Search

4. Haphsa sita (Distant, 1881) comb. n. Cosmopsaltria sita Distant, 1881: 636. Khimbya sita Distant, 1906: 141. Changa sita Lee, 2016: 596. Haphsa stellata Lee, 2009b: 335; Lee, 2016: 596. Distribution. China (Guangxi), India, Vietnam. Remarks. This species was formerly attributed to Changa as the type species by Lee (2016), and the same author synonymized H. stellata Lee, 2009 with Changa sita (Distant, 1881) (Lee, 2016). In the present paper, we remove it to Haphsa based on morphological characterization and phylogenetic analysis (Fig. 4). Lee (2016) also transferred H. jsguillotsi (Boulard, 2005) to Changa, but we confirm it is a member of Haphsa (see below). Accordingly, Changa Lee, 2016 syn. n. is synonymized with Haphsa., Published as part of Wang, Siyue, Peng, Xiaodong & Wei, Cong, 2021, A review of the cicada genus Haphsa Distant, 1905 with the description of one new species from China (Hemiptera: Cicadidae) and a phylogenetic analysis of Haphsa and its allies, pp. 523-538 in Zootaxa 4991 (3) on page 530, DOI: 10.11646/zootaxa.4991.3.5, http://zenodo.org/record/5042580, {"references":["Distant, W. L. (1881) Descriptions of new species belonging to the homopterous family Cicadidae. Transactions of the Royal Entomological Society of London, 1881, 627 - 648. https: // doi. org / 10.1111 / j. 1365 - 2311.1881. tb 00885. x","Distant, W. L. (1906) A synonymic catalogue of Homoptera. Part 1. Cicadidae. British Museum of Natural History, London, 207 pp. https: // doi. org / 10.1080 / 03745480509443637","Lee, Y. J. (2016) Erections of Changa gen. nov. and Songga gen. nov. of Aolina (Hemiptera: Cicadidae: Cicadinae: Dundubiini) with taxonomic notes and a synonymizatio. Zootaxa, 4084 (4), 596 - 600. https: // doi. org / 10.11646 / zootaxa. 4084.4.11","Lee, Y. J. (2009 b) Taxonomic notes on the genus Haphsa (Hemiptera: Cicadidae) with descriptions of two new species. Florida Entomologist, 92, 330 - 337. https: // doi. org / 10.1653 / 024.092.0218"]}

11. Haphsa karenensis (Ollenbach, 1929) Haphsa karenensis Ollenbach, 1929: 273; Wang, Yang & Wei, 2015: 419. Meimuna nauhkae Boulard, 2005b: 40. Distribution. China (Yunnan), Thailand., Published as part of Wang, Siyue, Peng, Xiaodong & Wei, Cong, 2021, A review of the cicada genus Haphsa Distant, 1905 with the description of one new species from China (Hemiptera: Cicadidae) and a phylogenetic analysis of Haphsa and its allies, pp. 523-538 in Zootaxa 4991 (3) on page 531, DOI: 10.11646/zootaxa.4991.3.5, http://zenodo.org/record/5042580, {"references":["Ollenbach, O. C. (1929) New species of Cicadidae and Fulgoridae from India and Burma. (Hemiptera). Indian Forest Records, Calcutta, 13 (6), 271 - 282.","Wang, X., Yang, M. S. & Wei, C. (2015) A review of the cicada genus Haphsa Distant from China (Hemiptera: Cicadidae) Zootaxa, 3957 (4), 408 - 424. https: // doi. org / 10.11646 / zootaxa. 3957.4.3","Boulard, M. (2005 b) Donnees statutaires et ethologiques sur des cigales thailandaises, incluant la description de huit especes nouvelles, ou mal connues. Ecole Pratique des Hautes Etudes, Travaux du Laboratoire Biologie et Evolution des Insectes Hemipteroidea, 15, 5 - 57."]}

5. Haphsa jsguillotsi (Boulard, 2005) comb. rev. Meimuna jsguillotsi Boulard, 2005a: 121. Haphsa jsguillotsi: Boulard, 2008: 32; Wang, Yang & Wei, 2015: 416. Changa jsguillotsi: Lee, 2016: 596. Material examined. 1♂ (NWAFU), China: Shuangjiang County, Yunnan Province 888 m, light trap, 29.v.1980, coll. Liu Fen; 1♂ (NWAFU), China: Mengla County, Xishuangbanna, Yunnan Province, 1050 m, 11.v.1958; 1♂ (NWAFU), China: Shuangjiang County, Yunnan Province, 888 m, light trap, 28.v.1980, coll. Liu Fen. Distribution. China (Yunnan), Thailand. Remarks. This is a small Haphsa species. It is similar to H. bindusara in the shape of uncus: uncal lobes short, bifurcated, fused at the base, but it can be distinguished from the latter by the body size and the shape of operculum. This species was original described by Boulard (2005) and attributed to Meimuna. Boulard (2008) transferred this species to Haphsa. Wang, Yang & Wei (2015) followed Boulard (2008) and redescribed this species. Lee (2016) transferred this species to Changa when he established this genus. In the present paper, we confirm it is a member of Haphsa based on morphology, therefore, Changa jsguillotsi (Boulard, 2005) is recovered to Haphsa.., Published as part of Wang, Siyue, Peng, Xiaodong & Wei, Cong, 2021, A review of the cicada genus Haphsa Distant, 1905 with the description of one new species from China (Hemiptera: Cicadidae) and a phylogenetic analysis of Haphsa and its allies, pp. 523-538 in Zootaxa 4991 (3) on page 530, DOI: 10.11646/zootaxa.4991.3.5, http://zenodo.org/record/5042580, {"references":["Boulard, M. (2005 a) Taxonomie et statut acoustique de huit cigales thailandaises, incluant cinq especes nouvelles [Rhynchota, Cicadoidea, Cicadidae]. Revue Francaise d'Entomologie, 27 (3), 117 - 143.","Boulard, M. (2008) Les cigales thaies. Liste actualisee incluant la description de deux nouveaux genres, de sept especes nouvelles et les Cartes d'identite Acoustique (CIA) de Chremistica siamensis Bregman et de Leptopsaltria samia (Walker) (Rhynchota, Cicadomorpha, Cicadidae). Ecole Pratique des hautes Etudes, Biologie et Evolution des Insectes Hemipteroidea, 18, 1 - 112.","Wang, X., Yang, M. S. & Wei, C. (2015) A review of the cicada genus Haphsa Distant from China (Hemiptera: Cicadidae) Zootaxa, 3957 (4), 408 - 424. https: // doi. org / 10.11646 / zootaxa. 3957.4.3","Lee, Y. J. (2016) Erections of Changa gen. nov. and Songga gen. nov. of Aolina (Hemiptera: Cicadidae: Cicadinae: Dundubiini) with taxonomic notes and a synonymizatio. Zootaxa, 4084 (4), 596 - 600. https: // doi. org / 10.11646 / zootaxa. 4084.4.11"]}

9. Haphsa dianensis Chou, Lei, Li, Lu & Yao, 1997 Haphsa dianensis Chou et al., 1997: 237; Wang, Yang & Wei, 2015: 422. Distribution. China (Yunnan), Vietnam.

Genus Haphsa Distant, 1905 Haphsa Distant, 1905: 64. Type species: Dundubia nicomache Walker, 1850. Aola Distant, 1905: 69. Type species: Pomponia bindusara Distant, 1881. Changa Lee, 2016: 596. syn. n. Type species: Cosmopsaltria sita Distant, 1881. Sinosemia Matsumura, 1927: 55. syn. n. Type species: Sinosemia shirakii Matsumura, 1927. Sinotympana Lee, 2009a: 87. syn. n. Type species: Sinotympana incomparabilis Lee, 2009. Diagnosis. Body medium-sized, head including eyes as wide as or slightly wider than mesonotum. Rostrum reaching or extending beyond posterior coxae. Pronotum slightly longer than head but shorter than mesonotum with pronotal collar dentate. Fore femur with primary and secondary spines large and subapical spine small. Wings hyaline, with 8 and 6 apical cells on fore wing and hind wing, respectively; fore wing with fuscous spots at bases of second and third apical cells. Male abdomen not swollen, slightly longer, shorter or equal to distance from head to cruciform elevation; timbal covers mostly concealing timbals dorsally; Male opercula with rounded angles. Uncal lobes short, fused at the base and bifurcated apically. Upper lobes of pygofer absent. Remarks. Haphsa is similar to Meimuna Distant, 1905, but it differs from the latter in the following characteristics: uncal lobes short, fused at the base and bifurcated apically (uncal lobes long, bifurcated in Meimuna); male abdomen slightly longer, shorter or equal to distance from head to cruciform elevation (male abdomen distinctly longer than distance from head to cruciform elevation in Meimuna)., Published as part of Wang, Siyue, Peng, Xiaodong & Wei, Cong, 2021, A review of the cicada genus Haphsa Distant, 1905 with the description of one new species from China (Hemiptera: Cicadidae) and a phylogenetic analysis of Haphsa and its allies, pp. 523-538 in Zootaxa 4991 (3) on page 525, DOI: 10.11646/zootaxa.4991.3.5, http://zenodo.org/record/5042580, {"references":["Distant, W. L. (1905) V. - Rhynchotal notes. - XXIX. Journal of Natural History, 15 (85), 58 - 70. https: // doi. org / 10.1080 / 03745480509443637","Walker, F. (1850) List of the specimens of homopterous insects in the collection of the British Museum. Order of the Trustees, London, 67 pp.","Distant, W. L. (1881) Descriptions of new species belonging to the homopterous family Cicadidae. Transactions of the Royal Entomological Society of London, 1881, 627 - 648. https: // doi. org / 10.1111 / j. 1365 - 2311.1881. tb 00885. x","Lee, Y. J. (2016) Erections of Changa gen. nov. and Songga gen. nov. of Aolina (Hemiptera: Cicadidae: Cicadinae: Dundubiini) with taxonomic notes and a synonymizatio. Zootaxa, 4084 (4), 596 - 600. https: // doi. org / 10.11646 / zootaxa. 4084.4.11","Matsumura, S. (1927) New species of Cicadidae from the Japanese Empire. Insecta Matsumurana. 2, 46 - 58.","Lee, Y. J. (2009 a) A new genus and a new species of Cicadidae (Insecta: Hemiptera) from China. Proceedings of the Biological Society of Washington, 122, 87 - 90. https: // doi. org / 10.2988 / 08 - 29.1"]}

14. Haphsa fratercula Distant, 1917 Haphsa fratercula Distant, 1917: 323; Lee 2008: 14; Lee 2009b: 330, 331; Pham & Yang 2009: 14, 16. Distribution. Vietnam., Published as part of Wang, Siyue, Peng, Xiaodong & Wei, Cong, 2021, A review of the cicada genus Haphsa Distant, 1905 with the description of one new species from China (Hemiptera: Cicadidae) and a phylogenetic analysis of Haphsa and its allies, pp. 523-538 in Zootaxa 4991 (3) on page 531, DOI: 10.11646/zootaxa.4991.3.5, http://zenodo.org/record/5042580, {"references":["Distant, W. L. (1917) The Homoptera of Indo-China. Annals and Magazine of Natural History, 20, 319 - 325. https: // doi. org / 10.1080 / 00222931709487014","Lee, Y. J. (2008) A checklist of Cicadidae (Insecta: Hemiptera) from Vietnam, with some taxonomic remarks. Zootaxa, 1787 (1), 1 - 27. https: // doi. org / 10.11646 / zootaxa. 1787.1.1","Lee, Y. J. (2009 b) Taxonomic notes on the genus Haphsa (Hemiptera: Cicadidae) with descriptions of two new species. Florida Entomologist, 92, 330 - 337. https: // doi. org / 10.1653 / 024.092.0218","Pham, H. T. & Yang, J. T. (2009) A contribution to the Cicadidae fauna of Vietnam (Hemiptera, Auchenorrhyncha), with one new species and twenty new records. Zootaxa, 2249 (1), 1 - 19. https: // doi. org / 10.11646 / zootaxa. 2249.1.1"]}

10. Haphsa durga (Distant, 1881) Cosmopsaltria durga Distant, 1881: 637. Meimuna durga Distant, 1906: 109; Chou et al., 1997: 244. Haphsa durga Lee, 2009b: 330. Dundubia durga Sanborn, 2013a: 249. Distribution. China (Yunnan, Guangdong, Fujian), India, Thailand, Laos, Vietnam., Published as part of Wang, Siyue, Peng, Xiaodong & Wei, Cong, 2021, A review of the cicada genus Haphsa Distant, 1905 with the description of one new species from China (Hemiptera: Cicadidae) and a phylogenetic analysis of Haphsa and its allies, pp. 523-538 in Zootaxa 4991 (3) on page 531, DOI: 10.11646/zootaxa.4991.3.5, http://zenodo.org/record/5042580, {"references":["Distant, W. L. (1881) Descriptions of new species belonging to the homopterous family Cicadidae. Transactions of the Royal Entomological Society of London, 1881, 627 - 648. https: // doi. org / 10.1111 / j. 1365 - 2311.1881. tb 00885. x","Distant, W. L. (1906) A synonymic catalogue of Homoptera. Part 1. Cicadidae. British Museum of Natural History, London, 207 pp. https: // doi. org / 10.1080 / 03745480509443637","Chou, I., Lei, Z., Li, L., Lu, X. & Yao, W. (1997) The Cicadidae of China (Homoptera: Cicadoidea). Tianze Eldoneio, Hong Kong, 380 pp. [in Chinese, English summary]","Lee, Y. J. (2009 b) Taxonomic notes on the genus Haphsa (Hemiptera: Cicadidae) with descriptions of two new species. Florida Entomologist, 92, 330 - 337. https: // doi. org / 10.1653 / 024.092.0218","Sanborn, A. F. (2013 a) Catalogue of the Cicadoidea (Hemiptera: Auchenorrhyncha). Academic Press, San Diego, 1002 pp. https: // doi. org / 10.1016 / B 978 - 0 - 12 - 416647 - 9.00001 - 2"]}

17. Haphsa opercularis Distant, 1917 Haphsa opercularis Distant, 1917: 323. Distribution. China (Yunnan), Vietnam., Published as part of Wang, Siyue, Peng, Xiaodong & Wei, Cong, 2021, A review of the cicada genus Haphsa Distant, 1905 with the description of one new species from China (Hemiptera: Cicadidae) and a phylogenetic analysis of Haphsa and its allies, pp. 523-538 in Zootaxa 4991 (3) on page 532, DOI: 10.11646/zootaxa.4991.3.5, http://zenodo.org/record/5042580, {"references":["Distant, W. L. (1917) The Homoptera of Indo-China. Annals and Magazine of Natural History, 20, 319 - 325. https: // doi. org / 10.1080 / 00222931709487014"]}

12. Haphsa lueta Wang, Yang & Wei, 2015 Haphsa lueta Wang, Yang & Wei, 2015: 410. Distribution. China (Hainan).

8. Haphsa apicoinfuscata Sanborn, 2013 Haphsa apicoinfuscata Sanborn, 2013b: 257; Wang, Yang & Wei, 2015: 413. Distribution. China (Hainan, Yunnan), Vietnam., Published as part of Wang, Siyue, Peng, Xiaodong & Wei, Cong, 2021, A review of the cicada genus Haphsa Distant, 1905 with the description of one new species from China (Hemiptera: Cicadidae) and a phylogenetic analysis of Haphsa and its allies, pp. 523-538 in Zootaxa 4991 (3) on page 531, DOI: 10.11646/zootaxa.4991.3.5, http://zenodo.org/record/5042580, {"references":["Sanborn, A. F. (2013 b) A new species of Haphsa Distant, 1905 from Vietnam (Insecta: Hemiptera: Cicadoidea: Cicadidae). Vernate, 32, 257 - 262.","Wang, X., Yang, M. S. & Wei, C. (2015) A review of the cicada genus Haphsa Distant from China (Hemiptera: Cicadidae) Zootaxa, 3957 (4), 408 - 424. https: // doi. org / 10.11646 / zootaxa. 3957.4.3"]}

6. Haphsa incomparabilis (Lee, 2009) comb. n. Sinotympana incomparabilis Lee, 2009a: 87. Distribution. China (Guangdong), Vietnam. Remarks. This species was formerly attributed to Sinotympana as the type species by Lee (2009a). In the present paper, we remove it to Haphsa based on morphological characterization and phylogenetic analysis (Fig. 4). Accordingly, Sinotympana Lee, 2009 syn. n. is synonymized with Haphsa., Published as part of Wang, Siyue, Peng, Xiaodong & Wei, Cong, 2021, A review of the cicada genus Haphsa Distant, 1905 with the description of one new species from China (Hemiptera: Cicadidae) and a phylogenetic analysis of Haphsa and its allies, pp. 523-538 in Zootaxa 4991 (3) on page 530, DOI: 10.11646/zootaxa.4991.3.5, http://zenodo.org/record/5042580, {"references":["Lee, Y. J. (2009 a) A new genus and a new species of Cicadidae (Insecta: Hemiptera) from China. Proceedings of the Biological Society of Washington, 122, 87 - 90. https: // doi. org / 10.2988 / 08 - 29.1"]}

16. Haphsa nicomache (Walker, 1850) Dundubia nicomache Walker, 1850: 67. Cicada delineata Walker, 1858: 17. Cosmopsaltria nicomache Distant, 1891: 57. Haphsa nicomache Distant, 1905: 64. Distribution. Pakistan, India., Published as part of Wang, Siyue, Peng, Xiaodong & Wei, Cong, 2021, A review of the cicada genus Haphsa Distant, 1905 with the description of one new species from China (Hemiptera: Cicadidae) and a phylogenetic analysis of Haphsa and its allies, pp. 523-538 in Zootaxa 4991 (3) on page 532, DOI: 10.11646/zootaxa.4991.3.5, http://zenodo.org/record/5042580, {"references":["Walker, F. (1850) List of the specimens of homopterous insects in the collection of the British Museum. Order of the Trustees, London, 67 pp.","Walker, F. (1858) Supplement. List of the specimens of homopterous insects in the collection of the British Museum. Order of Trustees, London, pp. 17.","Distant, W. L (1891) s. n. In: A monograph of Oriental Cicadidae. West, Newman & Co.; R. Friedlander & Sohn. London and Berlin, pp. 49 - 96.","Distant, W. L. (1905) V. - Rhynchotal notes. - XXIX. Journal of Natural History, 15 (85), 58 - 70. https: // doi. org / 10.1080 / 03745480509443637"]}

