Search

Background: Beta globin gene is responsible for producing beta globin chains that stabilize the structure and function of hemoglobin. This gene expression is controlled by complex interactions of transcriptions factors and its regulatory elements in a specific manner. Disturbed beta globin genes may result in hemoglobinopathies, mainly sickle cell disease and beta thalassemia. It seems interesting that several mutations occurring in intronic region results in severe symptoms to beta thalassemia patients, such an IVS1nt5 G>C. This research aimed to analyze RNA structural alteration effected by intronic mutation of beta thalassemia. Methods: The most prevalent mutation of beta thalassemia in Indonesia was obtained from Ithanet. The RNA secondary structure of IVS1nt5 G>C and beta globin gen (HBB) wildtype were performed by RNAStructure, along with probknot prediction. Results: The result showed that intronic mutation caused conformational change in beta globin secondary structure, either for max expect or base pairing probability approach. The mutant had bigger and more loops that diminished the protein stability. Thus, the structure might undergo dysfunction. Conclusion: The comprehensive structural-functional significance of these findings needs further study.

Background Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α‐thalassemia and two novel cases of β‐thalassemia caused by five different mutations in the globin gene. Methods Next‐generation sequencing (NGS) was used to identify novel α‐ and β‐thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. Results NGS revealed five novel cases of α‐ and β‐thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α‐globin mRNA were analyzed. Conclusion Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population., In this study, we identified five novel mutations in the five families: HBA2:c.245C>T, HBA2:c.54delC, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for the isoelectric point, amino acid conservation, and pathogenicity of the missense mutation.

Background: α-thalassemia, with carrier rates of 11.31% and 17.55% respectively in Guangdong and Guangxi province, is a highly prevalent disease in Southern China and tropical and subtropical regions and is mainly caused by deletion in α-globin gene (HBA1 and HBA2). The clinical manifestation of α-thalassemia is highly correlated with the copy number of α-globin gene. The decrease of copy number results in α-thalassemia, while duplication or triplication compounded with β-thalassemia may aggravate the clinical manifestation. However, the usual methods we used to measure the copy number variants can only detect the three common types: --SEA, -α3.7 and − α4.2, which may easily miss the rare deletional type and duplication or triplication cases. Therefore, it is essential to establish a new method which allows detection of different copy number variants in α-globin genes, including deletion, duplication and triplication simultaneously and accurately.Methods: 428 peripheral blood and fetal chorionic villus or amniotic fluid samples were recruited in this study. We used a pair of primers and two probes to perform droplet digital PCR.Results: By performing only two reactions, we accurately detected the copy number variants in α-globin genes, including the common form α-thalassemia, triplications such as αααanti4.2 and trisomy 16. The accuracy rate for detecting the copy number of α-globin genes can up to 100%.Conclusions: In conclusion, droplet digital PCR served as an accurate and rapid method for copy number variation detection in clinical screening for α-thalassemia.

Lysosomal enzyme deficiencies comprise a large group of genetic disorders that generally lack effective treatments. A potential treatment approach is to engineer the patient’s own hematopoietic system to express high levels of the deficient enzyme, thereby correcting the biochemical defect and halting disease progression. Here, we present an efficient ex vivo genome editing approach using CRISPR-Cas9 that targets the lysosomal enzyme iduronidase to the CCR5 safe harbor locus in human CD34+ hematopoietic stem and progenitor cells. The modified cells secrete supra-endogenous enzyme levels, maintain long-term repopulation and multi-lineage differentiation potential, and can improve biochemical and phenotypic abnormalities in an immunocompromised mouse model of Mucopolysaccharidosis type I. These studies provide support for the development of genome-edited CD34+ hematopoietic stem and progenitor cells as a potential treatment for Mucopolysaccharidosis type I. The safe harbor approach constitutes a flexible platform for the expression of lysosomal enzymes making it applicable to other lysosomal storage disorders., Mucopolysaccharidosis type I (MPSI) is a lysosomal storage disease caused by insufficient iduronidase (IDUA) activity. Here, the authors use an ex vivo genome editing approach to overexpress IDUA in human hematopoietic stem and progenitor cells and show it can phenotypically correct MSPI in mouse model.

The expression of the fetal Gγ- and Aγ-globin genes in normal development is confined to the fetal period, where two γ-globin chains assemble with two α-globin chains to form α2γ2tetramers (HbF). HbF sustains oxygen delivery to tissues until birth, when β-globin replaces γ-globin, leading to the formation of α2β2tetramers (HbA). However, in different benign and pathological conditions, HbF is expressed in adult cells, as it happens in the hereditary persistence of fetal hemoglobin, in anemias and in some leukemias. The molecular basis of γ-globin differential expression in the fetus and of its inappropriate activation in adult cells is largely unknown, although in recent years, a few transcription factors involved in this process have been identified. The recent discovery that fetal cells can persist to adulthood and contribute to disease raises the possibility that postnatal γ-globin expression could, in some cases, represent the signature of the fetal cellular origin.

