Search

Watermelon mosaic virus (WMV) is an economically important virus of cucurbit crops in Argentina. The available information on genetic variability must be continuously updated. In this study, we assessed the molecular variability of WMV isolates in Argentina based on the partial sequences of the NIb-CP region and compared them with isolates previously reported from around the world. Forty-six WMV isolates were obtained from naturally infected cucurbit crops collected from 10 provinces between 2011 and 2018. At the molecular level, WMV isolates were grouped into three distinct major phylogenetic groups based on genetic distance. Majority of the Argentine isolates belonged to the emerging group (G3), whereas one isolate was included in G1 and another cluster in G2. G3 was further divided into 5 subgroups, named EM1, EM2, EM3, EM4, and a new group “EMArg”, composed exclusively of Argentine isolates with high bootstrap support and high level of significance. Tajima’s D and Fu were significantly negative for G3 and EMArg, indicating that the population of this subgroup has recently expanded. AMOVA analysis showed that the isolates was not well correlated with their geographic origin. The fixation index (FST) value between the WMV isolates from the different provinces in Argentina was lower than 0.33, indicating a relatively frequent gene flow between provinces. In every group, the predominant evolutionary pressure was negative with a mean dN/dS

Environmental heterogeneity can shape the plant-virus relationship, furthering the appearance of new diseases in crops, or altering disease incidence and severity. In this work, we studied the virus association with environmental heterogeneity taking into account bio-meteorological variables and virus distribution. In Argentina, three potyviruses, Watermelon mosaic virus (WMV), Zucchini yellow mosaic virus (ZYMV), and Papaya ringspot virus (PRSV), and a cucumovirus, Cucumber mosaic virus (CMV), are the most common viruses infecting cucurbits. We identified the bio-meteorological variables that had the greatest impact on disease incidence. All the crops were infected with more than one virus in all the studied environments. Molecular and serological analyses showed the highest relative incidence for WMV (46%), the lowest for CMV (9%), and intermediate values for PRSV and ZYMV (20% and 24%, respectively). Infected plants had a random distribution. Viruses and bio-meteorological variables were highly correlated, with high support (Pearson’s r = 0.96, P

Molecular characterization is important for differentiating allexiviruses species, since detection by serological methods may be uncertain. Eight different species have been reported as infecting garlic: Garlic virus A, B, C, D, E, X (GarV-A, B, C, D, E, X), Shallot virus X (ShVX) and Garlic mite-borne filamentous virus (GarMbFV), and the complete genome is known for six of these. This work reports for the first time the complete sequence of GarV-B and makes a phylogenetic and recombination analysis between the different allexivirus species. Total RNA was obtained of a GarV-B positive garlic plant by ISEM-D using anti-GarV-B antiserum and this was sent for mass sequencing. Deep sequencing revealed the first complete GarV-B genome, consisting of 8327 nucleotides (nt). The genome contained six open reading frames (ORFs) with the typical genome organization which encodes putative proteins of 168 kDa (ORF1), 27 kDa (ORF2), 12 kDa (ORF3), 39 kDa (ORF4), 27 kDa (ORF5) and 14 kDa (ORF6). The comparison of the gene coding for the coat protein of the virus showed a greater identity of nt with other isolates of GarV-B (88.4 to 99.7%) and of GarV-X (75.4 to 78.3%) published in GenBank. The GarV-B replicase gene has not been previously reported in GenBank, so the sequence was compared with GarV-A, -C, −D, −E, −X and ShVX. The highest nt identity values were detected with isolates of GarV-X (73.5 to 74.1%) and GarV-C (71.9 to 72.8%). These results suggest that GarV-X and GarV-B may be different strains of the same virus. A genetic recombination analysis was also performed between the complete sequences of allexiviruses published and obtained in this work and it was detected that the species GarV-D and GarV-E may have arisen from the recombination of the N-terminal portion of GarV-B with the C-terminal portion of GarV-A.