13. Haphsa conformis Distant, 1917 Haphsa conformis Distant, 1917: 322; Lee 2008: 14; Lee 2009b: 330, 331; Pham & Yang 2009: 14, 16. Distribution. Vietnam., Published as part of Wang, Siyue, Peng, Xiaodong & Wei, Cong, 2021, A review of the cicada genus Haphsa Distant, 1905 with the description of one new species from China (Hemiptera: Cicadidae) and a phylogenetic analysis of Haphsa and its allies, pp. 523-538 in Zootaxa 4991 (3) on page 531, DOI: 10.11646/zootaxa.4991.3.5, http://zenodo.org/record/5042580, {"references":["Distant, W. L. (1917) The Homoptera of Indo-China. Annals and Magazine of Natural History, 20, 319 - 325. https: // doi. org / 10.1080 / 00222931709487014","Lee, Y. J. (2008) A checklist of Cicadidae (Insecta: Hemiptera) from Vietnam, with some taxonomic remarks. Zootaxa, 1787 (1), 1 - 27. https: // doi. org / 10.11646 / zootaxa. 1787.1.1","Lee, Y. J. (2009 b) Taxonomic notes on the genus Haphsa (Hemiptera: Cicadidae) with descriptions of two new species. Florida Entomologist, 92, 330 - 337. https: // doi. org / 10.1653 / 024.092.0218","Pham, H. T. & Yang, J. T. (2009) A contribution to the Cicadidae fauna of Vietnam (Hemiptera, Auchenorrhyncha), with one new species and twenty new records. Zootaxa, 2249 (1), 1 - 19. https: // doi. org / 10.11646 / zootaxa. 2249.1.1"]}

Maua squeala sp. nov. (Figs. 1���2) Type material. Holotype: ♂ (NWAFU), China: Jiufeng Mountain, Nanping City, Fujian Province, 07.VIII.2020, coll. Xiaohan Yu. Paratypes: 14♂♂ 1♀ (NWAFU), China: Jiufeng Mountain, Nanping City, Fujian Province, 07.VIII.2020, coll. Xiaohan Yu; 1♂ (NWAFU), China: Damao Mountain, Dexing City, Jiangxi Province, China, collector unknown. Measurements (in mm; 12♂♂, 1♀). Body length: ♂ 33.4���36.3, ♀ 27.8; fore wing length: ♂ 39.5���42.3, ♀ 37.2; fore wing width: ♂ 14.0���14.9, ♀ 11.5; width of head including eyes: ♂ 9.4���10.5, ♀ 9.8; pronotum width (including pronotal collar): ♂ 11.3���12.3, ♀ 11.8; mesonotum width: ♂ 8.9���10.6, ♀ 9.7. Etymology. The species name is the Latin adjective meaning ���squeal��� in reference to the distinctive calling song. Description of male. Head (Fig. 1A���D) mostly ochraceous, almost equal to width of mesonotum. Eyes blackish fuscous; ocelli yellowish brown, enclosed by blackish ochraceous fascia. Postclypeus protruding, with two longitudinal, blackish ochraceous fasciae medially, which are connected with alternate transverse, blackish ochraceous grooves and white stripes on each side. Basal area of anteclypeus with pair of longitudinal, blackish ochraceous patches. Lorum with corner black. Rostrum reaching almost posterior margin of sternite 3; apex dark ochraceous. Thorax (Fig. 1A���D). Pronotum ochraceous, longer than head; paired central fasciae blackish ochraceous, widened apically, with corresponding apexes connected with each other; pronotal collar generally ochraceous, anterior margin symmetrically with several blackish ochraceous markings anteriorly, lateral margin with small tooth. Mesonotum ochraceous, usually with five blackish ochraceous fasciae: median fascia very long and straight, extending from anterior margin of mesonotum to cruciform elevation; oblique paramedian fasciae long, extending from anterior margin of mesonotum to about half-length of mesonotum, widened posteriorly; one or several irregular spots laterad to paramedian fascia. Cruciform elevation ochraceous with dark markings on anterior angles. Golden pile in depressions and along lateral mesonotum. Legs (Fig. 1A���B). Mostly yellowish brown. Fore femur with dorsal side and apex of ventral side blackish ochraceous; three spines dark ochraceous: primary spine long and slender, secondary spine somewhat shorter and broader, subapical spine small. Fore tibia with dark brown fasciae on ventral surface. Tarsi of fore and middle legs brown, hind tarsi ochraceous, claws brown. Wings (Fig. 1A���D). Hyaline. Fore wing with distinct dark brown spots on transverse veins at bases of second and third apical cells; transverse veins at bases of fifth and seventh apical cells usually with small brown spots. Apices of longitudinal veins of apical cells with small brown spots. Basal membrane of fore wing and hind wing jugum tinged with light-brown. Abdomen (Fig. 1A���D). Mostly ochraceous with silvery to golden pubescence; longer than head and thorax together, widest across abdominal segment 3 or 4, which is slightly wider than pronotal collar. Tergites VII���VIII dark brown, with posterior margins of tergites II���VI with black markings. Timbal covers ochraceous. Opercula generally ochraceous with margin blackish ochraceous, triangular in shape, separated from each other at base, with apex broadly rounded, reaching or slightly exceeding posterior margin of abdominal sternite II. Abdominal sternites mostly ochraceous with median part blackish ochraceous. Sternites III and IV with paired nipple-like tubercles: tubercles of sternite III yellowish; tubercles of sternite IV glossy brown. Epipleurites with laterodistal corner blackish ochraceous. Male genitalia (Fig. 1E���G). Pygofer ochraceous, nearly elliptical. Uncus triangular with inwardly curved base and somewhat straight lateral margins in ventral view. Dorsal beak small. Distal shoulder broad and rounded in lateral view. Upper lobes of pygofer absent. Basal lobes of pygofer straight, placed laterally adjacent to side of pygofer. Description of female (Fig. 2A���D). Forebody identical to that of male. Opercula small, ochraceous to brownish, somewhat wider than long, exceeding posterior margin of abdominal sternite II. Abdomen noticeably shorter than male. Ovipositor sheath dark ochraceous, protruding beyond segment 9. Posterior margin of sternite VII incised at middle. Distribution. China (Fujian, Jiangxi, Duangdong). Habitat. The microhabitat of this new species is always close to rivers in the subtropical evergreen broad-leaved forests, with an elevation of ~ 150��� 350 m. Individuals were observed sitting and singing on trunks and branches of high trees, with the perching sites of different heights. Remarks. Variations of M. squeala sp. nov. mainly occurs on the lateral fasciae on mesonotum and spots of the fore wings. Individuals that possess only one distinct blackish ochraceous spot laterad the paramedian fascia usually have spots on transverse veins at bases of fifth and seventh apical cells (Fig. 1A), but individuals that possess several distinct irregular blackish ochraceous spots laterad the paramedian fascia usually have no spot on transverse veins at bases of fifth and seventh apical cells (Fig. 1C). This new species was misidentified to be M. affinis by Chou et al. (1997) based on two male specimens they examined, but the new species can be distinguished from M. affinis by the following characteristics: mesonotum has either one or several distinct irregular blackish ochraceous spots laterad to the paramedian fascia (lateral fasciae are linear in M. affinis); abdomen broad, segment 3 is slightly wider than pronotal collar (abdomen wider, segment 3 is distinctly wider than pronotal collar in M. affinis); posterior margins of tergites II���VI with blackish bands (tergite II with black band of variable width along about two thirds of posterior margin, posterior margins of tergites III���VI brown in M. affinis); basal lobe of pygofer straight (basal lobe of pygofer with slightly sinuate ridges in M. affinis); uncus triangular (uncus trapezoidal in M. affinis). This new species is similar to M. palawanensis, but differs from the latter in the shorter and slender body of males (body length of males of M. palawanensis is ~ 39 mm) and in the lateral fasciae on mesonotum in male (lateral fasciae on mesonotum of M. palawanensis males are not broken up). This new species is also similar to M. albigutta with respect to the configuration of the male abdomen, but it can be distinguished from the latter species by the larger body size (body length of males of M. albigutta less than 30 mm) and the small brown spots on apices of longitudinal veins of all apical cells (apices of longitudinal veins of apical cells 1���4 with small brown spots in M. albigutta)., Published as part of Wang, Jiali, Duffels, Joannes P. & Wei, Cong, 2021, Description of a new species of the genus Maua Distant (Hemiptera, Cicadidae) from China, pp. 582-588 in Zootaxa 4949 (3) on pages 583-584, DOI: 10.11646/zootaxa.4949.3.8, http://zenodo.org/record/4640935, {"references":["Chou, I., Lei, Z., Li, L., Lu, X. & Yao, W. (1997) The Cicadidae of China (Homoptera: Cicadoidea). Tianze Eldoneio, Hong Kong, 385 pp."]}

Genus Maua Distant, 1905 Maua Distant, 1905: 61; Moulton, 1923: 124; Metcalf, 1963: 491; Duffels & van der Laan, 1985: 113; Moulds, 2005: 391; Duffels, 2009: 303. Type species: Cicada quadrituberculata Signoret, 1847, Published as part of Wang, Jiali, Duffels, Joannes P. & Wei, Cong, 2021, Description of a new species of the genus Maua Distant (Hemiptera, Cicadidae) from China, pp. 582-588 in Zootaxa 4949 (3) on page 583, DOI: 10.11646/zootaxa.4949.3.8, http://zenodo.org/record/4640935, {"references":["Distant, W. L. (1905) Rhynchotal notes - XXIX. Annals and Magazine of natural History, 7 (15), 58 - 70. https: // doi. org / 10.1080 / 03745480509443637","Moulton, J. C. (1923) Cicadas of Malaysia. Journal of the Federated Malay States Museums, 11, 69 - 182.","Metcalf, Z. P. (1963) General catalogue of the Homoptera. Fascicle VIII. Cicadoidea. Part 1. Cicadidae. Section I. Tibiceninae. Paper No. 1502. North Carolina State College, Raleigh, 585 pp.","Moulds, M. S. (2005) An appraisal of the higher classification of cicadas (Hemiptera: Cicadoidea) with special reference to the Australian fauna. Records of the Australian Museum, 57, 375 - 446. https: // doi. org / 10.3853 / j. 0067 - 1975.57.2005.1447","Duffels, J. P. (2009) A revision of the cicadas of the genus Maua Distant (Hemiptera, Cicadidae) from Sundaland. Tijdschrift Voor Entomologie, 152 (2), 303 - 332. https: // doi. org / 10.1163 / 22119434 - 900000282"]}

Versicolora gen. nov. Type species. Versicolora ziyongi sp. nov., by present designation. Etymology. The generic name is derived from the beautiful body colour of species of this genus. The gender is feminine. Diagnosis. Head including eyes narrower than base of mesonotum; distance between lateral ocellus and corresponding eye slightly wider than distance between lateral ocelli. Postclypeus moderately prominent. Pronotum distinctly shorter than mesonotum excluding cruciform elevation; pronotal collar narrow, (much) ampliate caudolaterally, but not dentate laterally. Wings hyaline, nodal line obvious, tinted with distinct green markings at bases of apical cells, with 8 and 6 apical cells on forewing and hind wing, respectively. Male abdomen distinctly longer than distance from head to cruciform elevation; timbal mostly concealed by timbal cover; male operculum short, just extending beyond posterior margin of sternite II; abdominal sternite III with a pair of tubercle-like projections. Pygofer with dorsal beak and an apical spine on distal shoulder; basal lobes of pygofer absent; upper lobes of pygofer very short but distint, curved inward. Uncus with apex of median uncus lobe bifurcated; lateral uncus lobes large, semicircular; aedeagus thick, tube-like in shape. Remarks. This new genus appears closely allied to Tanna Distant of Leptopsaltriini, but differs in having a bifurcated (apex of) uncus and a short but distinct dorsal beak of pygofer., Published as part of Wei, Cong, Wang, Siyue, Hayashi, Masami, He, Miao & Pham, Hong Thai, 2020, New genus and species of Leptopsaltriini (Hemiptera: Cicadidae: Cicadinae) from China and Vietnam, with colour-changing behaviour reported for the first time in Cicadoidea, pp. 277-286 in Zootaxa 4759 (2) on page 278, DOI: 10.11646/zootaxa.4759.2.10, http://zenodo.org/record/3737507

Versicolora bellula sp. nov. (Figs. 4–7) Type material. Holotype: ♂ (NWAFU), China: Luchun County, Yunnan Prov., 21.VII.2015, coll. Hong Yang. Paratypes: 1♂ (NWAFU), China: Luchun County, Yunnan Prov., 20–22.IX.2015, coll. Kaige Xu; 1♀ (NWAFU), China: Pingbian County, Yunnan Prov., 13–14.VIII.2015, coll. Yin Wang; 1♂ (NSMT), Vietnam: Mt. Phan Si Pang (1840–1920 m), Hoang Lien Son Mts., Sapa, Lao Cai Prov., 9.X.1994, S. Uéno leg.; 1♂ (VNMN), Vietnam: Cao Bang Prov., Phia Oac Moutain, 10.VIII.2012, T. H. Pham leg.; 1♂ (RMNH), NW Vietnam: Hoang Lien N. R., 15 km W Sa Pa (1500 m), 15–18.X.1999 (in mist-nets), R. Dekker (leg.); 1♂ (RMNH), Vietnam: Lao Cai Prov., 5 km SSW of Sapa, nr. Cat-Cat (1400–1600 m), 23–29.X.1999, R. de Jong; 1♂ (RMNH), Vietnam (Lao Cai), Hoang Lien Son, Phan Si Pang, NW slopes near Sin Chai (2,100 m), 16.IX.2003, C. vd Berg & E. J. v. Nieukerken; 1♀ (RMNH), same locality except 8 km NW Sapa (1650 m), 22.IX.2003, same collectors; 1♂ (RMNH), Vietnam (Lao Cai), Sapa, in town, X.2001, 1500m, collector E. J. v. Nieukerken & J. C. Koster; 1♀ (RMNH), Vietnam (Lao Cai) Hoang Lien Son, Phan Si Pang (Fansipan) NW slopes near Sin Chai; Tourist camp, RMNH /EVN no: 2003060; RMNH 2003-1041, 16.IX.2003, at light, primary mountain broadleaved evergreen forest, 2100m, collector C. vd Berg & E. J. v. Nieukerken. Measurements (in mm; n = 8♂♂, 3♀♀). Body length: ♂ 33.4–37.9, ♀ 29.3–29.8; forewing length: ♂ 41.2–45.1, ♀ 44.4–45.2; width of forewing: ♂ 14.9–16.0, ♀ 15.0–16.1; width of head including eyes: ♂ 8.2–8.8, ♀ 8.6–8.9; pro- notum width (including pronotal collar): ♂ 12.7–13.9, ♀ 13.4–14.3; mesonotum width: ♂ 10.2–11.9, ♀ 11.4–11.5. Etymology. The species is named for the colorful markings on the thorax and forewings. Description of male. Head (Figs 4 A–D, 6A–C, F, G). Green with large median black spot enclosing ocelli; black markings along frontoclypeal suture and posterior margin of head. Eyes dark brown, ocelli light brown to dark brown. Postclypeus pale or yellowish green, with series of black transverse fasciae. Anteclypeus yellowish-green. Rostrum yellow to brown, with black apex extending beyond hind coxae. Genae pale green or yellowish-brown, with dense, long silvery hairs. Thorax (Figs. 4 A–D, 6A–C, F, G). Pronotum almost yellowish-green, with pair of central black fasciae, extending from anterior margin nearly to posterior margin of pronotum; irregular brown spots near lateral fissures and paramedian fissures of pronotum; pronotal collar yellowish-green, posterior margin slightly rippled. Mesonotum mostly green, covered with golden hair and with curved black fascia surrounding each submedian sigilla and (sometimes) with black spot in each lateral sigilla. Cruciform elevation yellowish brown to green, with black spot along each anterior arm. Legs (Fig. 4B, D, H). Mostly green with brown patches. Fore femur with only two spines, primary spine long and oblique; secondary spine short, triangular with rounded apex, extending subparallel to the femur (lying nearly horizontal). Wings (Figs 4 A–B, 6A–C, F, G). Hyaline. Forewing with distinct brown markings at each junction of apical cells and a marginal series of brown infuscations near apices of longitudinal veins in apical cells 2–5 and 7; a series of small stripes in marginal area. Abdomen (Figs 4 A–E, 6A–C, F, G). Cylindrical or barrel-shaped, about as long as head and thorax together, testaceous brown with irregular black markings on each tergite. Timbal covers brown and rounded. Opercula yellowish-green to yellowish brown, apart from each other, with rounded apex just extending beyond posterior margin of sternite II. Abdominal sternites mostly brown with pair of black markings on sternites IV–V laterally; sternite III with paired tubercle-like processes on centrolateral surface, distinctly longer than or as long as wide with rounded apices. Genitalia (Figs 4F, G, 7 A–D). Pygofer elliptical in ventral view. Dorsal beak of pygofer slightly developed, nearly triangular. Uncus not so curved inward toward apex and not widened apically, with apex bifurcated (triangularly notched at middle). Aedeagus thick, ventral part distinctly (triangularly) concave near apex, with triangularly to spiny expansion before (just basal from) the concavity in lateral view. Description of female (Figs 5 A–D, 6D, E). Opercula smaller, yellowish green. Abdominal segment VII with posterior margin triangularly incised at middle. Abdominal segment IX yellow with black markings. Ovipositor sheath protruding somewhat beyond abdominal segment IX (pygofer). Other characteristics similar to male. Distribution. China (Yunnan), Vietnam (Lao Cai, Cao Bang). Remarks. This new species is similar to V. ziyongi sp. nov., but can be distinguished by the markings on thorax and forewings, the shape of spines on fore femur, and also the shape of uncus and aedeagus.