High-throughput HPV typing assays with increased automation, faster turnaround and type-specific digital readout would facilitate studies monitoring the impact of HPV vaccination. We evaluated the NanoString nCounter&reg, platform for detection and digital readout of 48 HPV types in a single reaction. NanoString (NS) used proprietary software to design CodeSets: type-specific probe pairs targeting 48 HPV types and the globin gene. We tested residual DNA extracts from epidemiologic specimens and defined samples (HPV plasmids at 10 to 104 copies/reaction) directly (No-PCR) as well as after L1 consensus PCR of 45 (PCR-45) or 15 cycles (PCR-15). Assay and interpretation followed NS recommendations. We evaluated analytic performance by comparing NanoString results for types included in prior assays: Roche Linear Array (LA) or HPV TypeSeq assay. No-PCR results on 40 samples showed good type-specific agreement with LA (k = 0.621) but sensitivity was 65% with lower limit of detection (LOD) at 104 plasmid copies. PCR-45 results showed almost perfect type-specific agreement with LA (k = 0.862), 82% sensitivity and LOD at 10 copies. PCR-15 results on 75 samples showed substantial type-specific agreement with LA (k = 0.796, 92% sensitivity) and TypeSeq (k = 0.777, 87% sensitivity), and LOD at 10 copies of plasmids. This proof-of-principle study demonstrates the efficacy of the NS platform with HPV CodeSet for type-specific detection using a low number of PCR cycles (PCR-15). Studies are in progress to evaluate assay reproducibility and analytic validation with a larger number of samples.

Decades-old findings supporting origin of F cells in adult life from adult-type progenitors and the in vitro and in vivo enhancement of fetal globin under stress conditions have been juxtaposed against recent mechanistic underpinnings. An updated molecular interrogation did not debunk prior conclusions on the origin of F cells. Although fetal globin reactivation by widely diverse approaches in vitro and in response to anemic stresses in vivo is a work in progress, accumulating evidence converges toward an integrated stress response pathway. The newly uncovered developmental regulators of globin gene switching not only have provided answers to the long-awaited quest of transregulation of switching, they are also reaching a clinical threshold. Although the effect of fetal globin silencers has been robustly validated in adult cells, the response of cells at earlier developmental stages has been unclear and inadequately studied.

We studied the repression of adult and embryo-larval genes of the major globin gene locus in D. rerio fibroblasts. The results obtained suggest that at least some of the globin genes are repressed by Polycomb, similarly to human α-globin genes. Furthermore, within two α/β globin gene pairs, repression of α-type and β-type genes appears to be mediated by different mechanisms, as increasing the level of histone acetylation can activate transcription of only β-type genes.

More than 900 abnormal hemoglobin (Hb) β chain variants have now been characterized. The majority are due to point mutations resulting in a single amino acid substitution within the globin gene involved, with nearly twice as many β chain variants identified compared to α chain variants. Although most of these variants are clinically and hematologically silent, they can interact with different thalassemia mutations, which could sometimes render laboratory diagnostics in a routine setting difficult. In this study, we present a case of coinheritance of Hb City of Hope [β69(E13)Gly→Ser; HBB: c.208G>A] and β-thalassemia (β-thal), that compromises the molecular diagnosis of β-thal trait.

We report a rare mutation, HBA2: c.184A>T on the α2-globin gene, detected in a Chinese proband who presented with Hb H disease and a mild anemia. This frameshift mutation results in a premature ter...

Hb H disease is generally a moderate form of α-thalassemia (α-thal) that rarely requires regular blood transfusions. In this study, two Chinese families with members carrying transfusion-dependent Hb H disease were investigated for rare mutations on the α-globin genes (HBA1, HBA2). In one family, Hb Zurich-Albisrieden [α59(E8)Gly→Arg; HBA1: c.178G>C] in combination with the Southeast Asian (- -SEA) deletion was the defect responsible for the severe phenotype. In another family, a novel hemoglobin (Hb) variant named Hb Sichuan (HBA1: c.393_394insT), causes α-thal and a severe phenotype when associated with the - -SEA deletion. As these two HBA1 mutations can present as continuous blood transfusion-dependent α-thal, it is important to take this point into account for detecting the carriers, especially in couples in which one partner is already a known α0-thal carrier.

This study aimed to characterize polymorphism of the b-globin gene (framework) among common b-thalassemia mutations found in northern Thailand. Thirty-one homozygous b-thalassemia major patients admitted to Chiang Mai University Hospital were identified using direct DNA sequencing method. Among 15 patients with homozygous of codon 41/42 (-TCTT), eight were homozygous of framework 1 (FW1), one was homozygous of FW3A, and the remainders were heterozygousof FW1 and FW3A. The gene frequencies of FW1 and FW3A in the patients were 0.733 (22/ 30) and 0.267 (8/30), respectively. All 11 patients with homozygous of codon 17 (A-T) were homozygous of FW3A, while three patients with homozygous of intron 1 nt 1 (G-T) were homozygous of FW1. Both patients with homozygous of codon 71/72 (+A) were FW3A. In this report, the numbers of b-globin gene frameworks were restricted in each b-thalassemia mutation. This investigation may provide further information for the study of the evolution of common mutations causing b-thalassemia major in northern Thailand.

The ancient origins and functional versatility of globins make them ideal subjects for studying physiological adaptation to environmental change. Our goals in this review are to describe the evolution of the vertebrate globin gene superfamily and to explore the structure/function relationships of hemoglobin, myoglobin, neuroglobin and cytoglobin in teleost fishes. We focus on the globins of Antarctic notothenioids, emphasizing their adaptive features as inferred from comparisons with human proteins. We dedicate this review to Guido di Prisco, our co-author, colleague, friend, and husband of C.V. Ever thoughtful, creative, and enthusiastic, Guido spearheaded study of the structure, function, and evolution of the hemoglobins of polar fishes - this review is testimony to his wide-ranging contributions. Throughout his career, Guido inspired younger scientists to embrace polar biological research, and he challenged researchers of all ages to explore evolutionary adaptation in the context of global climate change. Beyond his scientific contributions, we will miss his warmth, his culture, and his great intellect. Guido has left an outstanding legacy, one that will continue to inspire us and our research.