The incidence and prevalence of strawberry viruses were determined in surveys of randomly selected strawberry plants grown in different regions of Argentina. In 2009 and 2010, 1034 plants from 28 fields and 1060 plants from 33 fields, respectively, were collected from Lules and Coronda. The samples were analysed by double‐antibody sandwich enzyme‐linked immunosorbent assay to detect Strawberry mild yellow edge virus (SMYEV). In 2014, 606 plants from 43 fields in Lules, Coronda and Mar del Plata were analysed by reverse transcription polymerase chain reaction with primers specific for SMYEV, Strawberry crinkle virus (SCV), Strawberry mottle virus (SMoV) and Strawberry polerovirus 1 (SPV1). The SMYEV incidence was 4–35%, while prevalence was 60–100%, depending on the year and region sampled. Meanwhile, SMoV and SPV1 incidences were 8–17%, and prevalences were 46–62%, depending on the virus and region sampled. SCV was observed relatively low (incidence was 0.5–8% and prevalence was 8–50%), although it was more abundant in Mar del Plata than in the other analysed regions. Spearman's correlation analysis indicated that SCV and SMYEV were correlated with disease symptoms (P < 0.005). A principal component analysis revealed a close relationship between SMYEV and SCV in Mar del Plata, in which the lowest temperatures were recorded. Interactions among viruses, regions and climatic conditions will need to be studied in greater detail. Accurately determining the incidence and prevalence of viruses in different regions will improve estimations of possible damages or yield decreases caused by viral infections during strawberry production.

More than 50 viruses have been reported in cucurbit crops worldwide. In Argentina, cucurbit viruses have been associated with important yield losses. The most prevalent and widespread potyvirus is Watermelon mosaic virus (WMV). WMV was detected in Argentina in all cucurbit species with high incidence. In this study, a WMV isolate (WMV 1 SDE FF) was obtained from a naturally infected squash associated with a severe outbreak on melon and squash crops in an important cucurbit growing area in Santiago del Estero province (Argentina), during a survey conducted in November 2012. The fully sequenced WMV 1 SDE FF genome consists of 10,027 nucleotides and shares 96 % nt identity and 98 % aa identity with the French isolates JF273464.1|C07–014 and EU660581.1|FMF00-LL1 of the WMV molecular group 3. Using the recombination detection program RDP4, two statistically significant recombination events were identified: event 1, an 830-nt long recombinant fragment in the putative P1 coding region, and event 2, a 4071-nt recombinant fragment detected across the HC Pro, P3 and CI coding regions. The putative parental sequences detected for event 1 were the EU660586.1| FBR04–37 (major parent) and JF273468.1|C07–284 (minor parent), both from France. Putative parental sequences for event 2 were JX079685.1| WMV-ShanXi (major parent) and HQ384216.1|Dendrobium (minor parent), from China and USA, respectively. To our knowledge, this is the first complete genome of an Argentine WMV isolate. Our results provide evidence that WMV 1 SDE FF is the causal agent of the strong outbreak reported in melon and squash fields in recent years. Inst. Patología Vegetal Fil: Perotto, Maria Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Patología Vegetal; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina Fil: Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina Fil: Pozzi, Elizabeth Alicia. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Patología Vegetal; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina Fil: Luciani, Cecilia E. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Patología Vegetal; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina

Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de São Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. ?cayote?, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina. Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina. Instituto Nacional de Tecnologia Agropecuaria. Centro Regional Cordoba. Estacion Experimental Agropecuaria Marcos Juarez. Agencia de Extension Rural Bell Ville.; Argentina Fil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentina Fil: Giovani Celli, Marcos Giovani. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentina Fil: Conci, Vilma Cecilia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentina Fil: Perotto, Maria Cecilia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentina

A new potyvirus, tentatively named cucurbit vein banding virus (CVBV), was identified in crops of cucurbits in San Pedro (Buenos Aires, Argentina). The complete genome sequences of two isolates of CVBV were obtained by next-generation sequencing (Illumina). The genomic RNA consisted of 9968 and 9813 nucleotides, respectively, and displayed typical potyvirus organization. The percentage identity for these two genome sequences, using BLASTn, was 77% to sweet potato virus c and 73% to tomato necrotic stunt virus. BLASTx analysis of the complete polyprotein showed that the most closely related virus is plum pox virus, with 48% amino acid sequence identity for both isolates. Sequence comparisons and phylogenetic analyses indicate that CVBV belongs to a previously undescribed species in genus Potyvirus. Fil: Perotto, Maria Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina Fil: Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina Fil: Luciani, Cecilia Elizabeth. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina Fil: Mitidieri, Mariel Silvina. Instituto Nacional de Tecnología Agropecuaria. Centro Regional Buenos Aires Norte. Estación Experimental Agropecuaria San Pedro; Argentina Fil: Conci, Vilma Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Córdoba; Argentina. Instituto Nacional de Tecnología Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patología Vegetal; Argentina