Versicolora ziyongi sp. nov. (Figs 1–3) Type material. Holotype: ♂ (NWAFU), China: Mt. Jiulian, Lianping County, Heyuan City, Guangdong Prov., 5.V.2016, coll. Cong Wei. Paratypes: 1♂, 6♀♀ (NWAFU), same data as holotype except for coll. Cong Wei and Hong He; 2♂♂, 5♀♀ (NWAFU), same locality as holotype, 3.V.2017, coll. Cong Wei and Yunxiang Liu; 1♂ (ELKU), China: Nanling, Shaoguan, Guandong Prov., 24.IV.2005, T. Tano leg. Measurements (in mm; n = 5♂♂, 11♀♀). Body length: ♂ 32.5–38.4, ♀ 25.3–30.0; forewing length: ♂ 40.9– 45.3, ♀ 43.5–46.5; width of forewing: ♂ 13.4–15.0, ♀ 13.5–14.8; width of head including eyes: ♂ 8.3–8.8, ♀ 8.2–9.1; pronotum width (including pronotal collar): ♂ 11.8–13.6, ♀ 12.2–13.7; mesonotum width: ♂ 9.7–10.1, ♀ 9.7–11.3. Etymology. The specific name is after Ziyong Shi (in Chinese, Ɓṉẘ), the discoverer of this new species. Description of male. Head (Fig. 1 A–D). Mostly green, with black markings along frontoclypeal suture and posterior margin of head and a large median black spot enclosing ocelli. Eyes greyish-green, with dense golden hair along posterior margin; ocelli red. Postclypeus green, with series of black transverse fasciae. Anteclypeus green, with small black patches laterally. Rostrum yellow, with black apex extending to hind coxae. Genae yellowish-green, with dense, long silvery hairs. Thorax (Fig. 1A, C). Pronotum almost green, with pair of central black fasciae extending from anterior margin to posterior end and irregular black spots near lateral fissures and paramedian fissures; pronotal collar reddish brown, with pair of black spots on posterolateral area, posterior margin rippled. Mesonotum mostly green, covered with silvery hair; with curved black fascia surrounding each submedian sigilla and longitudinal black fascia along each lateral sigilla. Cruciform elevation reddish brown, with black spots centrally. Legs (Fig. 1D, H). Yellow to green with black patches. Fore femur with only two spines: primary spine long and erect; secondary spine triangular with acute tip, obliquely extending. Wings (Fig. 1A, B). Hyaline, tinged with light blue particularly on basal half. Forewing with distinct tawny markings at bases of apical cells 1–5 and 7 and a marginal series of triangular tawny markings near apices of longitudinal veins in apical cells; costal margin bright green in living individuals with a series of dark brown obscure spots; veins M and CuA with alternating white and dark brown bands, which are particularly distinct in living specimens (Suppl. Fig. 1). Hind wing with indistinct markings at bases of apical cells 1 and 2. Abdomen (Fig. 1 A–E). Cylindrical, longer than head and thorax together, brown with irregular black markings on each tergite. Timbal covers brown, rounded apically. Opercula greyish-green, apart from each other, with rounded apex just extending beyond posterior margin of sternite II. Abdominal sternites mostly brown, with pair of indistinct black triangular markings on sternites IV–VI laterally. Paired tubercle-like processes on centrolateral surface of sternite III distinctly longer than wide. Genitalia (Fig. 1F, G). Pygofer elliptical in ventral view. Dorsal beak of pygofer well developed, broadly triangular in lateral view. Median uncus lobe short (variable in relative length), somewhat widened apically, curved ventrally, with apex bifurcated (triangularly incised at middle). Aedeagus thick, ventral margin smooth but with an acute spine at mid-ventral apex. Description of female (Fig. 2 A–D). Opercula smaller than in males, mostly brown with green laterally. Abdominal sternite VII with posterior margin roundly incised at middle. Abdominal segment IX yellow with black markings in lateral view. Ovipositor sheath not protruding beyond abdominal segment IX (pygofer). Dorsal beak pointed, very slightly longer than anal styles. Other characteristics similar to male. Description of exuvia (Fig. 3 A–G). Yellowish-brown, head and abdomen curved ventrally in lateral view, with sparse setae mainly on venter. Legs generally yellowish brown, tinged with black on apex of fore femur and tibia. Fore femoral comb with seven teeth, posterior tooth long and sharp, accessory tooth short with apex somewhat blunt, intermediate tooth robust, not apart from femoral comb. Fore tibia slightly arched, with apical tooth pointed; point of blade of tibia very small (Fig. 3E). Mid and hind legs with tibia with five apical spines respectively; fore tarsi well developed into a pair of claws of unequal sizes (Fig. 3 F–G). Forewing bud developed, reaching to middle of 4 th abdominal segment laterally; hind wing bud slightly developed (Fig. 3B). Abdomen oval, yellowish-brown, but in emerging adults with tergites II–IV dark brown (Fig. 3C, D). Distribution. China (Guangdong). Remarks. This new species can be distinguished in that the aedeagus is not concave near apex but with an apical spine on the mid-ventral margin of apex in lateral view. Remarkably, this new species is very unique, because living individuals, besides camouflaging themselves on the bark of the host-plant Castanopsis fordii Hance (Fagaceae), can change their body colour, particularly the light colour on lateral parts of abdomen and the proximal part of forewings in female, gradually from greenish brown to yellowish brown when captured. The changed colour can gradually return back to normal in several minutes when the disturbance stopped (Suppl. Fig. 1, Suppl. Video 1). It is the first and only known species that exhibits colourchanging behaviour in Cicadoidea to our knowledge. This provides innovative information for ecomorphological study of this remarkable species and other cicadas that potentially exhibit this behaviour.

Genus Emathia Stål, 1866 Emathia Stål, 1866: 8. Type species: Emathia aegrota Stål, 1866. Cicadalna Boulard, 2006: 529. syn. n. Type species: Cicadalna takensis Boulard, 2006. Diagnosis. Head about as long as pronotum, including eyes about as wide as base of mesonotum. Rostrum almost reaching the posterior coxae. Pronotum a little shorter than mesonotum, with barely developed lateral margin, not amplified. Abdomen short, about as long as forebody. Timbal covers incomplete, narrow and exposed inwardly; male opercula small, not extending beyond posterior margin of abdominal sternite II. Wings hyaline, with 8 and 6 apical cells on fore wing and hind wing, respectively. Remarks. The genus Cicadalna was erected by Boulard (2006) for the type species, Cicadalna takensis. Later, the same authour reviewed Cicadalna and placed it in the tribe Cicadini of the subfamily Cicadinae (Boulard 2013). However, the incomplete timbal covers, small opercula, shape of male genitalia and wing venation are inseparable between Cicadalna from Emathia, and no other sound morphological characters are available to separate these two genera. Accordingly, Cicadalna is treated here as a junior synonym of Emathia., Published as part of Wang, Xu, He, Zhiqiang & Wei, Cong, 2017, A new species of Cicadatra Kolenati, 1857 from China, with primary phylogenetic analyses of the tribe Cicadatrini (Hemiptera: Cicadidae), pp. 174-184 in Zootaxa 4242 (1) on page 179, DOI: 10.11646/zootaxa.4242.1.9, http://zenodo.org/record/376078, {"references":["Boulard, M. (2006) Cicadalna takensi s, nouvelle espece d'un genre nouveau decouverte en Thailande du Nord (Rhynchota, Cicadidae). Bulletin de la Societe entomologique de France, 111 (4), 529 - 534.","Boulard, M. (2013) The Cicadas of Thailand. Uol. 2. Taxonomy and Sonic Ethology. Siri Scientific Press, Manchester, 436 pp."]}

Psalmocharias akesensis sp. nov. Figs 1���3 Type material. Holotype: ♂ (NWAFU), China: Wensu County, Akesu City, Xinjiang Uygur Autonomous Region, 17.V.2016, coll. Tiansheng Zhu & Ping Zhang. Paratypes: 37♂♂, 11♀ (NWAFU), same data as the holotype. Measurements of types (16♂♂, 5♀; in mm). Body length: ♂ 23.1���26.4, ♀ 23.5���25.8; fore wing length: ♂ 25.0���29.7, ♀ 25.7���28.9; fore wing width: ♂ 10.2���11.6, ♀ 10.9���11.8; ♂ width of head including eyes: ♂ 6.0���7.2, ♀ 6.8���7.5; pronotum width (including pronotal collar): ♂ 8.3���10.3, ♀ 10.4���11.4; mesonotum width: ♂ 6.8���8.0, ♀ 8.1���8.5; expanse of forewings: ♂ 54.9���64.0; ♀ 58.5���63.3. Etymology. The species name is derived from the type locality. Description of male. Head (Fig. 1 A���C) narrower than mesonotum. Generally black with longitudinal central yellow fascia and two pairs of irregularly shaped yellow fasciae on posterior margins of head. Eyes dark brown, ocelli red. Supra-antennal plates yellow. Postclypeus black, with series of transverse fasciae yellow. Anteclypeus black. Rostrum yellow, with black apex extending to mid trochanter. Genae yellow, with dense, long silvery hairs. Distance between lateral ocellus and corresponding eye about as long as distance between lateral ocelli. Thorax (Fig. 1 A���C). Pronotum yellow, distinctly longer than head; inner area mostly yellow, with black longitudinal fasciae on either side of midline which are dilated anteriorly; two small posterior median fused black spots anterior to pronotal collar. Fissures light brown. Pronotal collar yellow with black markings along anterolateral margins. Mesonotum yellow with following black markings: pair of large fasciae on parapsidal sutures; pair of medial fascia surrounding scutal depression; pair of longitudinal fasciae along lateral sigilla. Cruciform elevation yellow. Thoracic sternites yellow, covered with dense golden hairs. Legs (Fig. 1 E). Yellow with black patches. Fore femur with three spines; primary spine pointed apically and oblique to femur; secondary spine large, erected and pointed; subapical spine shorter than secondary spine and pointed. Wings (Fig. 1 A, B). Hyaline, with 8 and 6 apical cells on fore wing and hind wing, respectively; veins yellow to ochraceous. Fore wing and hind wing with distinct, continuous infuscations on basal veins of apical cells 1���3, respectively. Abdomen (Fig. 1 A, B, D). Covered with silvery hairs. Tergites II and III black; tergites IV���VIII yellow with black markings medially. Timbal covers yellow to ochraceous, short and incomplete, with white short pile; timbals with eight long ribs and seven intercalary ribs. Opercula yellow, rounded, strongly oblique posteriorly, just extending beyond posterior margin of sternite II. Abdominal sternites ochraceous with yellow posterior margins, and covered with dense silvery hairs. Genitalia (Fig. 1 F���I). Pygofer rounded in ventral view. Dorsal beak long, pointed apically. Upper lobes moderately developed, rounded. Basal lobes undeveloped. Median uncal lobe short and rectangular, with apex truncated. Claspers deeply divided into two arms, recurving to sharp point apically. Aedeagus cylindrical, apex membranous, with two long straight spines and three short curved spines. Description of female (Fig. 2). Opercula scarcely developed. Abdominal segment VII with posterior margin incised at middle. Abdominal segment IX yellow, with black marking in lateral view. Ovipositor sheath black, not extending beyond dorsal beak. Other characteristics similar to male. Host plant. Ephedra intermedia Schrenk ex Mey. Distribution. China (Xinjiang). Remarks. Intraspecific variability of P. akesensis sp. nov. mainly occurs on markings on mesonotum of males. Two pairs of black fasciae on anterior margins and posterior margins of mesonotum are transitional (small-sized��� medium-sized���large-sized) (Fig. 3). This new species is similar to P. querula, but can be distinguished by the following characters: abdominal sternites ochraceous with yellow posterior margins (abdominal sternites black with reddish brown posterior margins in P. querula); male median uncal lobe short, lesser than 1/3 length of pygofer (male median uncal lobe long, about as long as 1/3 length of pygofer in P. querula); aedeagus with two long straight spines and three short spines apically (aedeagus with seven spines apically in P. querula). Adults of this new species are emerged in the middle of May at densities as great as 50���100 individuals/plant (Fig. 4). It is a truly amazing cicada, because it was found exclusively feeding on the medicinal plant Ephedra intermedia. Plants of this genus are important natural herbs and well known for containing various medicinally active alkaloids (notably ephedrine) which stimulate the central nervous system, influence muscle contraction of animals, and are widely used in preparations for the treatment of some diseases (Miao et al., 2011). Herbivorous insects have coexisted with higher plants for 250 million years (Brattsten, 1986). Plants produce many allelochemicals, such as alkaloids, terpenes, and phenols, for defense against insects (Fraenkel, 1959). These chemicals are often appreciably toxic and have favored the evolution of counteradaptions in plant-feeding insects, including behavioral adaptations, modified physiological processes, and biochemical mechanisms (Fraenkel, 1959). Insects often rely on a complex of general-purpose defensive enzymes to overcome the potential toxicity of the plants they eat (Brattsten et al., 1986). To our knowledge, insects that feed on Ephedra plants are extremely few, except for the cicada Subpsaltria yangi Chen and the aphid Ephedraphis gobica Szelegiewicz to date (Luo & Wei, 2015a; Luo & Wei, 2015b; Qiao & Zhang, 2002). The discovery of P. akesensis sp. nov. feeding on Ephedra intermedia provides important experiment materials for future studies of detoxification mechanism in insects and for the protection of this important medicinal plant., Published as part of Wang, Xu, He, Zhiqiang & Wei, Cong, 2017, A new cicada species of Psalmocharias Kirkaldy feeding on an Ephedra plant from China (Hemiptera: Cicadidae), pp. 367-372 in Zootaxa 4290 (2) on page 369, DOI: 10.11646/zootaxa.4290.2.6, http://zenodo.org/record/829131, {"references":["Miao, Y. R., Yang, Q. H., Yu, S. Y., Luo, S. Q. & Zhang, Y. (2011) Research progress of Ephedrine and Pseudoephedrine. Journal of Inner Mongolia Medical College, 33 (4), 490 - 494. [in Chinese with English abstract]","Fraenkel, G. S. (1959) The Raison d'Etre of Secondary Plant Substances. Science, 129 (3361), 1466 - 1470. https: // doi. org / 10.1126 / science. 129.3361.1466","Luo, C. & Wei, C. (2015 a) Intraspecific sexual mimicry for finding females in a cicada: males produce ' female sounds' to gain reproductive benefit. Animal Behaviour, 102, 69 - 76.","Luo, C. & Wei, C. (2015 b) Stridulatory sound-production and its function in females of the cicada Subpsaltria yangi. PLoS ONE, 10 (2), e 0118667.","Qiao, G. & Zhang, G. (2002) Ephedraphis Hille Ris Lambers, a newly recorded genus from China (Homoptera: Aphididae). Acta Zootaxonomica Sinica, 27 (3), 544 - 547."]}

Cicadatra hei sp. nov. Figs 1–2 Type material. Holotype: ♂ (NWAFU), China: Mt. Daheishan (26°36’14.82”N, 101°39’24.81”E), Geliping Town, Panzhihua City, Sichuan Prov., 1410 m, 24.X.2016, coll. Li He. Paratypes: 2♂♂, 1♀ (NWAFU), China: Mt. Daheishan (26°36’51.74”N, 101°40’39.33”E), Geliping Town, Panzhihua City, Sichuan Prov., 1582 m, 25.IX.2014, coll. Li He; 1♂ (CLHC), China: Mt. Daheishan (26°36’51.74”N, 101°40’39.33”E), Geliping Town, Panzhihua City, Sichuan Prov., 1582 m, 25.IX.2014, coll. Li He; 1♂ (CLHC), China: Mt. Daheishan (26°36’14.82”N, 101°39’24.81”E), Geliping Town, Panzhihua City, Sichuan Prov., 1410 m, 24.X.2016, coll. Li He; 2♂♂ (CLHC), China: Mt. Daheishan (26°36’14.82”N, 101°39’24.81”E), Geliping Town, Panzhihua City, Sichuan Prov., 1410 m, 7.XII.2016, coll. Benfu Miao. Measurements of types (3♂♂, 1♀; in mm). Body length: ♂ 21.1–25.4, ♀ 23.6; fore wing length: ♂ 27.7–29.6, ♀ 29.9; fore wing width: ♂ 10.1–11.3, ♀ 10.9; ♂ width of head including eyes: ♂ 6.7–7.5, ♀ 7.3; pronotum width (including pronotal collar): ♂ 8.8–9.4, ♀ 9.3; mesonotum width: ♂ 6.7–7.0, ♀ 7.3; expanse of forewings: ♂ 61.1– 66.7; ♀ 63.7. Etymology. The species name is named after the collector. The gender is feminine. Description of male. Head (Fig. 1 A–C) about as wide as pronotum. Generally black without distinct markings. Eyes brown, ocelli dark brown. Supra-antennal plates orange-yellow. Postclypeus orange-yellow, with longitudinal central fasciae black; series of 7–8 transverse fasciae black. Anteclypeus black. Rostrum with black apex extending to mid trochanter. Genae black, with dense, long silvery hairs. Distance between lateral ocellus and corresponding eye slightly wider than distance between lateral ocelli. Thorax (Fig. 1 A–C). Pronotum almost black, with anterior margin yellow; a central yellow fasciae, extending from anterior margin of pronotum, broadened at posterior end; pair of faint yellow spots near anterior margin of pronotum; pronotal collar yellow with posterior margin rippled. Mesonotum black, without distinct markings. Cruciform elevation yellow, with anterior and posterior angles black. Thoracic sternites black, with dense, long silvery hairs. Legs (Fig. 1 E). Black with orange-yellow patches. Fore femur with only two spines, secondary spine erect and subapical spine curved. Wings (Fig. 1 A, B). Hyaline, veins ochraceous. Fore wing with distinct, continuous infuscations at bases of apical cells 1–7 and proximal portion of apical cell 1. Hind wing with distinct, continuous infuscation at bases of apical cells 1–5; proximal portions of cubital cell 2 and anal cell 1 tinged with light brown. Abdomen (Fig. 1 A, B, D). Black, with white pollinosity fasciae between tergites VI and VII. Timbal covers black, short and rounded, incomplete but concealing timbals mostly; timbals with ten long ribs. Opercula ocherous, covered with silvery hairs; with rounded apex not extending beyond posterior margin of sternite II. Abdominal sternites mostly black, covered with dense silvery hairs. Genitalia (Fig. 1 F–H). Pygofer rounded in ventral view, with dense, long silvery hairs. Dorsal beak long. Upper lobes of pygofer well developed, very long and pointed. Basal lobes of pygofer widened basically, and slightly pointed apically. Uncus short, pair of median clasper processes separated basally. Aedeagus with basal part broadened; apex with three sclerotized processes and two folded saccate hooks. Description of female (Fig. 2). Opercula scarcely developed. Abdominal segment 7 with posterior margin incised at middle. Abdominal segment 9 black, with yellow median marking in ventral view. Ovipositor sheath black, extending beyond abdominal segment 9. Other characteristics similar to male. Habitat. The adult emergence of this new species gets started from late September and lasts to December, which is much later than that of most other cicadas occurring in Sichuan Province. Most individuals were observed sitting and singing on Zill Mango trees (Mangifera indica L.), but also on some other plants such as Dodonaea viscosa (L.) Jacq. and Sorghum bicolor (L.) Moench (Fig. 3). Distribution. China (Sichuan). Remarks. This new species is similar to C. gregoryi, but can be distinguished by the following characters: white pollinosity fasciae between tergites VI and VII of abdomen, continuous infuscation at bases of apical cells 1– 7 of fore wing, the broad infuscation on apical cells 1–5 of hind wing, the two spines of fore femur, and the developed basal lobes of pygofer., Published as part of Wang, Xu, He, Zhiqiang & Wei, Cong, 2017, A new species of Cicadatra Kolenati, 1857 from China, with primary phylogenetic analyses of the tribe Cicadatrini (Hemiptera: Cicadidae), pp. 174-184 in Zootaxa 4242 (1) on pages 177-178, DOI: 10.11646/zootaxa.4242.1.9, http://zenodo.org/record/376078