Thalassemia is a group of single-gene recessive inherited hemoglobin disorders caused by a mutation or deletion of one or more globin genes, which results in abnormal globin chain synthesis and hemoglobin formation. In this study, human iPSC lines HNMUi002-A, HNMUi003-A, HNMUi004-A, HNMUi005-A, HNMUi006-A, HNMUi007-A, HNMUi008-A, HNMUi009-A, HNMUi010-A were generated from the amniotic fluid cells or urine-derived cells isolated from 9 patients with thalassemia. The iPSC lines exhibited the normal karyotype, expressed pluripotency markers, and carried α- or β- globin gene mutations. These pluripotent stem cell lines will serve as useful tools for studying pathophysiological mechanism of thalassemia.

Summary Introduction Mutations in the δ-globin gene are not pathogenically relevant, but co-inheritance of δ-globin variants along with β-globin gene defects can mask the diagnosis of β-thalassaemia trait. Methods Routine haematological parameters were carried out. Molecular analysis of β-globin gene mutations was carried out by CRDB, ARMS and DNA sequencing. δ- globin gene analysis was carried out by DNA sequencing. Results In this case study, we report a β−thalassaemia trait (IVS 1-5GC) (HBB:c.92 + 5GC) with HbA2 of 1% showing the presence of δ-globin gene variant HbA2 St. George CD 81 (CT) (HBD:c.244CT). A similar observation was reported in another unrelated patient who showed near absence of HbA2 level in HPLC. He showed a presence of δ-globin gene mutation HbA2 Saurashtra CD 100(CT) (HBD: c.301CT) and a single 3.7 kb deletion in the α-globin gene. Conclusion In the countries, where β-thalassaemia is prevalent, an awareness and detection of different δ-globin gene mutations is important, as complex interactions between these haemoglobinopathies can lead to the misdiagnosis of β-thalassaemia carriers.

We report a novel mutation on the α2-globin gene, Hb Nanning (HBA2:c.369_370delinsGA) detected in a Chinese family. This mutation gives rise to a previously undescribed hemoglobin (Hb) variant that was undetectable by various separation techniques. Both carriers of the mutation have mean corpuscular volume (MCV) and mean corpuscular Hb (MCH) values that are below normal, as would be predicted for an α+-thalassemia (α+-thal) patient.

Chapter 5 provides an overview of the evolutionary history of the globin gene superfamily and places the evolution of vertebrate-specific globins in phylogenetic context. The duplication and functional divergence of globin genes has promoted key physiological innovations in respiratory gas transport and other physiological functions during animal evolution. A combination of both tandem gene duplication and whole-genome duplication contributed to the diversification of vertebrate globins. Phylogenetic reconstructions arrange vertebrate globins into those that derive from vertebrate-specific duplications (cytoglobin, globin E, globin Y, and the independently derived myoglobin-like and hemoglobin-like genes of jawed vertebrates and jawless fishes [lampreys and hagfish]) and those that derive from far more ancient duplication events that predate the divergence between deuterostomes and protostomes (androglobin, globin X, and neuroglobin). Tracing the evolutionary history of deuterostome globins reveals evidence for the repeated culling of ancestral diversity, followed by lineage-specific diversification of surviving gene lineages via repeated rounds of duplication and divergence.

We identified two novel δ-globin gene mutations in two families during routine thalassemia screening. One missense mutation at codon 73 on the δ-globin gene [δ73(E17)Asp→Val, HBD: c.221A>T] which results in a Hb A2 variant homologous to the β-globin gene variant called Hb Mobile [β73(E17)Asp→Val, HBB: c.221A>T] and we have named this variant Hb A2-Henan. The other is a nonsense mutation [δ7(A4)Glu→Stop, HBD: c.22G>T] which gives rise to a stop codon (TAG) at codon 7, resulting in δ0-thalassemia (δ0-thal). The Hb A2 in one individual with homozygous HBD: c.22G>T was absent.

BACKGROUND: One-tube osmotic fragility test (OFT) is widely used for screening thalassemia traits. Interobserver variation may occur with 0.36% NaCl-based OFT due to the naked eye result reading style. PURPOSE: The purpose of this study was to establish and evaluate the novel numerical OFT-based parameter, so-called hemolysis area (HA), in screening thalassemia traits. MATERIALS AND METHODS: The portable spectrophotometer was invented capable of calculating the HA values. The HA values were then compared among 69, 156, and 19 blood samples having positive, negative, and suspicious 0.36% NaCl-based OFT results, respectively; 109 and 135 blood samples having mean corpuscular volume (MCV) ≤80 fL and >80 fL, respectively; and 138 and 106 blood samples having mean corpuscular hemoglobin (MCH) ≤27 pg and >27 pg, respectively. In addition, the HA values were compared in 166 blood samples having different globin gene genotypes. Finally, the HA cutoff value was determined by receiver operation curve (ROC) analysis. RESULTS: The HA values in samples having positive, suspicious, and negative 0.36% NaCl-based OFT were 33.3 ± 14.4, 42.9 ± 10.5, and 65.3 ± 13.4, respectively; in sample having MCV ≤80 fL and >80 fL were 43.1 ± 19.6 and 63.8 ± 14.5, respectively; and in samples having MCH ≤27 pg and >27 pg were 46.7 ± 20.1 and 64.8 ± 14.2, respectively. The HA values in normal, hemoglobin E, SEA-a thalassemia 1, and β-thalassemia traits were 67.1 ± 12.6, 36.4 ± 13.9, 20.2 ± 4.8, and 18.6 ± 1.1, respectively. All were significantly different. ROC analysis established 52.4 as the HA cutoff that had comparable effectiveness to the conventional screening tests. CONCLUSION: The new HA value was effective and could be an alternative choice for screening thalassemia traits.

