboratory rodents infected with T. gondii, along with a bird’s eye view of underpinning biological changes in the host. We also summarize critical gaps and opportunities for future research in this exciting research area with broad implications in the transdisciplinary study of host–parasite relationships. Graphical abstract

Biological systems are composed of countless interlocking feedback loops. Reactor control systems—such as Chi-Bio (https://chi.bio/), recently published in PLOS Biology—enable biologists to drive multiple processes within living biological samples, using a single experimental framework. Consequently, the dynamic relationships between many biological variables can be explored simultaneously in situ. Similar multivariable experimental reactors are employed beyond biology in the study of active matter and non-equilibrium chemical reactions, in which physical systems are maintained far from equilibrium through the continuous introduction of energy or matter. Inexpensive state-of-the-art components enable open-source implementation of such multiparameter architectures, which represent a move away from expensive systems optimised for single measurements, towards affordable and reconfigurable multi-measurement systems. The transfer of well-understood engineering knowledge into the hands of biological and chemical specialists via open-source channels allows rapid cycles of experimental development and heralds a change in experimental capability that is driving increased theoretical and practical understanding of out-of-equilibrium systems across a wide range of scientific fields., Closed loop experimental configurations can drive chemical systems to become more lifelike by pushing them out of equilibrium; similar experimental arrangements can be applied to biological research. This Primer uses the recently published Chi-Bio system to explores the emerging trend in building open source libraries of hardware which has enabled some excellent science as well as bringing the price tag down.

Cell death is an important facet of animal development. In some developing tissues, death is the ultimate fate of over 80% of generated cells. Although recent studies have delineated a bewildering number of cell death mechanisms, most have only been observed in pathological contexts, and only a small number drive normal development. This Primer outlines the important roles, different types and molecular players regulating developmental cell death, and discusses recent findings with which the field currently grapples. We also clarify terminology, to distinguish between developmental cell death mechanisms, for which there is evidence for evolutionary selection, and cell death that follows genetic, chemical or physical injury. Finally, we suggest how advances in understanding developmental cell death may provide insights into the molecular basis of developmental abnormalities and pathological cell death in disease.

Flag smut incited by Urocystis agropyri has the potential to cause substantial reduction in yield and quality of wheat production. An early and precise diagnosis is a key component in the successful management of flag smut of wheat. Therefore, a simple molecular assay for the rapid detection of U. agropyri was developed for the first time. To detect U. agropyri, species specific primers were developed by comparing the partial sequences of internal transcribed spacer (ITS) DNA region of U. agropyri with related and unrelated phytopathogenic fungi. The clear amplicons of 503 and 548 bp were obtained with the two sets of designed primers (UA-17F/UA-519R and UA-15F/UA-562R) from the genomic DNA of 50 geographic distinct isolates of U. agropyri. However, no amplicon was obtained from the DNA of other 21 related and unrelated phytopathogenic fungi which showed the specificity of the primers for the U. agropyri. PCR reaction was also set up to confirm the presence of U. agropyri spores in six different wheat varieties along with eleven distinct regional soil samples as template DNA. The presence of U. agropyri in all the soil samples collected from an infected field and plant tissue of diseased plants collected at two different stages (20 and 40 days post sowing) and the absence in the soils and plants of healthy plots indicated 100% reliability for detection of U. agropyri. This simple and rapid test can be employed for the detection of U. agropyri from enormous wheat and soil samples in very short time with less man power. Thus, the reported molecular assay is very specific for U. agropyri and requires less time and man power over conventional diagnosis which is often confused by coinciding morphological features of closely related fungal pathogens, and therefore, it can be used for quarantine surveillance of flag smut.

Programmed cell death protein 1 (PD-1) is expressed on T cells upon T cell receptor (TCR) stimulation. PD-1 ligand 1 (PD-L1) is expressed in most tumor environments, and its binding to PD-1 on T cells drives them to apoptosis or into a regulatory phenotype. The fact that PD-L1 itself is also expressed on T cells upon activation has been largely neglected. Here, we demonstrate that PD-L1 ligation on human CD25-depleted CD4+ T cells, combined with CD3/TCR stimulation, induces their conversion into highly suppressive T cells. Furthermore, this effect was most prominent in memory (CD45RA−CD45RO+) T cells. PD-L1 engagement on T cells resulted in reduced ERK phosphorylation and decreased AKT/mTOR/S6 signaling. Importantly, T cells from rheumatoid arthritis patients exhibited high basal levels of phosphorylated ERK and following PD-L1 cross-linking both ERK signaling and the AKT/mTOR/S6 pathway failed to be down modulated, making them refractory to the acquisition of a regulatory phenotype. Altogether, our results suggest that PD-L1 signaling on memory T cells could play an important role in resolving inflammatory responses; maintaining a tolerogenic environment and its failure could contribute to ongoing autoimmunity.

Helping a friend move house, donating to charity, volunteering assistance during a crisis. Humans and other species alike regularly undertake prosocial behaviors—actions that benefit others without necessarily helping ourselves. But how does the brain learn what acts are prosocial? Basile and colleagues show that removal of the anterior cingulate cortex (ACC) prevents monkeys from learning what actions are prosocial but does not stop them carrying out previously learned prosocial behaviors. This highlights that the ability to learn what actions are prosocial and choosing to perform helpful acts may be distinct cognitive processes, with only the former depending on ACC., How do we learn which actions benefit others? This Primer discusses a recent study showing that removal of the anterior cingulate cortex prevents monkeys from learning new actions that benefit others, but does not stop them from carrying out previously learned prosocial acts.