Genus Psalmocharias Kirkaldy, 1908 Sena Distant, 1905: 307. Type species: Cicada querula Pallas, 1773 Psalmocharias Kirkaldy, 1908: 124. Type species: Cicada querula Pallas, 1773, Published as part of Wang, Xu, He, Zhiqiang & Wei, Cong, 2017, A new cicada species of Psalmocharias Kirkaldy feeding on an Ephedra plant from China (Hemiptera: Cicadidae), pp. 367-372 in Zootaxa 4290 (2) on page 368, DOI: 10.11646/zootaxa.4290.2.6, http://zenodo.org/record/829131, {"references":["Kirkaldy, G. W. (1908) Bibliographical and nomenclatorial notes on the Hemiptera - No. 8. Entomologist, 41, 122 - 124. https: // doi. org / 10.5962 / bhl. part. 10162","Distant, W. L. (1905) Rhynchotal notes XXX. Annals and Magazine of Natural History, Series 7, 15 (87), 304 - 319. https: // doi. org / 10.1080 / 03745480509443047"]}

Key to species of Cicadatra from China 1. Male opercula black; fore wing with a marginal series of fuscous spots near apices of longitudinal veins to apical cells...................................................................................... C. shaluensis China, 1925 - Male opercula ocherous; fore wing without spots near apices of longitudinal veins to apical cells...................... 2 2. Fore wing with broad, continuous infuscation at bases of apical cells 1–7; abdominal tergites V and VI with white pollinosity transverse fasciae........................................................................... C. hei sp. nov. - Fore wing with thin, continuous infuscation at bases of apical cells 1–5; abdominal tergites V and VI with pair of small white pollinosity spots laterally............................................................ C. gregoryi China, 1925, Published as part of Wang, Xu, He, Zhiqiang & Wei, Cong, 2017, A new species of Cicadatra Kolenati, 1857 from China, with primary phylogenetic analyses of the tribe Cicadatrini (Hemiptera: Cicadidae), pp. 174-184 in Zootaxa 4242 (1) on page 177, DOI: 10.11646/zootaxa.4242.1.9, http://zenodo.org/record/376078

Key to species of Psalmocharias 1. Pronotum without median fascia..........................................................................2 - Pronotum with median fascia............................................................................8 2. Body smaller, mean body length - Body larger, mean body length> 23.0 mm..................................................................4 3. Mesonotum only with linear marking along parapsidal suture............................. P. rugipennis (Walker, 1858) - Mesonotum with markings on lateral and submedial sigillae and within scutal depression.... P. plagifera (Schumacher, 1922) 4. Abdominal tergites IV-VIII yellow, with large black markings medially........................... P. akesensis sp. nov. - Abdominal tergites IV-VIII black, with narrow posterior margins yellow..........................................5 5. Abdominal tergite VII with posterior margin linear....................................... P. paliuri (Kolenati, 1857) - Abdominal tergite VII with posterior margin incised at middle..................................................6 6. Body reddish ochraceous with black markings; fore wing with distinct markings merely on basal veins of second and third api- cal cells................................................................. P. balochii Ahmed & Sanborn, 2010 - Body black with yellow or reddish orange markings; fore wing with other infuscations besides those on basal veins of second and third apical cells...................................................................................7 7. Fore wing longer, about 27.0 mm; fore wing without spots along the margin of costal vein........ P. querula (Pallas, 1773) - Fore wing shorter, about 30.0 mm; fore wing with bright reddish orange spots along the margin of costal vein......................................................................................... P. cataphractica (Popov, 1989) 8. Mesonotum yellow mostly............................................................. P. flava Dlabola, 1970 - Mesonotum black mostly...............................................................................9 9. Rostrum just passing mid coxae; timbal with eight complete and seven intercalary ribs; aedeagus with two long sub-lateral spines................................................................ P. chitralensis Ahmed & Sanborn, 2010 - Rostrum reaching hid coxae; timbal with greater than eight complete ribs; aedeagus with one long spine................ 10 10. Timbal with eight complete and one incomplete ribs and eight intercalaray ribs; aedeagus with single long recurved spine.......................................................................... P. gizarensis Ahmed & Sanborn, 2010 - Timbal with nine complete and one incomplete ribs and nine intercalary ribs; aedeagus with a long lateral spine.................................................................................. P. japokensis Ahmed & Sanborn, 2010

Genus Cicadatra Kolenati, 1857 Cicadatra Amyot, 1847: 153 (Non binom.). Type species: Cicada atra Olivier, 1790 Cicada Cicadatra Kolenati, 1857: 407. Type species: Cicatra burriana Horváth, 1912 Tettigia (Cicadatra) Stål, 1861: 617. Type species: Cicatra burriana Horváth, 1912 Head including eyes narrower than base of mesonotum; less than width between eyes. Postclypeus not protruded. Pronotum wider than long with lateral margins more or less obliquely straight. Male abdomen short, about as long as forebody; timbal covers incomplete. Male opercula short and transverse, not extending beyond posterior margin of abdominal sternite II. Wings hyaline, with 8 and 6 apical cells on fore wing and hind wing, respectively; fore wing usually with infuscation at bases of apical cells and more than twice but less than three times as long as broad. Pygofer elliptical in ventral view; dorsal beak and upper lobes present. Aedeagus curved ventrally from slit of medial uncal lobes, with several processes apically and subapically., Published as part of Wang, Xu, He, Zhiqiang & Wei, Cong, 2017, A new species of Cicadatra Kolenati, 1857 from China, with primary phylogenetic analyses of the tribe Cicadatrini (Hemiptera: Cicadidae), pp. 174-184 in Zootaxa 4242 (1) on page 176, DOI: 10.11646/zootaxa.4242.1.9, http://zenodo.org/record/376078, {"references":["Kolenati, F. A. (1857) \" Homoptera Latreille. Leach. Gulaerostria Zetterstedt. \" in Meletemata Entomologica. Bulletin de la Societe Imperiale des Naturalistes de Moscou, 30, 399 - 429.","Amyot, C. J. B. (1847) Entomologie Francaise. Rhynchotes. Ordre deuxieme. Homopteres. Homoptera. Latr. Annales de la Societe entomologique de France, 1847, 143 - 238.","Stal, C. (1861) Genera nonnulla nova Cicadinorum. Annales de la Societe Entomologique de France, 1 (4), 613 - 622."]}

Emathia takensis (Boulard, 2006) comb. nov. Cicadalna takensis Boulard, 2006: 592., Published as part of Wang, Xu, He, Zhiqiang & Wei, Cong, 2017, A new species of Cicadatra Kolenati, 1857 from China, with primary phylogenetic analyses of the tribe Cicadatrini (Hemiptera: Cicadidae), pp. 174-184 in Zootaxa 4242 (1) on page 180, DOI: 10.11646/zootaxa.4242.1.9, http://zenodo.org/record/376078, {"references":["Boulard, M. (2006) Cicadalna takensi s, nouvelle espece d'un genre nouveau decouverte en Thailande du Nord (Rhynchota, Cicadidae). Bulletin de la Societe entomologique de France, 111 (4), 529 - 534."]}

Paharia semenovi (Oshanin, 1906) Tibicen semenovi Oshanin, 1906: 161. Tibicena semenovi ��� Oshanin 1912: 96. Psalmocharias semenovi ��� Distant 1914: 10. Paharia semenovi ��� China 1926: 376. Tibicina (Paharia) semenovi ��� Boulard 1977: 563. Distribution Kazakhstan and Tajikistan., Published as part of Wang, Xu, Duffels, Joannes P. & Wei, Cong, 2017, Review of the cicada genus Paharia Distant (Hemiptera, Cicadidae), with the description of a new species and its allied species, pp. 1-14 in European Journal of Taxonomy 349 on page 9, DOI: 10.5852/ejt.2017.349, http://zenodo.org/record/3832670, {"references":["Oshanin V. F. 1906. Deux nouvelles especes de cicadides de l'Asie Centrale. Revue russe d'Entomologie 6: 161 - 163. Available from http: // biodiversitylibrary. org / page / 11943527 [accessed 9 Aug. 2017].","Oshanin V. F. 1912. Katalog der palaarktischen Hemipteren (Heteroptera, Homoptera - Auchenorhyncha und Psylloideae). Friedlander & Sohn, Berlin.","Distant W. L. 1914. Homoptera, family Cicadidae, subfamily Gaeaninae. Genera Insectorum 158: 1 - 38.","China W. E. 1926. A new species of Cicadatra (Homoptera, Cicadidae) from Waziristan, with notes on the allied genus Psalmocharias Kirk. Annals and Magazine of Natural History 18 (9): 374 - 376. https: // doi. org / 10.1080 / 00222932608633531","Boulard M. 1977. Description d'une nouvelle Tibicina de l'ouest asiatique; revision de la liste des especes palearctiques appartenant a ce genre (Hemiptera, Cicadoidea). Annales de la Societe entomologique de France (N. S.) 12: 557 - 566."]}

Paharia insidiosa (Boulard, 1977) comb. nov. Tibicina (Tibicina) insidiosa Boulard, 1977: 557. Distribution. Afghanistan.

Paharia zevara (Kusnezov, 1931) Tibicina zevara Kusnezov, 1931: 15. Paharia zevara ��� Nast 1972: 148. Tibicina (Paharia) zevara ��� Boulard 1977: 564. Distribution Afghanistan and Tajikistan., Published as part of Wang, Xu, Duffels, Joannes P. & Wei, Cong, 2017, Review of the cicada genus Paharia Distant (Hemiptera, Cicadidae), with the description of a new species and its allied species, pp. 1-14 in European Journal of Taxonomy 349 on page 9, DOI: 10.5852/ejt.2017.349, http://zenodo.org/record/3832670, {"references":["Kusnezov V. 1931. Ubersicht der asiatischen weissgeflugelten Tibicina - Arten (Homoptera-Cicadidae). Konowia 10: 15 - 18.","Nast J. 1972. Palaearctic Auchenorrhyncha (Homoptera). An Annotated Checklist. Polish Scientific Publishers, Warsaw.","Boulard M. 1977. Description d'une nouvelle Tibicina de l'ouest asiatique; revision de la liste des especes palearctiques appartenant a ce genre (Hemiptera, Cicadoidea). Annales de la Societe entomologique de France (N. S.) 12: 557 - 566."]}

Key to the species of Paharia 1. Abdominal tergite(s) with distinct marking(s) on posterior margin(s)............................................. 2 ��� Abdominal tergites without distinct markings.................................................................................. 3 2. Abdomen with yellow margins on each tergite; mesonotum with pair of yellow irregularly-shaped markings extending to anterior margin of disc................................ Pa. lacteipennis (Walker, 1850) ��� Abdomen with yellow margin merely on tergite VIII; mesonotum with pair of yellow irregularlyshaped markings not extending to anterior margin of disc................. Pa. semenovi (Oshanin, 1906) 3. Pronotum with pair of large brown markings on lateral fissure of inner area............................................................................................................................... Pa. insidiosa (Boulard, 1977) comb. nov. ��� Pronotum without distinct markings on lateral fissure..................................................................... 4 4. Fore wing with costal vein brown to black; pronotum without markings......................................................................................................................................................... Pa. zevara (Kusnezov, 1931) ��� Fore wing with costal vein yellow; pronotum with a yellow central longitudinal fascia................. 5 5. Male median uncal lobes pale brown; female opercula reaching posterior margin of abdominal sternite II.......................................................................................................... Pa. oorschoti sp. nov. ��� Male median uncal lobes black; female opercula not reaching posterior margin of abdominal sternite II................................................................................................................. Pa. putoni (Distant, 1892), Published as part of Wang, Xu, Duffels, Joannes P. & Wei, Cong, 2017, Review of the cicada genus Paharia Distant (Hemiptera, Cicadidae), with the description of a new species and its allied species, pp. 1-14 in European Journal of Taxonomy 349 on pages 9-10, DOI: 10.5852/ejt.2017.349, http://zenodo.org/record/3832670, {"references":["Walker F. 1850. List of the Specimens of Homopterous Insects in the Collection of the British Museum. British Museum Trustees, London.","Oshanin V. F. 1906. Deux nouvelles especes de cicadides de l'Asie Centrale. Revue russe d'Entomologie 6: 161 - 163. Available from http: // biodiversitylibrary. org / page / 11943527 [accessed 9 Aug. 2017].","Boulard M. 1977. Description d'une nouvelle Tibicina de l'ouest asiatique; revision de la liste des especes palearctiques appartenant a ce genre (Hemiptera, Cicadoidea). Annales de la Societe entomologique de France (N. S.) 12: 557 - 566.","Kusnezov V. 1931. Ubersicht der asiatischen weissgeflugelten Tibicina - Arten (Homoptera-Cicadidae). Konowia 10: 15 - 18."]}

Paharia putoni (Distant, 1892) Fig. 3 Tibicina lacteipennis Puton, 1883: 45. Tibicen putoni Distant, 1892a: 67 (nom. nov. pro Tibicina lacteipennis Puton, 1883 [nec Tibicen lacteipennis Walker, 1850]). Sena lacteipennis ��� Distant 1906: 82. Psalmocharias lacteipennis ��� Distant 1914: 10. Paharia putoni ��� China 1926: 376. Paharia putoni putoni ��� Sanborn 2013: 699. Tibicina (Paharia) putoni ��� Boulard 1977: 564. Material examined TURKEY: 12 ♂♂, 11 ♀♀, Van, Kurubas Ge��idi, 2100 m, st. 261, 18 Jul. 1985, H. v. Oorschot and H. v. d. Brink leg. (ZMAN); 2 ♂♂, 2 ♀♀, same collection data as precedent (NWAFU); 11 ♂♂, 3 ♀♀, Van, Kurubas Ge��idi, 2200 m, st. 606, 3 Jul. 1990, H. v.d. Brink, D. v.d. Poorten and W. de Prins leg. (ZMAN); 9 ♂♂, 6 ♀♀, Mus, Seferek Ge��idi, 6 km ENE of Varto, 1900���2000 m, st. 2612, 25 Jun. 2000, H. v. Oorschot, H. v. d. Brink and P. Oosterbroek leg. (ZMAN); 2 ♂♂, 2 ♀♀, same collection data as precedent (NWAFU); 2 ♂♂, Van, N of Catak, 1900 m, st. 604, 2���5 Jun. 1990, H. v.d. Brink, D. v.d. Poorten and W. de Prins leg. (ZMAN). IRAN: 10 ♂♂, 2 ♀♀, M��zandar��n, Khoshye���alaq, Khosh Yeil��q, 2000���2500 m, 4���6 Jul. 1972, W.L. Blom leg. (ZMAN); 2 ♂♂, 2 ♀♀, Ostan M��zandar��n, Kūh-e-Sovar, Khosh Yeil��q, 1900��� 2100 m, 22���24 Jun. 1978, W.L. Blom leg. (ZMAN). Description MEASUREMENTS (in mm; n = 10 ♂♂, 10 ♀♀). Body length: ♂ 24.5���27.9, ♀ 21.6���26.1; fore wing length: ♂ 29.9���36.0, ♀ 29.2���33.3; width of head including eyes: ♂ 6.2���6.9, ♀ 5.8���7.0; pronotum width (including pronotal collar): ♂ 9.2���10.0, ♀ 9.0���10.5; mesonotum width: ♂ 7.4���8.7, ♀ 7.2���8.9. HEAD (Fig. 3 A���B). Head including eyes much narrower than base of mesonotum; mostly black with a thin yellow spot extending from median ocellus to posterior margin of head. Distance between lateral ocellus and corresponding compound eye about equal to distance between lateral ocelli. Eyes green, ocelli red. Lorum black, covered with golden hairs. Postclypeus black, with yellow lateral and posterior margins in ventral view, and covered with long golden hairs. Anteclypeus black. Rostrum yellow basally and black apically, reaching mid coxae. THORAX (Fig. 3A, C���D). Inner area of pronotum black and distinctly longer than head, covered with dense golden hairs; a faint central longitudinal fascia yellow. Pronotal collar black without markings, covered with golden hairs. Mesonotum black with somewhat quadrangled marking around corresponding scutal depression; pair of yellow fasciae along lateral margins of mesonotum. Cruciform elevation yellow. Thoracic sternites black, covered with dense golden hairs. LEGS (Fig. 3B, H). Mostly yellow. Fore femur with black marking near posterior margin in lateral view; primary spine pointed apically and slightly oblique to femur; secondary spine large, curved downward; subapical spine undeveloped. Trochanter with black marking. Tibiae fuscous to black basally. WINGS (Fig. 3 A���B). Hyaline; fore wing pale yellow without markings; veins thick and brown; costal vein yellow. Hind wing not tinged. Male ABDOMEN (Fig. 3 A���B, E). About as long as head and thorax together; black with white pruinosity on lateral areas and golden hairs on median areas of each tergite. Timbal covers yellow with black markings, undeveloped dorsally and leaving dorso-lateral timbal cavity wide open. Opercula black with yellow posterior margin, not overlapping each other centrally, not reaching posterior margin of abdominal sternite II. Abdominal sternites black and covered with golden hairs; deeply depressed, with epipleurites strongly developed and very prominent; epipleurites black with lateral margins yellow. Sternite VIII longer than length of two preceding sternites together. GENITALIA (Fig. 3 F���G). Pygofer elliptical in ventral view, with long, silvery hairs. Basal lobes of pygofer curved inward distally. Anal styles yellow to fuscous. Uncus black; medial uncal lobe black and tapering to apex, with apex blunt and lower margin nearly straight in lateral view. Aedeagal shaft elongated, curved anteriorly and then posteriorly, apex sickle-shaped. Female ABDOMEN. About as long as head and thorax together, dorsally black with white hairs on lateral and median areas of tergites but without distinct marking. Opercula black with narrow yellow posterior margin, not overlapping and not reaching posterior margin of abdominal sternite II. Abdominal sternites black and covered with silvery hairs; epipleurites prominent, black with yellow lateral margins. Sternite VIII with deep median incision, black with distal lobes orange-yellow. Lower part of segment IX orangeyellow to yellowish brown. Distribution Iran, Turkmenistan, Afghanistan, Kazakhstan and Tajikistan. Remarks This species is morphologically very close to Pa. oorschoti sp. nov. (for detail, see Remarks for Pa. oorschoti sp. nov.)., Published as part of Wang, Xu, Duffels, Joannes P. & Wei, Cong, 2017, Review of the cicada genus Paharia Distant (Hemiptera, Cicadidae), with the description of a new species and its allied species, pp. 1-14 in European Journal of Taxonomy 349 on pages 6-8, DOI: 10.5852/ejt.2017.349, http://zenodo.org/record/3832670, {"references":["Puton A. 1883. Deux especes nouvelles de cicadides. Revue d'Entomologie 2: 45 - 46. Available from http: // biodiversitylibrary. org / page / 25445565 [accessed 9 Aug. 2017].","Distant W. L. 1892 a. On some undescribed Cicadidae, with synonymical notes. Annals and Magazine of Natural History 10 (6): 54 - 67. https: // doi. org / 10.1080 / 00222939208677373","Walker F. 1850. List of the Specimens of Homopterous Insects in the Collection of the British Museum. British Museum Trustees, London.","Distant W. L. 1906. A Synonymic Catalogue of Homoptera. Part 1. Cicadidae. British Museum of Natural History, London.","Distant W. L. 1914. Homoptera, family Cicadidae, subfamily Gaeaninae. Genera Insectorum 158: 1 - 38.","China W. E. 1926. A new species of Cicadatra (Homoptera, Cicadidae) from Waziristan, with notes on the allied genus Psalmocharias Kirk. Annals and Magazine of Natural History 18 (9): 374 - 376. https: // doi. org / 10.1080 / 00222932608633531","Sanborn A. F. 2013. Catalogue of the Cicadoidea (Hemiptera: Auchenorrhyncha). Academic Press / Elsevier, London.","Boulard M. 1977. Description d'une nouvelle Tibicina de l'ouest asiatique; revision de la liste des especes palearctiques appartenant a ce genre (Hemiptera, Cicadoidea). Annales de la Societe entomologique de France (N. S.) 12: 557 - 566."]}