When different species experience similar selection pressures, the probability of evolving similar adaptive solutions may be influenced by legacies of evolutionary history, such as lineage-specific changes in genetic background. Here we test for adaptive convergence in hemoglobin (Hb) function among high-altitude passerine birds that are native to the Qinghai-Tibet Plateau, and we examine whether convergent increases in Hb–O 2 affinity have a similar molecular basis in different species. We documented that high-altitude parid and aegithalid species from the Qinghai-Tibet Plateau have evolved derived increases in Hb–O 2 affinity in comparison with their closest lowland relatives in East Asia. However, convergent increases in Hb–O 2 affinity and convergence in underlying functional mechanisms were seldom attributable to the same amino acid substitutions in different species. Using ancestral protein resurrection and site-directed mutagenesis, we experimentally confirmed two cases in which parallel substitutions contributed to convergent increases in Hb–O 2 affinity in codistributed high-altitude species. In one case involving the ground tit ( Parus humilis ) and gray-crested tit ( Lophophanes dichrous ), parallel amino acid replacements with affinity-enhancing effects were attributable to nonsynonymous substitutions at a CpG dinucleotide, suggesting a possible role for mutation bias in promoting recurrent changes at the same site. Overall, most altitude-related changes in Hb function were caused by divergent amino acid substitutions, and a select few were caused by parallel substitutions that produced similar phenotypic effects on the divergent genetic backgrounds of different species.

International audience; BACKGROUND Donor availability and transplantation-related risks limit the broad use of allogeneic hematopoietic-cell transplantation in patients with transfusion-dependent beta-thalassemia. After previously establishing that lentiviral transfer of a marked beta-globin (beta(A-T87Q)) gene could substitute for long-term red-cell transfusions in a patient with beta-thalassemia, we wanted to evaluate the safety and efficacy of such gene therapy in patients with transfusion-dependent beta-thalassemia. METHODS In two phase 1-2 studies, we obtained mobilized autologous CD34+ cells from 22 patients (12 to 35 years of age) with transfusion-dependent beta-thalassemia and transduced the cells ex vivo with LentiGlobin BB305 vector, which encodes adult hemoglobin (HbA) with a T87Q amino acid substitution (HbA(T87Q)). The cells were then reinfused after the patients had undergone myeloablative busulfan conditioning. We subsequently monitored adverse events, vector integration, and levels of replication-competent lentivirus. Efficacy assessments included levels of total hemoglobin and HbA(T87Q), transfusion requirements, and average vector copy number. RESULTS At a median of 26 months (range, 15 to 42) after infusion of the gene-modified cells, all but 1 of the 13 patients who had a non-beta(0)/beta(0) genotype had stopped receiving red-cell transfusions; the levels of HbA(T87Q) ranged from 3.4 to 10.0 g per deciliter, and the levels of total hemoglobin ranged from 8.2 to 13.7 g per deciliter. Correction of biologic markers of dyserythropoiesis was achieved in evaluated patients with hemoglobin levels near normal ranges. In 9 patients with a beta(0)/beta(0) genotype or two copies of the IVS1-110 mutation, the median annualized transfusion volume was decreased by 73%, and red-cell transfusions were discontinued in 3 patients. Treatment-related adverse events were typical of those associated with autologous stem-cell transplantation. No clonal dominance related to vector integration was observed. CONCLUSIONS Gene therapy with autologous CD34+ cells transduced with the BB305 vector reduced or eliminated the need for long-term red-cell transfusions in 22 patients with severe beta-thalassemia without serious adverse events related to the drug product. (Funded by Bluebird Bio and others; HGB-204 and HGB-205 ClinicalTrials. gov numbers, NCT01745120 and NCT02151526.)

We report a novel mutation on the α2-globin gene, HBA2: c.184A>T, detected in a Chinese proband. This mutation resulted in a Lys→Term substitution at position 62 of the α2-globin gene, causing a premature termination of translation. This mutation did not cause severe hematological abnormalities in the carriers. From the properties of substituted residues on the α2-globin gene, it is generally expected that this mutation causes unstable and truncated protein, thus this mutation should be detected in couples at-risk for α-thalassemia (α-thal).

Hemoglobinopathies are a heterogeneous group of inherited disorders resulting from mutations in the globin genes. Transmission is autosomal. There are 2 main types of hemoglobinopathies, one of which comprises disorders of decreased or absent production of a globin gene. These disorders are known as thalassemias. Structural abnormalities resulting from single amino acid substitutions comprise the second group of hemoglobinopathies. Although delineated by quantitative and qualitative characteristics, they are not mutually exclusive. Thalassemias can have qualitative defects, whereas other structural abnormalities may have quantitative defects. Collectively, they are one of the most common causes of nonimmune hemolytic anemias with various frequencies distributed throughout the world.

β -globinopathies (sickle-cell anemia and β-thalassemia) are the most common monogenic disorders worldwide that are potentially amenable to gene therapy. Proof-of-concept studies done 15 years ago, which showed correction of murine models of hemoglobinopathies, have gone through the rigors of preclinical safety and efficacy testing, and are now showing clinical promise both in β-thalassemia and sickle-cell anemia. Lentivirus-mediated gene replacement therapy with erythroid-specific expression of the globin gene appears safe thus far.