Hyalessa wangi sp. nov. Figs. 1���2 Type material. Holotype: ♂ (NWAFU), China: Daxueshan Nature Reserve (24��01���30���N, 99��15���15���E), Yongde County, Lincang City, Yunnan Prov., 2000m, 22.VIII.2015, coll. Jishen Wang. Paratype: 1 ♂ (NWAFU), same data as the holotype. Measurements of types (in mm). (2 ♂♂): Body length: 27.18���27.68; fore wing length: 45.50���46.51; fore wing width: 15.04���15.08; width of head including eyes: 9.20���9.26; pronotum width (including pronotal collar): 13.36���13.39; mesonotum width: 11.21���11.23. Etymology. The species name is named after the collector. Description of male. Head (Fig. 1A���C) mostly green, about 0.69 times as wide as pronotum. Compound eye greenish brown; ocelli green. A median inverted trianglular black marking enclosing ocelli area; pair of black, linear markings along frontoclypeal suture. Supra-antennal plate black. Postclypeus moderately swollen, with a green medial longitudinal fascia and black transverse grooves on each side. Lorum black covered with golden pile. Anteclypeus green with pair of black markings posterior. Rostrum black and reaching half-length of abdominal sternite II. Thorax (Fig. 1A���C). Pronotum green and slightly longer than head, with pair of central broad longitudinal black fasciae widened both anteriorly and posteriorly; pair of large reddish fasciae along lateral fissure. Pronotal collar generally green with some irregular, black markings. Mesonotum black with large areas of irregular, green markings anteriorly; pair of faint green spots on scutal depressions. Cruciform elevation black, with pair of green markings on anterior angles. Metanotum and lateral part of cruciform elevation green to black with golden pile. Thoracic sternites green to black. Legs (Fig. 1E). Black; fore femur with large ochraceous patch medially and longitudinal ochraceous patch along posterior margin in lateral view. Fore tibia and mid femur mostly black. Hind legs mostly black. Fore femur with primary spine short and oblique to femur, secondary spine erected and pointed, subapical spine absent. Wings (Fig. 1A, B). Hyaline; fore wing pale brown with distinct large fuscous spot at bases of second, third, fifth, and seventh apical cells; a marginal series of minute pale fuscous spots near apices of longitudinal veins in apical cells. Costa vein and R+Sc vein reddish brown to black. Basal membrane dark green. Hind wing not tinged. Abdomen (Fig. 1A���D). Mostly black; abdominal tergite III with indistinct green posterior margin. Timbal cover black, circular and globose. Operculum black, overlapping to the other one centrally, with rounded apex not reaching posterior margin of abdominal sternite II. Abdominal sternites black, with posterior margins green. Genitalia (Fig. 1F���H). Pygofer nearly elliptical, covered with long hairs in ventral view. Anal styles brownish yellow. Basal lobes of pygofer not developed. Distal shoulder rounded. Uncal lobes black basally and yellow apically, long and flat, with rounded apices well separated from each other from near base in ventral view. Aedeagus thick, large medial saccate hook tapered and curved subapically, protruding from near base of uncal lobes; a pair of highly sclerotized lateral processes extending from base of aedeagus very long and thin, with apices curved cephalad in lateral view, which are nearly completely overlapped by the uncal lobes in situ. Female. Unknown. Distribution. China (Yunnan). Habitat. This new species was collected from a mountain valley at elevation of 2000 m. The microhabitat is among evergreen broad-leaved forests with dense herbaceous groundcover. Individuals were observed sitting and singing on high trees (e.g., Rhododendron delavayi Franch, Cyclobalanopsis stewardiana var. longicaudata Hsu, Mao & Li and Schim a argenti Pritz) (Fig. 2). Molecular Characters. Partial mitochondrial COI gene sequence with GenBank accession number: KT989869. Material: 1 ♂, Yunnan, Lincang, Yongde, Daxueshan Nature Reserve, 2000m, 22.VIII.2015 (coll. Jishen Wang). GATTGCATTCATTTTTGGATTTGATCAGGGATGATTGGTACATCTTTAAGAATATTAATTCGAATTGAGT TAGGAACTCCTGGTTCCTTTATTGGTAATGATCAAATTTATAATGTTATTGTTACAGCTCATGCATTTATT ATAATTTTTTTTATAGTTATGCCTATCATAATTGGGGGTTTTGGAAATTGGCTTATTCCTTTAATAATTGG AGCCCCAGATATAGCGTTTCCTCGAATAAATAATATGAGTTTTTGATTACTTCCTCCTTCTTTAACTTTAT TGATAATTGGTATAATAGTTGATAGAGGGGCTGGTACTGGTTGAACAGTTTATCCTCCATTATCAAGTAC TATATCTCATTCTGGAGCTTGTGTAGATTTAACAATTTTTTCTTTACATTTGGCAGGTGTATCTTCAATTT TAGGGGCTGTAAATTTTATTAGAACAATTTTTAATATGCGTGCAATTGGTATGTATTTGGATCGAACACC TTTATTTGTATGAGCAGTGTTAATTACTGCTTTTCTTTTATTGTTATCATTGCCAGTTCTGGCTGGGGCTA TTACTATATTATTAACAGATCGAAATATAAATACTTCTTTTTTTGACCCATCAGGTGGGGGAGATCCAAT TCTTTATCAGCATTTAT Remarks. This new species is similar to H. stratoria in body size, but can be distinguished by the coloration and shape of timbal covers and opercula. This new species is also similar to H. maculaticollis in the shape of timbal covers and opercula, but can be distinguished by the markings on thorax, the coloration of uncal lobes and the shape of aedeagus. This new species is also similar to H. expansa in the uncal lobes being separated from each other from near their base, but can be distinguished by the rounded apices of the uncal lobes (uncal lobes with apices pointed in H. expansa). This new species is unique in the genus Hyalessa due to the following two characteristics: 1) fore femur possesses only the primary and secondary spines, without subapical spine; and 2) aedeagus with a pair of very long and sclerotized lateral processes. Currently, Hyalessa species lack any barcode records in GenBank. We obtained a partial mitochondrial cytochrome oxidase subunit I (COI) sequences (DNA barcoding) of H. wangi sp. nov., and submitted it to GenBank. This will be helpful for molecular identification and phylogeny reconstruction of Hyalessa species, which will be treated elsewhere., Published as part of Wang, Xu, Qiu, Yue & Wei, Cong, 2016, A new species of the genus Hyalessa (Hemiptera, Cicadidae) from China, with DNA barcoding data and a key to related species in Zootaxa 4085 (2), DOI: 10.11646/zootaxa.4085.2.10, http://zenodo.org/record/1052581

Wang, Xu, Qiu, Yue, Wei, Cong (2016): A new species of the genus Hyalessa (Hemiptera, Cicadidae) from China, with DNA barcoding data and a key to related species. Zootaxa 4085 (2), DOI: http://doi.org/10.11646/zootaxa.4085.2.10

Kosemia guanzhongensis sp. n. Figures 17���19 Type material. Holotype: ♂ (NWAFU), [Shaanxi Prov.] Yangling Agricultural Hi-tech Industries Demonstration Zone, 29 -vii- 1990, coll. Lei Zhongren. Paratypes: [Shaanxi Prov.] 3 ♂ (NWAFU), Yangling Agricultural Hi-tech Industries Demonstration Zone, 19 -vii- 1990, coll. Lei Zhongren; 1 ♂ (NWAFU), Wugong County, vii- 1933, coll. Yang Linghuan; 1 ♂ (NWAFU), Wugong County, 3 -vi- 1988, coll. unknown; 1 ♂ (NWAFU), Yangling Agricultural Hi-tech Industries Demonstration Zone, vi- 1991, coll. unknown; 1 ♀ (NWAFU), Taibai County, 20 -vii- 1990, coll. unknown; 1 ♀ (NWAFU), Yangling Agricultural Hi-tech Industries Demonstration Zone, vi- 1991, coll. unknown (NWAFU); 1 ♀, Zhouzhi County, 23 -vii- 1996, coll. Zhang Cuixuan. Etymology. The species is named after the type locality which is located at the middle part of Shaanxi Province and generally referred to as Guanzhong Area in China. Description. Male. Body small, almost cylindrical, furnished with golden pubescence. Head (Figs. 17 A���D). Head including eyes narrower than base of mesonotum; vertex reddish brown with some irregular fuscous markings. Eyes generally brown. Ocelli generally reddish (yellowish in two male paratypes). Postclypeus black, faded to brown distally and laterally, black area covering central sulcus and transverse grooves generally smaller and lighter (dark brown) in lighter specimens and wider in darker ones; two rather large black patches at base, while entirely black in some paratypes. Anteclypeus dark brown or black in some paratypes, with golden scattered pubescence laterally. Antennae dark brown or black. Lora and genae brown or black with dense, long golden pubescence. Rostrum dark brown with tip black, basal joint of rostrum brown. Thorax (Figs. 17 A���D). Pronotum shiny black with margins and central longitudinal fascia light brown; central longitudinal fascia slightly ampliate anteriorly and strongly ampliate posteriorly, where it contains a dark brown or black spot. Lateral part of pronotal collar ampliate laterally and rounded; lateral angle well ampliate posterolaterally. Mesonotum light brown with submedian and lateral sigilla castaneous. Cruciform elevation light brown. Two scutal depressions in front of cruciform elevation fuzzy, dark brown or black. Wings (Figs. 17 A���B). Wings hyaline with venation proximally yellowish becoming fuscous distally. Fore wing with veins M and CuA adjacent to one another at basal cell, but not fused as one; basal membrane orangereddish. Hind wing plaga dark brown, narrowly along vein 2 A to its distal end and around ambient vein of cubital cell 2 and anal cell 1; plaga on most of 3 A and basal part of jugum infuscated. Legs (Fig. 17 G). Light brown, with dense, short golden setae. Fore leg with fasciae of coxa, one or two spot(s) of trochanter, two longitudinal fasciae of femur, all black. Fore femur with three strong spines beneath, all slightly slanted and shiny reddish brown apically, decreasing in size from primary to tertiary spine; a tiny spine divided from tertiary spine in some paratypes. Mid and hind legs much lighter in hue as compared with fore legs. Opercula (Fig. 17 E). Operculum generally light brown with silvery scattered pile; apical half raised above level of tympanal cavity, weakly curving outwards at distomedial margin; apical margin rounded, not reaching to posterior margin of tympanal cavity. Meracanthus light brown. Abdomen (Figs. 17 A���B, E���F). Timbal with two long ribs. Abdominal tergites almost shiny black; posterior margins of tergites II���VII and posterior portion of tergite VIII yellow; posterior margin of tergite VIII indented medially. Abdominal sternites black with dense, short golden setae; sternite II orange-yellow; posterior margins of sternites III���VI, epipleurites III���VI and most posterior portion of sternite VII���VIII, all pale yellow; sternite VIII distinctly shorter than sternite VII. Genitalia (Figs. 18 A���F). Pygofer almost light brown. Dorsal beak of pygofer generally short and broad at base and tapering towards apex. Upper lobe of pygofer about right angled in lateral view, apex obtuse; basal lobe of pygofer tending to be broadly angled in lateral view. Median lobe of uncus small, paramedian area slightly convex in ventral view. Clasper moderately developed, digitate, meeting the other one at base and then strongly curving anterolaterally; apex obtuse. Female (Figs. 19 A���D). Female longer than male. Supra-antennal plate reddish brown. Eye generally brownish. Rostrum dark brown. Operculum very small, rounded, light brown; meracanthus light brown, broadly triangular, with apex pointed. Abdominal tergites almost black; posterior margin of tergite VII and posterior portion of tergite VIII yellowish; tergite IX pale yellowish, with black Y-shaped marking dorsal-laterally, reaching to apex of dorsal beak; two stigma of tergite IX black-brown. Abdominal sternites ochraceous or light brown, furnished with dense, short golden setae; middle of venter striped with a series of black spots; posterior margin of sternite VII with median incision very deep and broad, deep to about 4 / 5 the length of sternite VII; two oblique black patches on anterolateral parts of sternite VII. Dorsal beak of pygofer short and sharp, reaching beyond anal styles. Ovipositor sheath dark-brown to black, protruding beyond apex of dorsal beak. Other morphological characters similar to male. Measurements. (7 ♂♂, 3 ♀♀), mean (range) (in mm). Body length: male 18.5 (18.0��� 19.8), female 20.6 (19.0��� 22.3); fore wing length: male 18.9 (18.1���19.8), female 21.4 (19.7���23.2); fore wing width: male 7.1 (6.8���7.3), female 7.8 (7.1���8.2); width of head including eyes: male 5.1 (4.9���5.3), female 5.5 (5.3���5.7); pronotum width (including pronotal collar): male 6.2 (6.1���6.3), female 7.1 (6.6���8.1); mesonotum width: male 5.7 (5.2 ���6.0), female 6.2 (5.5���6.7). Distribution. China (Shaanxi). Remarks. This new species is very similar to K. castaneous sp. n.. However, it can be distinguished from the latter by the following characteristics: mesonotum and cruciform elevation light brown; abdominal tergites black with narrow yellow posterior margins; operculum short, not extending to posterior margin of tympanal cavity; clasper moderately developed, meeting the other one at base and then strongly curving anterolaterally. This new species is also very similar to K. yezoensis (Matsumura, 1898) and K. admirabilis (Kato, 1927). However, it can be distinguished from these species by the following characteristics: vertex reddish brown; rostrum only reaching beyond anterior margin of middle coxae; mesonotum castaneous or brown, without black markings; abdomen almost cylindrical; abdominal sternite VII about as long as sternites V���VI together., Published as part of Qi, Shengping, Hayashi, Masami & Wei, Cong, 2015, A review of the cicada genus Kosemia Matsumura (Hemiptera: Cicadidae), pp. 451-492 in Zootaxa 3911 (4) on pages 472-475, DOI: 10.11646/zootaxa.3911.4.1, http://zenodo.org/record/235745, {"references":["Matsumura, S. (1898) A summary of Japanese Cicadidae with description of a new species. Annotationes Zoologicae Japonenses, 2, 16 - 19.","Kato, M. (1927) Descriptions of some new Japanese and exotic Cicadidae. Transactions of the Natural History Society of Formosa, 17, 274 - 283."]}

Kosemia castanea sp. n. Figures 14���16 Type material. Holotype: ♂ (NWAFU), [Shaanxi Prov.] Wugong County, 21 -v- 1983, coll. Zhu Jianguo. Paratypes: [Shaanxi Prov.] 1 ♂ (NWAFU), Wugong County, vii- 1957, coll. Song Huiwen; 1 ♂ (NWAFU), Fengxian County, 2 - vi- 1974, coll. Tian Chou; 1 ♀ (NWAFU), Wugong County, vii- 1983, coll. Zhang Yunping; 1 ♀ (NWAFU), Fengxian County, vii- 1989, coll. Xu Xin (NWAFU); 1 ♀ (NWAFU), Taibai County, 18 -vii- 1990, coll. Lei Zhongren. Etymology. The species name castanea refers to the color of the mesonotum and abdomen. Description. Male. Body above castaneous with black markings on pronotum and base of postclypeus. Head (Figs. 14 A���D). Head including eyes narrower than base of mesonotum; vertex reddish brown with grey scattered pile. Ocelli orange-reddish. Eyes generally dark brown. Postclypeus light brown with light orangereddish laterally; two large black patches at base approaching to one another but not meeting medially; transverse grooves of postclypeus slender, black with grey scattered pile. Anteclypeus light brown, with silvery scattered pile. Genae and lora brown with dense, long silvery pubescence. Rostrum brown with dark brown tip. Thorax (Figs. 14 C���D). Pronotum shiny black with margins brown; central longitudinal fascia brown, widened posteriorly; lateral part of pronotal collar ampliate and broadly rounded. Mesonotum light brown with submedian and lateral sigilla castaneous. Mesonotum uniformly dull brown in one male paratype and uniformly light brown in one male paratype. Cruciform elevation light brown. Wings (Figs. 14 A���B). Fore wing with costal vein pale testaceous; venation of basal two-thirds light brown, apical one-third olivaceous; basal membrane sanguineous; veins M and CuA adjacent to one another at basal cell, but not fused. Hind wing plaga grayish, narrowly along vein 2 A to its distal end and around ambient vein of cubital cell 2 and anal cell 1; plaga on most of 3 A and basal part of jugum infuscated. Legs (Fig. 14 G). Light brown with short, golden setae. Fore leg with fasciae of coxa and one or two spot(s) of trochanter black. Two longitudinal fasciae of fore femur reddish brown. Fore femur with three strong spines beneath: primary spine more slanted; secondary spine half as long as primary spine, somewhat erected; tertiary spine one-third as long as primary spine, slightly slanted; a tiny spine divided from tertiary spine. Opercula (Fig. 14 E). Operculum generally light brown, covered with scarce silvery pile; inner margin obtusely angulated; posterior margin slightly oblique, rounded in one male paratype. Meracanthus small, triangular, light brown. Abdomen (Figs. 14 A���B, E���F). Abdomen slightly longer than head and thorax together. Timbal with three long ribs. Abdominal tergites shiny castaneous; posterior margins of tergites III���VII and posterior part of tergite VIII ochraceous. Abdominal sternites pale reddish brown with silvery scattered pile; sternite VIII distinctly shorter than sternite VII, hind margin rounded. Genitalia (Figs. 15 A���H). Pygofer golden yellowish. Upper lobe of pygofer well developed, with apex somewhat acute in lateral view; basal lobe of pygofer slightly angled in lateral view. Median lobe of uncus small, black apically. Clasper shiny dark red, weakly elongated, digitate, closely meeting the other one at basal half; apex somewhat straight. Female (Figs. 16 A���D). Female longer than male. Head as in male holotype but reddish ochraceous with dense golden pile; head light brownish in one female paratype. Eyes black or black-brown. Postclypeus brown with dense golden pile. Anteclypeus brownish with dense golden pile, slightly tapering towards distal end. Pronotum with margins reddish, furnished with golden setae; central longitudinal fascia reddish and ampliate anteriorly and posteriorly, furnished with short, dense golden pile. Mesonotum and cruciform elevation golden brown with short, dense golden pile. Operculum small, rounded, orange-reddish; lateral margin slightly oblique. Meracanthus reddish, broadly triangular, apex pointed. Abdominal tergites dark reddish; posterior portion of tergite VII and most portion of tergite VIII testaceous; tergite VIII furnished with short, dense golden pile on posterior margin; tergite IX testaceous with dark red Y-shaped marking dorsal-laterally, reaching to apex of dorsal beak; two stigma on tergite IX dark red. Abdominal sternites testaceous red, with dense, short golden setae; posterior margin of sternite VII with median incision very deep and broad, deep to about 4 / 5 the length of sternite VII. Dorsal beak of pygofer short and sharp, slightly reaching beyond anal styles. Ovipositor sheath dark-brown, slightly protruding beyond apex of dorsal beak. Other morphological characters similar to male. Measurements. (3 ♂♂, 3 ♀♀), mean (range) (in mm). Body length: male 18.0 (17.6���18.5), female 21.7 (20.1���23.4); fore wing length: male 18.4, female 22.8 (21.4 ���25.0); fore wing width: male 6.7, female 7.9 (7.7���8.2); width of head including eyes: male 5.0 (4.8���5.2), female 5.7 (5.6 ���6.0); pronotum width (including pronotal collar): male 6.3 (6.1���6.6), female 7.3 (7.1���7.4); mesonotum width: male 5.5 (5.3���5.7), female 6.2 (6.1���6.3). Distribution. China (Shaanxi). Remarks. This new species is very similar to K. fuscoclavalis (Chen, 1943). However, it can be distinguished from the latter by the following characteristics: vertex reddish brown; mesonotum and abdomen mainly castaneous; abdomen longer than head plus thorax; abdominal tergites with posterior segmental margins narrowly ochraceous; clasper meeting the other one at base, with apical half nearly straight., Published as part of Qi, Shengping, Hayashi, Masami & Wei, Cong, 2015, A review of the cicada genus Kosemia Matsumura (Hemiptera: Cicadidae), pp. 451-492 in Zootaxa 3911 (4) on pages 468-471, DOI: 10.11646/zootaxa.3911.4.1, http://zenodo.org/record/235745, {"references":["Chen, K. - F. (1943) New genera and species of Chinese cicadas with synonymical and nomenclatorial notes. Journal of the New York Entomological Society, 51, 39 - 40."]}

Kosemia fuscoclavalis (Chen, 1943) Figures 12���13 Melampsalta fuscoclavalis Chen, 1943: 39. Melampsalta fuscoclavalis chungnanshana Chen, 1943: 40. Cicadetta fuscoclavalis: Nast, 1972: 152. Leptopsalta fuscoclavalis: Chou et al., 1997: 52. Kosemia fuscoclavalis: Sanborn, 2013: 524. Material examined. 1 ♂ (NWAFU), Shaanxi Prov., Zhongnan Mountain, 1 -v- 1936, coll. unknown. Description. Male. Ground color of body black with greyish and silvery pile. Head (Figs. 12 A���D). Head including eyes narrower than base of mesonotum; paramedian posterior margin of vertex with pale testaceous. Ocelli reddish. Eyes dark brown. Postclypeus, supra-antennal plate, genae and anteclypeus pale testaceous with dense, long silvery pile; transverse grooves of postclypeus slender and black, two rather large black patches at base of postclypeus approaching to one another but not meeting medially. Antennae, lora and two-thirds of rostrum black or black brown. Thorax (Figs. 12 C���D). Pronotum black with margins and central longitudinal fascia pale testaceous, the latter slightly widened anteriorly and much widened near posteriorly, where it contains a small black spot. Lateral part of pronotal collar slightly ampliate laterally and rounded; lateral angle well ampliate posterolaterally. Mesonotum black with two central obconical spots, lateral margin and cruciform elevation pale testaceous. Wings (Figs. 12 A���B). Fore wing hyaline, distinctly broader, with costal vein distinctly arched; costal membrane and costal vein testaceous red; venation of basal two-thirds fuscous brown, apical one-third piceous; basal membrane sanguineous; veins M and CuA contiguous only at basal point. Hind wing with faintly infuscation narrowly along vein 2 A to its distal end and around ambient vein of cubital cell 2 and anal cell 1; plaga on most of 3 A and basal part of jugum also infuscated. Legs (Fig. 12 G). General color reddish ochraceous. Wedge-shaped spot on front coxa, spots on each mid and hind coxa, streaks on mid and hind femur and tibiae, all black. Fore femur with three strong spines beneath, all slightly slanted, decreasing in size from primary to tertiary spine; a tiny spine divided from tertiary spine. Opercula (Fig. 12 E). Somewhat reddish ochraceous or pale testaceous, covered with scarce silvery pile; inner margin obtusely angulated; lateral margin weakly oblique; posterior margin convexly rounded. Meracanthus small, slightly pale testaceous. Abdomen (Figs. 12 A���B, E���F). Abdomen as long as head and thorax together. Timbal with three long ribs. Abdominal tergites black, gradually attenuated posteriorly; tergite I, spot on each lateral area of tergite II, posterior margins of tergites III���VII and posterior portion of tergite VIII, all pale testaceous; tergite VIII with long greyish pile; posterior margin of tergite VIII a little indented medially. Abdominal sternites testaceous, with silverly scattered pile; sternites and epipleurites III���VII with a black spot on each sternite, diminishing in size posteriorly; sternite VIII slightly flat and shorter than sternite VII. Genitalia (Figs. 13 A���D). Pygofer black dorsally, pale testaceous laterally and posteriorly. Dorsal beak of pygofer moderately long and spine-shaped, narrowly pointed at apex. Upper lobe of pygofer slightly concave, distant from dorsal beak, broadly triangular in lateral view, apex obtuse. Median lobe of uncus small, apex slightly upswept in lateral view, paramedian area slightly convex in ventral view. Clasper slightly elongated, digitate, meeting the other one at base then separated anterolaterally; apex obtuse. Measurements. (1 ♂) (in mm), Body length: 20; fore wing length: 20; fore wing width: 8.0; width of head including eyes: 5.5; pronotum width (including pronotal collar): 7.2; mesonotum width: 6.1. Distribution. China (Shaanxi). Remarks. This species also shows some variability in body color: postclypeus black with apical and lateral portions pale testaceous; pronotum without central longitudinal fascia; mesonotum with two wedge-shaped spots on disk; opercula blackish, with posterior margin fuscous; sternite VIII not flattened at posterior portion. This variation was formerly named as K. fuscoclavalis var. chungnanshana (Chen, 1943). This species can be easily distinguished from other species of Kosemia by the following characteristics: lateral margin of pronotum pale testaceous; fore wing with costal vein remarkably arched, testaceous red., Published as part of Qi, Shengping, Hayashi, Masami & Wei, Cong, 2015, A review of the cicada genus Kosemia Matsumura (Hemiptera: Cicadidae), pp. 451-492 in Zootaxa 3911 (4) on pages 466-468, DOI: 10.11646/zootaxa.3911.4.1, http://zenodo.org/record/235745, {"references":["Chen, K. - F. (1943) New genera and species of Chinese cicadas with synonymical and nomenclatorial notes. Journal of the New York Entomological Society, 51, 39 - 40.","Nast, J. (1972) Palaearctic Auchenorrhyncha (Homoptera). An Annotated check list. Polish Scientific Publishers, Warszawa, 550 pp.","Chou, I., Lei, Z., Li, L., Lu, X. & Yao, W. (1997) The Cicadidae of China (Homoptera: Cicadoidea). Tianze Eldoneio, Hong Kong, 380 pp., 16 pls. [in Chinses with title and partial summary in English]","Sanborn, A. F. (2013) Catalogue of the Cicadoidea (Hemiptera: Auchenorrhyncha), 1 st Edition. Academic Press, USA, 1001 pp."]}

Kosemia yezoensis (Matsumura, 1898) Figures 5���8 Melampsaltria (sic) yezoensis Matsumura, 1898: 17. Cicadetta yezoensis: Oshanin, 1908: 399. Cicadetta sachalinensis Matsumura, 1917: 209. Kosemia yezoensis: Matsumura, 1927: 55. Melampsalta konoi Kato, 1937: 676. Leptopsalta yezoensis: Chou et al., 1997: 50. Material examined. 1 ♂ (NWAFU), Qinghai Prov., Qilian Mountain, vii- 1959, coll. Zhang Yiran; 8 ♂, 1 ♀ (NWAFU), Hebei Prov., Xiaowutai Mountain, 1200���1400m, 22 -viii- 1964, coll. Wang Chunguang; 1 ♂ (NWAFU), Xinjiang Prov., Urumqi Municipality, vii- 1983, coll. unknown; 1 ♀ (NWAFU), Shaanxi Prov., Yan���an County, 22 - vi- 1983, coll. unknown; 1 ♀ (NWAFU), Shaanxi Prov., Yulin County, 7 -vi- 2003, coll. Zhang Yalin; 1 ♂ (NWAFU), Liaoning Prov., Shenyang, 27 -viii- 2008, coll. Sheng Maoling; 47 ♂, 8 ♀ (NWAFU), Inner Mongolia, Helan Mountain, 1487���2400m, 10 -viii- 2010, coll. Zhong Haiying; 1 ♀ (NWAFU), Henan Prov., Yicheng County, 19 -vii- 2012, coll. Yang Mingsheng. Additional material examined. 1 ♀ (NWAFU), Heilongjiang Prov., Baimiaozi, 4 -vii- 1954, coll. unknown. Description. Male. Ground color of body almost black, body (especially head and thoracic nota) densely covered with blackish hairs and sparingly covered with short yellowish metallic hairs. Head (Figs. 5 A���D). Head including eyes narrower than base of mesonotum. Paramedian posterior margin of vertex, supra-antennal plates, lateral margins of postclypeus, base of lorum all somewhat brown. Ocelli reddish orange. Eyes dark brown. Rostrum black, basal joint of rostrum yellow or brown. Thorax (Figs. 5 C���D). Pronotum almost black. Anterior and posterior margins of pronotum brownish yellow or dark brown. Median, reversed Y-shaped elevation brown or yellowish. Lateral part of pronotal collar ampliate and broadly rounded; lateral angle well ampliate posterolaterally. Mesonotum black with two central deltoid spots, lateral margin pale yellow. Cruciform elevation yellowish or light brown. Wings (Figs. 5 A���B). Wings hyaline. Fore wing with costal, basal and ulnar veins olivaceous; anal vein and apical margin dusky; basal membrane sanguineous; veins M and CuA usually meeting basal cell with their stems completely fused as one, but sometimes unstable; infuscation on fore wing cross veins weakly developed in some specimens. Hind wing plaga narrow along vein 2 A to its distal end and around ambient vein of cubital cell 2 and anal cell 1; plaga on 3 A and basal part of jugum also infuscated. Legs (Fig. 5 G). General color dark reddish or pale yellow, with dense, silvery short setae. Fore leg with fasciae on coxa, one or two spot(s) on trochanter, two longitudinal fasciae and tips of femur, tips and longitudinal fasciae of tibiae, all black. Fore femur with three strong spines beneath, all slightly slanted and black, decreasing in size from primary to tertiary spine; a tiny spine divided from tertiary spine. Opercula (Fig. 5 E). Operculum broadly rounded, almost pale yellow and slightly fuscous or black basally, coarsely covered with silvery pubescence. Meracanthus pale yellow with base black. Abdomen (Figs. 5 A���B, E���F). Abdomen longer than head and thorax together, gradually attenuated posteriorly. Timbal with three long ribs. Abdominal tergites almost black, furnished with short metallic yellow pile; tergites I���II almost black; posterior margins of tergites III���VII and posterior portion of tergite VIII dark yellow. Abdominal sternites dark yellow with silvery pilosity, venter with a series of median black spots; sternite VIII slightly shorter than sternite VII. Genitalia (Figs. 6 A���D). Pygofer almost black with basal lobe brown, furnished with long, silvery scattered pubescence and short greyish setae. Dorsal beak of pygofer slightly short and broad, pointed at apex. Upper lobe of pygofer triangular in lateral view, black in basal half, dark brown in apical half. Basal lobe of pygofer shiny brown, tending to be broadly angled in lateral view. Median lobe of uncus small, black, apex somewhat upswept in lateral view, whilst paramedian area slightly convex in ventral view. Clasper shiny dark red or black reddish, slightly elongated, digitate, meeting the other one at base then strongly separated anterolaterally; apex obtuse. Female (Figs. 7 A���D). Body larger and longer than male. Wings with veins somewhat lighter in hue than male. Operculum very small and generally pale yellow, coarsely covered with silvery pubescence, posterior margin rounded; meracanthus black, broadly triangular, very small. Abdominal tergites black, furnished with dense, short silvery pubescence; tergites III���VIII with posterior margins narrowly brownish yellow; tergite IX black dorsally, pale yellow or brownish yellow laterally with two stigma black. Abdominal sternites have a high degree of variability in coloration from entirely pale yellowish to brownish with a central black patch on each sternite; sternite VII with a pair of oblique, anterolateral black patches; median incision in posterior margin very deep and broad, deep to about 4 / 5 the length of sternite VII. Dorsal beak of pygofer black, sharp and slightly reaching beyond anal styles. Ovipositor sheath dark-reddish to black apically, reaching to or slightly beyond apex of dorsal beak. Other morphological characters similar to male. Measurements. (10 ♂♂, 10 ♀♀), mean (range) (in mm). Body length: male 22.5 (21.1���23.5), female 23.8 (20.6���27.1); fore wing length: male 25.9 (22.0���28.0), female 27.4 (23.8���31.4); fore wing width: male 9.8 (9.0��� 10.3), female 10.0 (9.3���10.6); width of head including eyes: male 6.2 (5.6���6.6), female 6.5 (5.7���6.7); pronotum width (including pronotal collar): male 7.8 (6.5���8.3), female 8.1 (6.9���9.2); mesonotum width: male 6.7 (6.0��� 7.2), female 6.8 (5.9���7.5). Distribution. China (Hebei, Inner Mongolia, Liaoning, Heilongjiang, Henan, Shaanxi, Qinghai, Xinjiang), Korea, Mongolia, Japan. Remarks. This species also has some pale-colored forms (Figs. 8 A���B) as in K. admirabilis (Hayashi & Saisho, 2011): dorsum of thorax with pale ochraceous area developed, venter of body more (almost entirely) pale ochraceous. However, it can be distinguished from K. admirabilis by the following characteristics: head including eyes narrower than base of mesonotum; abdomen longer than head and thorax together, male sternite VIII longer than 2 / 3 of sternite VII. In addition, the female specimen from Heilongjiang Province formerly identified as K. chinensis was removed to K. yezoensis as additional material based on its body color and weak infuscation on the fore wing cross veins. The identity of this female specimen needs further investigation when more related specimens become available., Published as part of Qi, Shengping, Hayashi, Masami & Wei, Cong, 2015, A review of the cicada genus Kosemia Matsumura (Hemiptera: Cicadidae), pp. 451-492 in Zootaxa 3911 (4) on pages 457-462, DOI: 10.11646/zootaxa.3911.4.1, http://zenodo.org/record/235745, {"references":["Matsumura, S. (1898) A summary of Japanese Cicadidae with description of a new species. Annotationes Zoologicae Japonenses, 2, 16 - 19.","Oshanin, V. T. (1908) Verzeichnis der palaarktischen Hemipteren mit besonderer Berucksichtigung ihrer Verteilung im Russischen Reiche. II. Band. Homoptera. III. Lieferung. Annuaire de Musee Zoologique de l'Academie Imperiale des Sciences de St. - Petersbourg, 13, 385 - 492.","Matsumura, S. (1917) A list of the Japanese and Formosan Cicadidae, with descriptions of new species and genera. Transactions of the Sapporo Natural History Society, 6, 186 - 212.","Matsumura, S. (1927) New species of Cicadidae from the Japanese Empire. Insecta Matsumurana, 2, 46 - 58, pl. 2.","Kato, M. (1937) Semi (15). Entomological World, 5, 675 - 684.","Chou, I., Lei, Z., Li, L., Lu, X. & Yao, W. (1997) The Cicadidae of China (Homoptera: Cicadoidea). Tianze Eldoneio, Hong Kong, 380 pp., 16 pls. [in Chinses with title and partial summary in English]","Hayashi, M. & Saisho, Y. (2011) The Cicadidae of Japan. Seibundo-shinkosha, Tokyo, 224 pp. [in Japanese]"]}