Sickle cell disease and β-thalassemia are well-known genetic disorders which are caused by mutations in β-globin gene. Reactivation of fetal hemoglobin in adulthood through induction of γ-globin gene expression has proven be sufficient to ameliorate sickle cell disease and β-thalassemia. In the last few decades, substantial efforts have been made to identify potential target candidates for β-globin diseases. In the present work, we propose an innovative approach for identifying novel molecular targets of β-globin diseases. Our approach is based on quantitative modeling of fetal-to-adult hemoglobin switching network with hybrid functional Petri nets. We verify the coherence of deterministic quantitative model created in this research to be sure it is consistent with qPCR data available for known siRNA- and shRNA-based strategies. Comparison of simulation results for the proposed strategy with the ones obtained for already existing RNAi-mediated treatments shows that our strategy is optimal, as it leads to the highest level of γ-globin induction. Consequently, it has potential beneficial therapeutic effect on β-globin diseases. This study also provides an innovative strategy for the target-based treatment of many other diseases. The file in this item is the post-print version of the article (author’s copy; author’s final manuscript, accepted for publication after peer-review process). Due to copyright restrictions, the access to the publisher version (published version) of this article is only available via subscription. You may click URI and have access to the Publisher Version of this article through the publisher web site or online databases, if your Library or institution has subscription to the related journal or publication.

The long-term goal of our research is to understand the genomics underlying clinical expression of β-thalassemia (β-thal) with a particular interest in the developmental regulation of globin gene switching and the pharmacogenomics re-activation of Hb F. Our approach follows two lines of investigation; clinical and experimental, by which observations in patients and families are done followed by experimental genomics. Prospective clinical data were collected over 25 years from patients with homozygous β-thal with different mild or severe mutations, using an innovative clinical severity score that served to quantify minimal response to transfusion and Hb F induction. The data indicated the requirements for transfusion even of mild thalassemia in children and that splenectomy was largely ineffective. Small doses of hydroxyurea (HU) resulted in aggravation of hematological parameters presumably due to medullary inflammation. A small number of critical families with a phenoypic thalassemia variant, or pseudo-thalassemia, due to various degrees of Krüppel-like factor 1 (KLF1) deficiency and various levels of Hb F in adulthood were identified and followed. Extensive experimental genomics confirmed the role of the KLF1 locus both directly and indirectly in regulating γ- to β-globin gene switching within a complex interactome that included FLVCR1 isoforms and that regulated the inter-erythrocytic distribution of the Hb F. Further research is intended to explore the interplay between the loci and the possible effects of new Hb F-inducing agents acting on new pathways in the clinical setting to improve patient outcomes., peer-reviewed

Alpha globin chain variants per se do not cause severe morbidity and mortality but can modify – usually ameliorate – the clinical manifestations of beta globin chain variants when co-inherited with the latter. They also pose challenges in interpretation of high-performance liquid chromatography histograms and require molecular analysis for proper characterization. Hemoglobin (Hb) Fontainebleau is a rare alpha globin chain variant [alpha 21(B2) Ala→Pro], of which only three families have been reported from India in the past. Here, we describe a case of Hb fontainebleau detected in heterozygous condition in a 19-year-old primigravida. Her husband was found to have a double heterozygous state for HbQ India and beta-thalassemia trait. This opens up the possibility of multiple combinations of hemoglobinopathies in the offspring.

The study provides an account of the incidence of Haemoglobin E and α -thalassaemia mutations and interactions between these globin gene mutations with the help of haematological data analysis and molecular characterization among the tribes from North East India. The study deals with a large cohort of four hundred and thirteen tribal population consisting of 234 cases from Assam and 179 cases from Arunachal Pradesh, respectively. These cases were obtained during a random screening programme organized by Ramakrishna Mission (RKM) Seva Pratisthan, Kolkata in collaboration with RKM’s North East Ashram for tribal populations of Dibrugarh in Assam and Itanagar in Arunachal Pradesh. These subjects from tribal populations attended the camp for routine clinical and hematological investigations. Clinical and haematological data were assessed in all 413 cases. Haemoglobin E , codon 26 (G → A ) was found to be the most prevalent mutation in the population of Dibrugarh : 48 % (113/234) in Assam and Itanagar : 16 % (29/179) in Arunachal Pradesh. Eighty cases from Assam and thirty-two cases from Arunachal Pradesh were selected for molecular study of α thalassaemia mutations based on Hb

We report a novel mutation on the α2-globin gene, codon 83 (TG), which was detected in two members of two unrelated families from Khuzestan Province, South Iran, that we named Hb Ahvaz. This mutation was detected by cellulose acetate electrophoresis and characterized by molecular studies. Hb Ahvaz does not seem to be responsible for hematological abnormalities in the carriers, but with α(0)-thalassemia (α(0)-thal) defects, might induce severe clinical symptoms.

The delineation of the beta-globin locus control region has led to a new understanding of the developmental regulation of the beta-globin gene cluster. It now seems that globin gene switching is effected through the sequential and mutually exclusive interaction of the locus control region with the embryonic, fetal and adult stage specific globin genes.

Sickle cell hemoglobin is the result of a mutation at the sixth amino acid position of the beta (β) globin chain. The HBB*S gene is in linkage disequilibrium with five main haplotypes in the β-globin-like gene cluster named according to their ethnic and geographic origins: Bantu (CAR), Benin (BEN), Senegal (SEN), Cameroon (CAM) and Arabian-Indian (ARAB). These haplotypes demonstrated that the sickle cell mutation arose independently at least five times in human history. The distribution of βS haplotypes among Brazilian populations showed a predominance of the CAR haplotype. American populations were clustered in two groups defined by CAR or BEN haplotype frequencies. This scenario is compatible with historical records about the slave trade in the Americas. When all world populations where the sickle cell gene occurs were analyzed, three clusters were disclosed based on CAR, BEN or ARAB haplotype predominance. These patterns may change in the next decades due to recent migrations waves. Since these haplotypes show different clinical characteristics, these recent migrations events raise the necessity to develop optimized public health programs for sickle cell disease screening and management.