Kosemia radiator (Uhler, 1896) Figure 32 Melampsalta radiator Uhler, 1896: 276. Cicadetta radiator: Oshanin, 1908: 399. Kosemia radiator: Matsumura, 1927: 55. Leptopsalta radiator: Kato, 1928: 85. Material examined. 1 ♂ (SUU), Mt. Hiwada-yama, Saitama Prefecture, (central) Honshu, Japan, 17 -x- 1980, coll. M. Hayashi leg. Description of male. Ground color of body black, polished, with silvery pile. Head (Fig. 32 A). Head including eyes about as wide as base of mesonotum. Vertex and antennae black. Supraantennal plates, paramedian posterior margin of vertex, lateral margins of postclypeus, all yellowish brown. Ocelli light red. Eyes brown. Rostrum black, reaching to middle coxae. Thorax (Fig. 32 A). Pronotum black with anterior and posterior margins reddish brown; central longitudinal fascia widened posteriorly (where it contains one small black spots) with pale yellowish. Lateral part of pronotal collar slightly ampliate laterally; lateral angle well ampliate posterolaterally. Mesonotum with a slender line in the same color of deltoid yellow spot on each side of disk, which is connected with corresponding deltoid spot and extends posteriorly to anterior arm of cruciform elevation. Cruciform elevation light brown. Wings (Fig. 32 A). Wings hyaline. Fore wing with costal, basal and ulnar veins greenish yellow, anal veins and apical margin dusky; basal membrane sanguineous; veins M and CuA adjacent to one another at basal cell, but not fused as one. Hind wing with a heavy brown infuscation along vein 2 A to its distal end and around ambient vein of cubital cell 2 and anal cell 1; plaga on most of 3 A and basal part of jugum also infuscated. Legs (Fig. 32 A). General color greenish yellow. Fore leg with fasciae of coxa, one or two spot(s) of trochanter, two longitudinal fasciae and tips of femur, tips and longitudinal fasciae of tibiae, all black. Fore femur with three strong spines beneath all slightly slanted and black, decreasing in size from primary to tertiary spine. Abdomen (Fig. 32 A). Abdomen long and narrow, slightly longer than head and thorax together. Abdominal tergites almost black, furnished with dense, short silvery pubescence; tergites I���II almost black; posterior margins of tergites III���VII and lateral side of tergite VIII yellowish brown or dark brown. Abdominal sternites fulvous with dense silvery pile, middle of venter striped with a series of black spots. Genitalia. Dorsal beak of pygofer moderately long and spine-shaped, narrowly pointed at apex. Upper lobe of pygofer broadly triangular in lateral view, apex obtuse; basal lobe of pygofer broadly angled in lateral view. Median lobe of uncus small, apex slightly upswept in lateral view. Clasper moderately elongated, digitate, meeting the other one at base then widely separated anterolaterally, apex obtuse. Measurements. (1 ♂) (in mm). Body length: 20.3; total length including forewings: 29.6. Distribution. Japan. Remarks. This species had been documented from Jilin, Liaoning, Shanxi, Qinghai, Hubei of China (Chou et al., 1997; Hua, 2000; Lee et al., 2002). Recently, Hayashi & Saisho (2011) stated that this species is endemic to Japan, while the specimens collected from North Korea and Northeast China which has been mistakenly identified as K. radiator should be K. admirabilis (for detailed description see above). In our study, we have not found any material of K. radiator from China. Therefore, this species is removed from China cicada fauna., Published as part of Qi, Shengping, Hayashi, Masami & Wei, Cong, 2015, A review of the cicada genus Kosemia Matsumura (Hemiptera: Cicadidae), pp. 451-492 in Zootaxa 3911 (4) on pages 489-490, DOI: 10.11646/zootaxa.3911.4.1, http://zenodo.org/record/235745, {"references":["Uhler, P. R. (1896) Summary of the hemiptera of Japan, presented to the United States National Museum by Professor Mitzukuri. Proceedings of the United States National Museum, 19, 276 - 277. http: // dx. doi. org / 10.5479 / si. 00963801.1108.255","Oshanin, V. T. (1908) Verzeichnis der palaarktischen Hemipteren mit besonderer Berucksichtigung ihrer Verteilung im Russischen Reiche. II. Band. Homoptera. III. Lieferung. Annuaire de Musee Zoologique de l'Academie Imperiale des Sciences de St. - Petersbourg, 13, 385 - 492.","Matsumura, S. (1927) New species of Cicadidae from the Japanese Empire. Insecta Matsumurana, 2, 46 - 58, pl. 2.","Kato, M. (1928) Descriptions of two new genera of Japanese Cicadidae and corredtions of some species. Insect World, 32, 182 - 188.","Chou, I., Lei, Z., Li, L., Lu, X. & Yao, W. (1997) The Cicadidae of China (Homoptera: Cicadoidea). Tianze Eldoneio, Hong Kong, 380 pp., 16 pls. [in Chinses with title and partial summary in English]","Hua, L. - Z. (2000) List of Chinese insects. Vol. I. Zhongshan (Sun Yat-sen) Universisty Press, Guangzhou, 448 pp.","Lee, Y. J., Choe, H. - J., Lee, M. - L. & Woo, K. - S. (2002) A phylogenetic consideration of the Far Eastern Palaearctic species of the genus Cicadetta Kolenati (Homoptera, Cicadidae) based on the mitochondrial COI gene sequences. Journal of Asia- Pacific Entomology, 5, 3 - 11.","Hayashi, M. & Saisho, Y. (2011) The Cicadidae of Japan. Seibundo-shinkosha, Tokyo, 224 pp. [in Japanese]"]}

Haphsa dianensis Chou, Lei, Li, Lu & Yao, 1997 Haphsa dianensis Chou, Lei, Li, Lu & Yao, 1997: 237. Distribution. China (Yunnan); India, Sri Lanka, Bangladesh. Remarks. Chou et al. (1997) merely provided morphological descriptions, measurements and distribution for Haphsa dianensis when they established this species, but they neither provided illustrations/photographs nor assigned the type specimen(s) for this species. Chou et al. (1997) didn’t mention in which institute the materials (12 males and 2 females) they examined were deposited when they established this species. Although Chou et al. (1997) noted this species was widely distributed in Yunnan Province of China, India, Sri Lanka and Bangladesh, no detailed distribution information was provided. In our study, we checked collections of various institutes, including that of NWAFU, but found no related materials. To date, no specimens of Haphsa have been found as identical to H. dianensis, and it is difficult to get a conclusion which species of Haphsa is identical or closes to H. dianensis. Therefore, we don’t include this species in the key in this paper. The identity of this species needs to be addressed when more materials from related areas (i.e., southern China, India, Sri Lanka and Banggladesh, etc.) become available in the future.

Kosemia admirabilis (Kato, 1927) Figures 1���4 Melampsalta admirabilis Kato, 1927: 282. Leptopsalta admirabilis: Kato, 1928: 186. Leptopsalta admirabilis (Kato) var. kishidai Kato, 1932: 395. Leptopsalta kishidai: Kato, 1938 a: 28. Cicadetta admirabilis: Hayashi, 1984: 67. Kosemia admirabilis: Lee, 2008: 458. Material examined. 1 ♂ (Holotype of Melampsalta admirabilis) (UMUT), Kwainei, 22 -viii- 1922, coll., Masayo Kato; 1 ♂ (Holotype of Leptopsalta admirabilis var. kishidai) (UMUT), ���North Hamgyong, Kyongwon County��� (written in Chinese letters), vii- 1931, coll. K. Kishida; 3 ♂, 1 ♀ (NWAFU), Qinghai Prov., Mengda Tianchi National Nature Reserve, 9 -viii- 2012, coll. Lu Lin & Xue Qingquan. Additional material examined. 1 ♂ (NWAFU), Liaoning Prov., Qianshan Mountain, 11 -viii- 1957, coll. unknown. Description. Male. Ground color of body black with silvery pubescence. Head (Figs. 1 A���D). Head including eyes about as wide as base of mesonotum. Supra-antennal plates, paramedian posterior margin of vertex, lateral margins of postclypeus, base of lorum, all yellowish brown. Ocelli dark red. Eyes dark brown. Rostrum black; basal joint of rostrum somewhat yellowish brown. Thorax (Figs. 1 C���D). Pronotum black with anterior and posterior margins red brown; central longitudinal fascia pale yellowish, widened posteriorly, where it contains two small black spots. Lateral parts of pronotal collar ampliate laterally and slightly straight or rounded; lateral angle well ampliate posterolaterally. Mesonotum black with two central deltoid spots, lateral margins pale yellow. Cruciform elevation light brown. Wings (Figs. 1 A���B). Wings hyaline. Fore wing with costal, basal and ulnar veins light brown; anal veins and apical margin dusky; basal membrane sanguineous; veins M and CuA separated when meeting basal cell. Hind wing with a heavy brown infuscation along vein 2 A to its distal end and around ambient vein of cubital cell 2 and anal cell 1; plaga on most of 3 A and basal part of jugum also infuscated. Legs (Fig. 1 G). General color brown or greenish yellow, with silvery pubescence. Fore leg with fasciae on coxa, one or two spot(s) of trochanter, two longitudinal fasciae and tips of femur, tips and longitudinal fasciae of tibiae, all black or black brown. Fore femur with three strong spines beneath, all slightly slanted and black, decreasing in size from primary to tertiary spine. Opercula (Fig. 1 E). Operculum generally pale yellow or pale ochraceous, slightly black at base, coarsely covered with short silvery pubescence; inner margin obtusely angulated; lateral and posterior margins rounded. Meracanthus small, same color with operculum. Abdomen (Figs. 1 A���B, E���F). Abdomen as long as or slightly shorter than head and thorax together. Timbal with three long ribs. Abdominal tergites almost black, furnished with dense, short silvery pubescence; tergites I���II almost black; posterior margins of tergites III���VII and lateral sides of tergite VIII yellowish brown or dark brown. Abdominal sternites fulvous with dense silvery pile, middle part of venter striped with a series of black spots; sternite VIII shorter than 2 / 3 of sternite VII. Genitalia (Figs. 2 A���D). Pygofer black dorsally and posteriorly, dull brownish laterally. Dorsal beak of pygofer moderately long and spine-shaped, narrowly pointed at apex. Upper lobe of pygofer broadly triangular in lateral view, apex obtuse. Basal lobe of pygofer broadly angled in lateral view. Median lobe of uncus small, brownish; apex slightly upswept in lateral view; paramedian area slightly convex in ventral view. Clasper shiny black, moderately elongated, digitate, meeting the other one at base then widely separated anterolaterally; apex obtuse. Female (Figs. 3 A���D). Body, especially abdomen, longer than male and conical, with dense silvery pubescence. Pronotum with a central longitudinal fascia widened posteriorly, where it contains one small black spot. Fore wing with veins M and CuA adjacent to one another at basal cell, but not fused as one. Operculum very small, generally pale yellow, coarsely covered with silvery pubescence, posterior margin rounded; meracanthus small and black, broadly triangular. Abdominal tergites black, furnished with dense, short silvery pubescence; tergite IX black dorsally, pale yellow laterally; two stigma on tergite IX black; posterior margin of sternite VII with median incision very deep and broad, deep to about 4 / 5 the length of sternite VII; a pair of oblique black patches on sternite VII anterolaterally. Dorsal beak of pygofer black and sharp, distinctly reaching beyond anal styles. Ovipositor sheath black, distinctly reaching beyond apex of of dorsal beak. Other morphological characters similar to male. Measurements. (4 ♂♂, 1 ♀), mean (range) (in mm). Body length: male 20.2 (19.7���20.7), female 22; fore wing length: male 24.9 (24.2���26.1), female 25.4; fore wing width: male 8.5 (8.2���8.6), female 8.8; width of head including eyes: male 6.1 (5.9���6.3), female 5.9; pronotum width (including pronotal collar): male 6.8 (6.6 ���7.0), female 6.5; mesonotum width: male 6.1 (5.9���6.4), female 5.8. Distribution. China (Hebei, Liaoning, Shaanxi, Gansu, Qinghai, Ningxia), Korea. Remarks. This species has some pale-colored forms (Figs. 4 C���D): pale ochraceous central longitudinal stripe on pronotum developed and much widened posteriorly, where it contains a black spot; a pair of stripes and cruciform elevation on mesonotum, forewing veins, legs and venter of body mostly pale ochraceous. In addition, we put the male specimen (pygofer damaged) from Liaoning Province as additional material for this species based on its external morphology. The identity of this specimen needs further investigation when more materials, particularly associated males from the same locality, become available. This species may be closely allied to K. radiator (Uhler, 1896), but can be easily distinguished from that species by the following characteristics: body rather slender and much larger; mesonotum has no markings behind the deltoid spot on each side of disk., Published as part of Qi, Shengping, Hayashi, Masami & Wei, Cong, 2015, A review of the cicada genus Kosemia Matsumura (Hemiptera: Cicadidae), pp. 451-492 in Zootaxa 3911 (4) on pages 454-456, DOI: 10.11646/zootaxa.3911.4.1, http://zenodo.org/record/235745, {"references":["Kato, M. (1927) Descriptions of some new Japanese and exotic Cicadidae. Transactions of the Natural History Society of Formosa, 17, 274 - 283.","Kato, M. (1928) Descriptions of two new genera of Japanese Cicadidae and corredtions of some species. Insect World, 32, 182 - 188.","Kato, M. (1932) Monograph of Cicadidae. Sanseido, Tokyo, 450 pp., 32 pls. [in Japanese]","Kato, M. (1938 a) A revised catalogue of Japanese Cicadidae. Bulletin of the Cicadidae Museum, 1, 1 - 50. [in Japanese]","Hayashi, M. (1984) A review of the Japanese Cicadidae. Cicada, 5, 25 - 75. [in Japanese with English summary]","Lee, Y. J. (2008) Revised synonymic list of Cicadidae (Insecta: Hemiptera) from the Korean Peninsula, with the description of a new species and some taxonomic remarks. Proceedings of the Biological Society of Washington, 121, 445 - 467. http: // dx. doi. org / 10.2988 / 08 - 09.1","Uhler, P. R. (1896) Summary of the hemiptera of Japan, presented to the United States National Museum by Professor Mitzukuri. Proceedings of the United States National Museum, 19, 276 - 277. http: // dx. doi. org / 10.5479 / si. 00963801.1108.255"]}

Kosemia mogannia (Distant, 1905), comb. n. Figures 23���27 Quintilia mogannia Distant, 1905: 205. Melampsalta mogannia: Wu 1935: 28. Lycurgus mogannia: Kato, 1956: 102. Cicadetta mogannia: Nast, 1972: 153. Lycurgus sinensis Jacobi, 1944: 9, syn. n. Leptopsalta rubicosta Chou & Lei, 1997: 53, syn. n. Kosemia rubicosta: Sanborn, 2013: 525. Material examined. 1 ♂, 1 ♀ (Type specimens of Quintilia mogannia), China: Hong Kong, coll. J. C. Bowring (BMNH); 1 ♂ (Holotype of Leptopsalta rubicosta), China: Fujian, 14 -vi- 1981, coll., Luo Lizhi; (NWAFU); 1 ♂ (Type of Lycurgus sinensis), China: Fokien (Fujian Prov.), V- 1911, coll. A. Jacobi (MTD); 1 ♀ (Type of Lycurgus sinensis), China: Zhejiang Prov., Ningpo, VII- 1916, coll. A. Jacobi (MTD); 1 ♂ (NWAFU), Fujian Prov., Xianfengling, 14 -vi- 1981, coll. Luo Lizhi; 1 ♂ (NWAFU), Fujian Prov., Wuyishan Nature Reserve, 1 -viii- 1983, coll. Zhang Kechi; 1 ♀ (NWAFU), Fujian Prov., Dehua County, 800���1150 m, 7 -vi- 1960, coll. Ma Chenglin; 1 ♀ (NWAFU), Fujian Prov., Chong���an County, 900���1160 m, 11 -vii- 1963, coll. Zhang Youwei; 1 ♀ (NWAFU), Fujian Prov., Jianyang City, 800���950 m, coll. unknown; 1 ♀ (NWAFU), Shaanxi Prov., Ningqiang County, 860 m, 30 -x- 1973, coll. Lu Jinsheng and Tianchou; 1 ♀ (NWAFU), Hebei Prov., Qianxi County, 24 -v- 1973, coll. unknown; 1 ♀ (NWAFU), Hubei Prov., Shennongjia Forest Region, 26 -vii- 1977, coll. Liu Shengli; 2 ♀ (NWAFU), Fujian Prov., Pingnan City, 15 -vii- 1980, coll. unknown; 1 ♀ (NWAFU), Zhejiang Prov., Fengyang Mountain, 29 -vii- 2007, coll. Wei Jiufeng & Zhang Tiantao. Description. Male. Small cicadas. Body above black, finely with greyish pile. Head (Figs. 23 A���D). Head including eyes slightly narrower than base of mesonotum. Supra-antennal plate dull testaceous. Ocelli reddish. Eyes dark brown. Postclypeus black with dull testaceous laterally, transverse grooves of postclypeus, anteclypeus all black with grey scattered pile. Genae and lora black with dense, long silvery pile. Rostrum dark brown with black tip. Thorax (Figs. 23 C���D). Pronotum black with margins testaceous; central longitudinal fascia widened posteriorly, where it contains three small testaceous spots. Lateral part of pronotal collar slightly ampliate laterally and rounded; lateral angle well ampliate posterolaterally. Mesonotum with two central, discal, wedge-shaped fasciae; lateral margin and cruciform elevation testaceous. Wings (Figs. 23 A���B). Wings semi-transparent with basal half infuscated and venation fuscous. Fore wing with costal veins, basal membrane and extreme base testaceous; veins M and CuA narrowly separated when meeting at basal cell. Legs (Fig. 23 G). General color piceous; mid and hind tibiae annulated apically and basally with pale ochraceous. Fore femur with three spines: primary spine more slanted; secondary spine half as long as primary spine, almost erected; tertiary spine one-third as long as primary spine, slightly slanted. Opercula (Fig. 23 E). Operculum black in basal half, testaceous in apical half, coarsely covered with greyish pile; lateral margin of operculum slightly oblique. Meracanthus black to testaceous towards apex. Abdomen (Figs. 23 A���B, E���F). Abdomen slightly longer than head plus thorax. Timbal with three long ribs. Abdominal tergites piceous, with posterior margins of tergites III���VII and posterior portion of tergite VIII testaceous. Abdominal sternites testaceous with silvery scattered pile; sternites II���VII with a series of central piceous spots; sternite VII tapering posteriorly, with posterior margin obtuse; sternite VIII distinctly shorter than sternite VII, hind margin rounded. Genitalia (Figs. 24 A���D). Pygofer black at base, pale ochraceous laterally and pale testaceous posteriorly. Upper lobe of pygofer broadly triangular in lateral view, with apex obtuse. Median lobe of uncus small, apex slightly upswept in lateral view, paramedian area slightly convex in ventral view. Clasper moderately elongated, finger-shaped, apex obtuse, meeting the other one at base then separated anterolaterally. Female (Figs. 25 A���D). Female longer than male. Body beneath more testaceous red than in male, with short, dense golden pile. Operculum very small, posterior margin rounded. Abdominal tergites piceous, with dense, short silvery pile; posterior margins of tergites II���VII, posterior portion of tergite VIII all brightly testaceous; tergite IX brightly testaceous with a piceous Y-shaped marking dorsal-laterally, reaching to apex of dorsal beak. Abdominal sternites testaceous, with very small fuscous spot on posterior margin of each sternite (sometimes without such spot in some specimens); posterior margin of sternite VII with median incision very deep and broad, deep to about 4 / 5 the length of sternite VII; two oblique dark-reddish patches on anterolateral parts of sternite VII; two stigma of tergite IX dark-red. Dorsal beak of pygofer sharp, reaching beyond anal styles. Ovipositor sheath dark-reddish to black posteriorly, protruding beyond apex of dorsal beak. Other morphological characters similar to male. Measurements. (2 ♂♂, 9 ♀♀), mean (range) (in mm). Body length: male 15.2 (14.2���16.8), female 21.1 (20.8���22.5); fore wing length: male 17.8 (17.0��� 18.5), female 20.7 (20.0��� 22.6); fore wing width: male 6.5 (6.4���6.6), female 7.4 (7.0���8.0); width of head including eyes: male 4.7 (4.7 ��� 4.7), female 5.3 (5.1���5.6); pronotum width (including pronotal collar): male 6.0 (5.9 ���6.0), female 6.9 (6.6���7.4); mesonotum width: male 4.9 (4.8 ���5.0), female 5.8 (5.4���6.2). Distribution. China (Hebei, Zhejiang, Fujian, Hong Kong). Remarks. The species was described by Distant (1905) under the genus Quintilia from Hong Kong, China. However, examination of the holotype and paratype (Figs. 26 A���B) of this species deposited in BMNH revealed that this species is a member of Kosemia. Furthermore, Kosemia rubicosta (Chou & Lei, 1997) (transferred from Leptopsalta by Sanborn (2013)) is proposed as a junior synonym of K. mogannia, based on morphology and the same type locality of related specimens. Regarding to the status of Lycurgus sinensis Jacobi, 1944 (Figs. 27 A���E), Jacobi (1944) described this species from Ningbo, Zhejiang Prov. of China. However, examination of the type specimens of this species deposited in MTD revealed that this species also should be a junior synonym of K. mogannia, based on morphology and the near type locality of related specimens. This species can be easily distinguished from other species of Kosemia by the following characteristics: fore wing with basal half infuscated, and operculum black in basal half and testaceous red in apical half., Published as part of Qi, Shengping, Hayashi, Masami & Wei, Cong, 2015, A review of the cicada genus Kosemia Matsumura (Hemiptera: Cicadidae), pp. 451-492 in Zootaxa 3911 (4) on pages 479-484, DOI: 10.11646/zootaxa.3911.4.1, http://zenodo.org/record/235745, {"references":["Wu, C. F. (1935) Order XV. Homoptera. Catalogus Insectorum Sinensium, 2, 1 - 252.","Kato, M. (1956) The biology of the cicadas. Iwasakishoten Co., Tokyo, 319 pp., 46 pls. [in Japanese]","Nast, J. (1972) Palaearctic Auchenorrhyncha (Homoptera). An Annotated check list. Polish Scientific Publishers, Warszawa, 550 pp.","Jacobi, A. (1944) Die Zikadenfauna der Provinz Fukien in Sudchina und ihre tiergeographischen Beziehungen. Mitteilungen der Munchener Entomologischen Gesellschaft, 34, 5 - 66.","Chou, I., Lei, Z., Li, L., Lu, X. & Yao, W. (1997) The Cicadidae of China (Homoptera: Cicadoidea). Tianze Eldoneio, Hong Kong, 380 pp., 16 pls. [in Chinses with title and partial summary in English]","Sanborn, A. F. (2013) Catalogue of the Cicadoidea (Hemiptera: Auchenorrhyncha), 1 st Edition. Academic Press, USA, 1001 pp."]}