The haemoglobin (Hb) of the extinct woolly mammoth has been recreated using recombinant genes expressed inEscherichia coli. The globin gene sequences were previously determined using DNA recovered from frozen cadavers. Although highly similar to the Hb of existing elephants, the woolly mammoth protein shows rather different responses to chloride ions and temperature. In particular, the heat of oxygenation is found to be much lower in mammoth Hb, which appears to be an adaptation to the harsh high-latitude climates of the Pleistocene Ice Ages and has been linked to heightened sensitivity of the mammoth protein to protons, chloride ions and organic phosphates relative to that of Asian elephants. To elucidate the structural basis for the altered homotropic and heterotropic effects, the crystal structures of mammoth Hb have been determined in the deoxy, carbonmonoxy and aquo-met forms. These models, which are the first structures of Hb from an extinct species, show many features reminiscent of human Hb, but underline how the delicate control of oxygen affinity relies on much more than simple overall quaternary-structure changes.

Beta (β) Thalassemia is a common globin gene disorder in India. Although about 65 different mutations are known in the multiethnic populations of India, the group of 9 'core mutations', i.e. IVSI,5 (G > C){HBB:c.925G > C}, 619 base pair deletion(bp del){NG_000007.3:g.71609_72227del619}, FS8/9 (G){HBB:c.27_28insG}, IVSI,1 (G > T) {HBB:c.92G > T}, FS41/42 (-CTTT){HBB:c.124_127del-CTTT}, C15 (G > A){HBB:c.47G > A}, FS16 (-C){HBB:c.51delC}, C30 (G > C){HBB:c.93G > C} and C5 (-CT){HBB:c17_18delCT} cover about 96% of mutations in the carriers. We attempted a multiplex PCR to detect these mutations using ARMS method and strategized it in high risk groups of western India. The system was found reliable, cost effective, fast and most applicable for mutation screening of β Thalassemia in Indian populations.

Aim. In order to get more information about organization of active chromatin hubs and their role in the regulation of gene transcription we have studied the spatial organization of the a-globin gene domain in cultured chicken erythroblasts. Methods. The chromosome conformation capture (3C) protocol was employed to analyze the 3D configuration of the chicken a-globin gene domain. Results. We have demonstrated that in the same cell population the chicken domain of a-globin gene may be organized in two different active chromatin hubs. One of them appears essential for the activation of the a-globin gene expression while the other – for the activation of TMEM8 gene which constitutes a part of the a-globin gene domain in chicken, but not in human and other mammals. Importantly, two regulatory elements participate in the formation of both active chromatin hubs. Conclusions. The assembly of the same genomic area into two alternative chromatin hubs which share some regulatory elements suggests that active chromatin hubs are dynamic rather than static, and that regulatory elements may shuttle between different chromatin hubs. Keywords: active chromatin hub, globin gene, genomic domain, chromosome conformation capture. Мета. Щоб отримати нову інформацію стосовно організації активаторних хроматинових блоків та їхньої ролі в регуляції транскрипції ми вивчили просторову організацію домену a-глобінових генів у культивованих курячих еритробластах. Методи. Для анализу 3D конфігурації домену a-глобінових генів використано метод фіксації конформації хромосоми (3С). Результати. Ми продемонстрували, що в одній і тій самій популяції курячих клітин домен a-глобінових генів може бути організованим у два різних хроматинових блоки. Один з них необхідний для активації транскрипції a-глобінових генів, тоді як другий забезпечує активацію транскрипції гена TMEM8. Цей ген входить до складу домену aглобінових генів курей, але не ссавців і людини. Важливо, що два регуляторних елементи домену a-глобінових генів присутні у складі обох активаторних хроматинових блоків. Висновки. Існування в одному й тому ж геномному домені двох різних активаторних комплексів, які мають у своєму складі спільні регуляторні елементи, свідчить про динамічну природу активаторних хроматинових блоків, що дозволяє спільним регуляторним елементам періодично переміщуватися з одного комплексу в другий. Ключові слова: активаторні хроматинові блоки, глобіновий ген, геномний домен, метод фіксації хромосоми. Цель. Чтобы получить новую информацию об организации активаторных хроматиновых блоков и их роли в регуляции транскрипции, мы изучили пространственную организацию домена a-глобиновых генов в культивируемых куриных эритробластах. Методы. Для анализа 3D конфигурации домена a-глобиновых генов использован метод фиксации конформации хромосомы (3С). Результаты. Мы продемонстрировали, что в одной и той же популяции куриных клеток домен a-глобиновых генов может быть организован в два различных хроматиновых блока. Один из них необходим для активации транскрипции a-глобиновых генов, в то время как другой обеспечивает активацию транскрипции гена TMEM8. Этот ген входит в состав домена a-глобиновых генов кур, но не млекопитающих и человека. Важно, что два регуляторных элемента домена a-глобиновых генов присутствуют в составе обоих активаторных хроматиновых блоков. Выводы. Существование в одном и том же геномном домене двух разных активаторных комплексов, имеющих в своем составе общие регуляторные элементы, свидетельствует о динамической природе активаторных хроматиновых блоков, что позволяет общим регуляторным элементам периодически перемещаться из одного комплекса в другой. Ключевые слова: активаторные хроматиновые блоки, глобиновый ген, геномный домен, метод фиксации хромосомы.

INTRODUCTION The aim of this review is to study the frequency of common and the occurrence of rare and novel mutations of the delta-globin gene and of Hb Lepore defects that might interfere with thalassemia diagnostics and to report the rationale of HbA2 estimation in the presence of delta- or alpha-gene mutations. METHODS A total of 135 cases suspected to have a delta-globin gene defect collected in a diagnostic center in the USA and in a reference laboratory in the Netherlands were characterized by molecular analysis. RESULTS Hb B2 was found at a frequency of at least 0.5% in the USA and 0.87% in the Netherlands. Known variants such as Hb A2-Babinga, Hb A2-Sphakia, Hb A2-Fitzroy, Hb A2-Flatbush, Hb A2-NYU, Hb A2-Grovetown, HbA2-Yialousa, Hb A2-Indonesia and several delta-thalassemia mutations were found together with 13 new mutations and two new polymorphisms, while Hb Lepores were regularly observed. CONCLUSION HbA2 mutations either structurally stable and visible or undetectable because of a thalassemia effect or instability are clinically asymptomatic but may compromise the diagnosis of beta-thalassemia minor. Stable mutations result in two HbA2 fractions of about half of the expected value. Expression defects are undetectable as a protein fraction but reduce the amount of HbA2 by half.

We report two new point mutations of the α1-globin gene found in a Greek and a Burmese patient, both living in Western Australia. The patients were initially selected for their microcytic hypochromic parameters as belonging to a group suspected for uncommon (deletion) defects. Gap-polymerase chain reaction (gap-PCR) and multiplex ligation-dependent probe amplification (MLPA) technologies were applied, and in those cases not showing deletions, direct sequencing was performed. We have found 1) HBA1:c.86C>T, Hb Nedlands [α28(B9)Ala→Val] which, based on the red cell indices and phenotype prediction scores, is presumed to be clinically silent, and 2) HBA1:c.98T>A, Hb Queens Park [α32(B13)Met→Lys] which seems to be associated with a mild α-thalassemia (α-thal) phenotype. The phenotype/genotype correlation is briefly described.

We report the identification of two different mutations involving the first nucleotide of intron 1 of the α2-globin gene: IVS-I-1 G→A and G→T. The available data indicated that both mutations reduce the efficiency of proper mRNA splicing, resulting in α+-thalassemia (α+-thal).

The hemoglobin (Hb) lepore-Boston is a beta-globin structural variant, produced in a reduced amount and formed from the fusion of N-terminus delta-(residues 1-87) and C-terminus beta-chains (residues 116-146). This type of fusion protein is quite common in Southern Italy (Campania, Calabria, and Sicily). We report here the hematological and hemoglobin data on 96 unrelated Sicilians with Hb lepore trait. Particularly interesting are the subjects where Hb lepore occurs with Hb S or Sicilian type delta beta-thalassemia. In these individuals, striking features are clinical variability and different hematological pictures. These observations underscore the importance of thalassemia screening in these geographic areas, such as Southern Italy, principally Sicily, where the mutations in globin gene clusters are especially prevalent. Moreover, as from the second half of the last century, owing to high migratory flux from Sicily to Northern Europe, North and South America, and Australia, the Hb lepore, as well as other hemoglobin variants, have become prevalent, making the identification of the heterozygotes a problem of general interest.

We have characterized 14 patients in 10 families with a mild form of homozygous beta thalassemia which has not been previously well defined. As these patients originate from a small area of northern Portugal we propose to call this beta + thalassaemia--Portuguese type. Clinically, the homozygotes range from asymptomatic to thalassaemia intermedia and they are characterized by low levels of HbF, less than 20%, indicating only a mild deficit in beta globin production. Heterozygotes are indistinguishable from those with the more common types of beta thalassaemia as regards red cell morphology, haemoglobin analysis and globin chain synthesis studies. Globin gene mapping excluded the presence of alpha thalassaemia in these patients and demonstrated no abnormalities in the beta-like globin gene cluster. Restriction enzyme site polymorphisms around the beta gene cluster are identical on both chromosomes in all of the homozygotes, confirming their homogeneity.

We report here restriction endonuclease maps of the β-like globin gene cluster for the British form of HPFH and for a case of Gγβ+ HPFH, and also confirm and extend previous reports of the map for the Greek form of HPFH. These results show that all these conditions belong to a group lacking any substantial deletion or rearrangement of DNA sequence in this gene cluster. The absence of any gross disruption of the structure of this region of the genome, together with evidence that the HPFH genotype is either allelic with, or closely linked to, the β-like globin gene cluster, suggests that the responsible lesions are nearer to being purely regulatory in nature than in forms of HPFH due to substantial deletions. Thus these conditions promise to provide less equivocal evidence about the regulation of β-like globin gene expression than has so far been available.

The Hb Gerland [α55(E4)Val→Ala] mutation has been described in the α2-globin gene. We report here the same mutation in the paralogous α1-globin gene. This variant was found in a healthy 18-month-old boy of Chinese origin. Abnormal hemoglobin (Hb) fractions were visible on isoelectric focusing (IEF) and cation exchange high performance liquid chromatography (HPLC), with elution patterns differing from one system to another. Direct sequencing of the α-globin genes revealed a GTT>GCT (Val→Ala) transversion at codon 55 of the α1-globin gene. We propose to name the variant encoded by the α1-globin gene Hb Gerland [A1], and the variant that is encoded by the α2-globin gene Hb Gerland [A2].

An extensive investigation of the organisation of globin genes has greatly contributed to the understanding of universal mechanisms of gene evolution and expression. Cartilaginous fish are the first organisms that have evolved the tetrameric form of hemoglobin (Hb). So far, there has been absolute lack of data about globin genes in chondrichthyans. Bathyraja is the dominant rajid south of 60 degrees S. In the framework of the investigations on globin genes of Antarctic red-blooded and Hb-less fish we obtained the cloning of the alpha- and beta-globin cDNAs of the main Hb (Hb 1) of the skate Bathyraja eatonii. Then, a genomic fragment of 6.2 kb was isolated where the Hb 1 alpha and beta genes are linked in a tail-to-head (3' to 5') orientation. The beta-globin gene promoter region and the chromosomal organisation of the Hb 1 genes of B. eatonii have been compared to their homologues in other vertebrates. The finding of a tail-to-head linkage of the Hb 1 alpha- and beta-globin genes in B. eatonii is the first characterisation of the organisation of globin genes in chondrichthyes; such finding offers a novel contribution to the understanding of the evolution of this class of genes. Moreover, the characterisation of chondrichthyan genes is very important for gaining insight into the ancestral state of vertebrate genomes.

We recently observed a heterozygote for Hb Hekinan in a Taiwanese subject. The molecular lesion of Hb Hekinan is a substitution of G--T at codon 27 of the alpha1-globin gene, which abolishes an HaeIII restriction enzyme site. Hb Hekinan [alpha27(B8)Glu--Asp, GAG--GAC (alpha2)] has not been found in Taiwan. This variant can be detected by high performance liquid chromatography (HPLC) but not by capillary or cellulose electrophoresis.

The thalassaemias are the commonest monogenic disorders in the world population. They occur at a particularly high frequency in Mediterranean regions and Southeast Asia, which cause a massive public health problem. In Hong Kong, the prevalence of heterozygous carriers of α or β thalassaemia mutations is approximately 8% [1]. Thalassaemia is characterized by the reduced synthesis of one or more normal globin chains. This causes globin chain imbalance and finally leads to hypochromic microcytic anaemia. Different types of thalassaemia are named according to the under-produced chains. The majority of thalassaemia can be diagnosed by basic haematologic profiles and simple phenotypic techniques. However, in some cases of thalassaemia the diagnosis are not apparent after routine laboratory investigations. To arrive at a diagnosis which is important for antenatal diagnosis and genetic counseling, it is necessary to use molecular approaches. In this study, 25 patients with microcytosis, normal phenotypic haemoglobin study results and without iron deficiency were analyzed retrospectively. This cohort of patients was suspected to have occult or masked thalassaemia. DNA was extracted from archive samples and further investigated by alpha multiplex gap polymerase chain reaction (α multiplex gap-PCR), alpha amplification refractory mutation system (α ARMS) and direct nucleotide sequencing of globin genes for the detection of possible underlying globin gene mutations. Results indicated that 60% of these cases with microcytosis were occult and silent αthalassaemia caused by deletional or non-deletional mutations. Maskedβthalassaemia due to co-existing δ thalassaemia or variants or normal Hb A2 β thalassaemia due to mild β globin gene mutations were not detected in the cohort. Forty percent of these cases of microcytosis remained unexplained, which await further molecular testing.

The total number of hemoglobin (Hb) variants currently included in the globin gene server database is 1626 (November 12 2014), of which 131 are fetal Hb variants. These variants are observed as two different subunits of fetal Hb, (G)γ- and (A)γ-globin chains. Of the 131 documented fetal Hb variants, 73 are (G)γ- and 58 are (A)γ-globin chain variants. Although they are easily detected at birth, as the quantity of γ chains progressively decreases over the first few months of life, they are essentially undetectable after 6 months of age. In this report we discuss the molecular characteristics and diagnostic criteria of a new (A)γ chain variant that was detected during newborn screening and named Hb F-Sykesville MD [(A)γ113(G15)Val → Ile; HBG1: c.340GA].

Background Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a mutation at codon 91 of α1-globin gene whereas Hb E is a common β-globin chain variant among Southeast Asian population. We report two hitherto undescribed conditions of Hb Grey Lynn found in Thai individuals. Methods The study was done on two unrelated Thai subjects. Hematological parameters were recorded and Hb analysis was carried out using automated Hb analyzers. Mutations were identified by DNA analysis. Hematological features of the patients were compared with those of various forms of Hb Grey Lynn documented previously. Results Hb and DNA analyses identified a heterozygous Hb Grey Lynn in one patient and a double heterozygous Hb Grey Lynn and Hb E with α(+)-thalassemia in another. Interaction of α(Grey Lynn) with β(E) chains leads to the formation of a new Hb variant, namely the Hb Grey Lynn E (α(GL)2β(E)2), detectable by liquid chromatography (10.3%) but masked by Hb E on capillary electrophoresis. Conclusions Interaction of these multiple globin gene defects could lead to complex hemoglobinopathies requiring combined analysis with multiple Hb analyzers followed by DNA testing to provide accurate diagnosis of the cases.

We introduce a novel 2D graphical representation of DNA sequences based on the pairs of the neighboring nucleotides (PNNs). Then we get the PNNs’ distributions and obtain a y-M. The construction of the PNN-curve has some important advantages ( 1 ) It avoids loss of information and the PNN-curve standing for DNA sequences does not overlap or intersect with itself. (2) The novel 2D representation is more sensitive. The utility of this method can be illustrated by the examination of similarities/dissimilarities among the coding sequences of the first exon of β -globin gene of eleven different species in Table 2.