Haphsa lueta sp. n. (Figs. 1–3) Type material. Holotype: ♂ (NWAFU), China: Mt. Jianfengling, Hainan Province, 7.iv. 1983. Paratypes: China, Hainan Province: 1 ♂ (NWAFU), Mt. Wuzhishan, 670 m, light trap, 7.iv. 2008, coll. Yang Zhaofu & Men Qiulei; 1 ♀ (NWAFU), Mt. Wuzhishan, 700 m, light trap, 7.iv. 2008, coll. Yang Zhaofu & Fu Qiang; 1 ♂ (NWAFU), Mt. Limuling, 680 m, light trap, 18.iv. 2008, coll. Zheng Jianwu & Men Qiulei; 1 ♀ (NWAFU), Mt. Jianfengling, 980 m, light trap, 5.v. 2008, coll. Fu Qiang; 1 ♀ (NWAFU), Mt. Jianfengling, 980 m, light trap, 6.v. 2008, coll. Fu Qiang; 1 ♂ 1 ♀ (NWAFU), Mt. Jianfengling, 980 m, light trap, 8.v. 2008, coll. Fu Qiang; 1 ♀ (NWAFU), Mt. Jianfengling, 980 m, light trap, 9.v. 2008, coll. Fu Qiang; 1 ♂ (NWAFU), Mt. Bawangling, 176 m, light trap, 15.v. 2008, coll. Men Qiulei & Fu Qiang; 2 ♀♀ (NWAFU), Mt. Bawangling, 176 m, light trap, 17.v. 2008, coll. Men Qiulei & Fu Qiang; 1 ♀ (NWAFU): Mt. Bawangling, 176 m, light trap, 18.v. 2008, coll. Men Qiulei & Fu Qiang; 1 ♀ (NWAFU): Mt. Jianfengling, 960 m, light trap, 29.v. 2011, coll. Yang Mingsheng. Measurements (in mm). (5 ♂♂, 9 ♀♀): Body length: male 30.0–33.0, female 32.7–33.9; fore wing length: male 41.7–42.8, female 41.7–44.1; fore wing width: male 12.8–13.9, female 12.1–13.5; width of head including eyes: male 10.7–11.8, female 10.8–11.6; pronotum width (including pronotal collar): male 11.0– 12.8, female 10.9– 11.9; mesonotum width: male 8.9–9.8, female 9.0– 9.7. Etymology. The species name is an arbitrary combination of letters, and is regarded as feminine. Description of male. Head (Figs. 1 A, B, 2 A). Slightly wider than mesonotum. Olivaceous with the following black markings: a median upside-down triangle marking enclosing ocelli and reaching frontoclypeal suture; a Vshaped folding line extending from medial supra-antennal plate to posterior ends of each eye. Eyes brown and ocelli red. Postclypeus greenish-tawny with black arrowhead shaped marking in dorsal view and a rounded spot in the middle part; black transverse grooves on each side, with pair of big black patches apically. Anteclypeus olivaceous-tawny along midline, black laterally and on posterior margin, sparsely covered with white pruinosity. Rostrum light olivaceous-tawny, with black apex, extending to posterior coxae. Thorax (Figs. 1 A, 2 A). Generally olivaceous-tawny. Pronotum disk with following black markings: pair of central longitudinal fasciae, extending from anterior margin of pronotum to pronotal collar, curved outward and dilated both anteriorly; pair of longitudinal fasciae between median parts of paramedian oblique fissures and posterior ends of lateral oblique fissures; pair of oblique fasciae along lateral fissures; lateral margins of pronotum disk black. Pronotal collar generally olivaceous-tawny, with two pairs of fuscous fasciae laterally; lateral margins with black fasciae and small teeth. Mesonotum olivaceous-tawny with following black markings: a medial black longitudinal fascia slightly dilated posteriorly; pair of longitudinal fasciae along medial parapsidal suture; pair of small upside-down triangular markings anteriorly between parapsidal sutures and lateral sigillae; a broad, interrupted fasciae along each lateral sigilla; pair of small spots on scutal depressions. Cruciform elevation olivaceous-tawny with black markings on anterior angles. Golden pile in depressions and along lateral mesonotum. Legs (Fig. 1 B). Mostly olivaceous-tawny. Fore femora sparsely covered with white pruinosity, with black marking near posterior margin in lateral view; fore femora with three spines, primary spine and secondary spine pointed oblique to femur, and parallel to each other, subapical spine shortest, angled slightly. Tibiae fuscous basally and distally. Tarsi testaceous. Pretarsal claws testaceous basally and fuscous distally. Wings (Fig. 1 A, B). Hyaline, fore wing with fuscous spots at bases of second and third apical cells. Costal vein green ochre. Basal membrane of fore wing and hind wing jugum tinged greyish-green. Abdomen (Figs. 1 A, B, 2 B). Equal to distance from head to cruciform elevation. Conical and mostly dark brown, covered with short silvery pile and white pruinosity. Tergites 2–8 with black markings on anterior margins. Timbal covers olivaceous-tawny, large and concealing timbals completely in dorsal view. Opercula olivaceoustawny, spoon-shaped, and diverging from posterior margin of sternite II, rounded apices extending to middle of abdominal sternites IV. Abdominal sternites mostly olivaceous-tawny, coloration more developed on sternites VI and VII. Epipleurites mostly black, with white pruinosity. Male genitalia (Fig. 2 C, D). Pygofer elliptical in ventral view, with long, golden pile. Basal lobe of pygofer thin and long, curved outward, and covered with long golden pile. Anal styles light brown. Uncus fuscous to black. Median uncal lobes membranous with a pair of processes medially and separated from each other. Lateral uncal lobes long, gradually narrowed and curved anteriorly, with apex pointed; inner margins distinctly convex subbasally. Description of female (Fig. 3). Opercula broadly separated from each other, posterior margin just extending to abdominal sternite II. Abdominal segment 9 fuscous, with a black median upside-down triangle marking in dorsal view and a big black irregular marking in ventral view; ovipositor sheath black, extending beyond segment 9, posterior margin of segment 7 incised at middle. Other characteristics similar to male. Distribution. China (Hainan). Remarks. This new species is similar to H. apicoinfuscata externally, but can be easily distinguished from the latter by its larger body size, markings on abdominal tergites, the absence of infuscation on the apical portion of the fore wings, and the shape of male uncal lobes.

Kosemia yamashitai (Esaki & Ishihara, 1950) Figures 9���11 Melampsalta yamashitai Esaki & Ishihara, 1950: 40. Cicadetta yamashitai: Nast, 1972: 155. Leptopsalta yamashitai: Chou et al., 1997: 51. Kosemia yamashitai: Sanborn, 2013: 525. Material examined. Holotype ♂ (ELKU), Henglingkan, Shansi, 12 -v- 1942, H. Yamashita leg.; allotopotype ♀ (ELKU), same data as holotype; 1 ♂ (NWAFU), Shaanxi Prov., Fengxian County, 28 -v- 1974, coll. Gu Zhixiang; 2 ♂ (NWAFU), Gansu Prov., Gangu County, v- 1982, coll. Zhang Guisheng; 1 ♂ (NWAFU), Zhejiang Prov., Fengyang Mountain, 20 -vii- 1982, coll. unknown; 1 ♂ (NWAFU), Shaanxi Prov., Taibai Mountain, 2100m, 10 -vi- 1983, coll. unknown; 1 ♂ (NWAFU), Shaanxi Prov., Ningshan County, vi- 1984, coll. unknown; 1 ♂ (NWAFU), Shaanxi Prov., Fengxian County, vii- 1974, coll. Xie Liping; 1 ♂ (NWAFU), Shaanxi Prov., Yangling Agricultural Hi-tech Industries Demonstration Zone, 2 -vi- 1986, coll. Zhou Jingruo; 1 ♂ (NWAFU), Gansu Prov., Maiji Mountain, 1300m, coll. Tang Qiaorui; 1 ♀ Hubei Prov., Shennongjia, 800-1300m, 19 -vii- 2003, coll. Sun Hongyan; 1 ♂, 1 ♀ (NWAFU), Shaanxi Prov., Yangling Agricultural Hi-tech Industries Demonstration Zone, 520m, 7 -vi- 2013, coll. Qi Shengping. Description. Male. Ground color of body black, body (especially head and thoracic nota) densely covered with blackish hairs and gold pubescence. Head (Figs. 9 A���D). Head including eyes slightly narrower than base of mesonotum. Supra-antennal plates slightly brown. Ocelli orange-reddish. Eyes dark brown. Postclypeus black with dark brown laterally. Gena and anteclypeus black with dense, long silvery pile. Antennae, lora and two-thirds of rostrum black. Thorax (Figs. 9 C���D). Pronotum black, with marginal area, especially on the brown posterior margin, densely covered with blackish hairs and gold pubescence laterally; pronotum also with a reversed Y-shaped elevation, black or slightly brown. Lateral part of pronotal collar ampliate and rounded; lateral angle well ampliate posterolaterally. Mesonotum black except for brown cruciform elevation, with dark brown setae around. Wings (Figs. 9 A���B). Fore wing hyaline with dark brown veins, which are darkened apically; costal membrane and costal vein light brown; basal membrane sanguineous; veins M and CuA contiguous only at basal points. Hind wing plaga narrowly along vein 2 A to its distal end and around ambient vein of cubital cell 2 and anal cell 1; plaga on most of 3 A and basal part of jugum also infuscated. Legs (Fig. 9 G). General color black with light brownish setae. Front coxa black with base, apex and marginal parts brown. Anterior trochanter black, with apical margin brown. Fore femur with three strong spines beneath, all slightly slanted, black at base and shiny reddish apically, decreasing in size from primary to tertiary spine; a tiny spine divided from tertiary spine. Mid and hind legs much lighter in hue as compared with fore legs, with light brownish setae. Opercula (Fig. 9 E). Operculum generally dark brownish and slightly darkened basally, coarsely covered with light brownish pubescence; inner margin rounded; lateral margin weakly oblique; posterior margin slightly rounded. Meracanthus dark brownish. Abdomen (Figs. 9 A���B, E���F). Abdomen about as long as head and thorax together. Timbal with two long ribs. Abdominal tergites almost black, furnished with short gold pubescence, gradually attenuated posteriorly; tergites I���II almost black; posterior margins of tergites III���VII and posterior portion of tergite VIII brown. Abdominal sternites almost black with light brownish, dense setae; posterior margin of each sternite and posterior half of terminal segment brown. Genitalia (Figs. 10 A���D). Pygofer black dorsally, brown laterally. Dorsal beak of pygofer slightly short and broad, pointed at apex. Upper lobe of pygofer slightly concave, distant from dorsal beak, rounded in lateral view. Basal lobe of pygofer tending to be broadly angled in lateral view. Median lobe of uncus small, black, apex slightly upswept in lateral view, paramedian area slightly convex in ventral view. Clasper shiny black reddish, slightly elongated, digitate, meeting the other one at base then moderately separated anterolaterally; apex obtuse. Female (Figs. 11 A���D). Body, especially abdomen, longer than male. Supra-antennal plates slightly pale testaceous. Wings with veins lighter in hue than male. Operculum very small, dark brown, posterior margin rounded; meracanthus black, broadly triangular, very small. Abdominal sternites light brown, furnished with short silvery pile; middle of venter striped with a series of large, black spots; posterior margin of sternite VII with median incision very deep and broad, deep to about 4 / 5 the length of sternite VII; a pair of oblique black patches on anterolateral parts of sternite VII. Dorsal beak of pygofer black and sharp, reaching beyond anal styles. Ovipositor sheath dark-reddish, slightly protruding beyond apex of dorsal beak. Other morphological characters similar to male. Measurements. (9 ♂♂, 2 ♀♀), mean (range) (in mm). Body length: male 18.3 (16.6 ���19.0), female 20.3 (19.3���21.3); fore wing length: male 19.0 (17.1���20.7), female 21.0 (20.5���21.5); fore wing width: male 6.9 (6.4���7.4), female 7.9 (7.6���8.2); width of head including eyes: male 5.1 (4.6���5.3), female 5.5 (5.2���5.8); pronotum width (including pronotal collar): male 6.6 (6.3 ���7.0), female 7.4 (7.3���7.4); mesonotum width: male 5.5 (4.8���5.7), female 6.3 (6.2���6.3). Distribution. China (Shanxi, Hubei, Shaanxi, Gansu, Ningxia). Remarks. This species is allied to K. yezoensis. However, it can be distinguished from the latter by the following characteristics: body size smaller; mesonotum black except for brown cruciform elevation; male abdominal sternites black with posterior margin of each segment brown., Published as part of Qi, Shengping, Hayashi, Masami & Wei, Cong, 2015, A review of the cicada genus Kosemia Matsumura (Hemiptera: Cicadidae), pp. 451-492 in Zootaxa 3911 (4) on pages 463-466, DOI: 10.11646/zootaxa.3911.4.1, http://zenodo.org/record/235745, {"references":["Esaki, T. & Ishihara, T. (1950) Hemiptera of Shansi, North China. Hemiptera. Homoptera. Mushi, 21, 39 - 48, 3 pls.","Nast, J. (1972) Palaearctic Auchenorrhyncha (Homoptera). An Annotated check list. Polish Scientific Publishers, Warszawa, 550 pp.","Chou, I., Lei, Z., Li, L., Lu, X. & Yao, W. (1997) The Cicadidae of China (Homoptera: Cicadoidea). Tianze Eldoneio, Hong Kong, 380 pp., 16 pls. [in Chinses with title and partial summary in English]","Sanborn, A. F. (2013) Catalogue of the Cicadoidea (Hemiptera: Auchenorrhyncha), 1 st Edition. Academic Press, USA, 1001 pp."]}

Haphsa jsguillotsi (Boulard, 2005), new record to China (Figs. 7���8) Meimuna jsguillotsi Boulard, 2005 a: 121. Haphsa jsguillotsi, Boulard, 2008: 32. Material examined. 1 ♂ (NWAFU), China: Mt. Nuoshan, Menghai County, Yunnan Province, 1200 m, 24.iv. 1957, coll. Zang Lingchao; 1 ♂ (NWAFU), China: Mena Village, Xishuangbanna, Yunnan Province, 1050 m, 11.v. 1958; 1 ♂ (NWAFU), China: Shuangjiang County, Yunnan Province 888 m, light trap, 28.v. 1980, coll. Liu Fen. Measurements (in mm). (3 ♂♂): Body length: 21.0��� 22.8; fore wing length: 31.1���32.9; fore wing width: 9.1��� 10.4; width of head including eyes: 7.6���8.2; pronotum width (including pronotal collar): 8.0��� 8.1; mesonotum width: 6.4���7.6. Description of male. Head (Figs. 7 A, B, 8 A). Head testaceous, about 1.1 or 1.2 X as wide as mesonotum and sparsely covered with golden pile, with a median upside-down trapezoid marking enclosing ocelli; a broad Vshaped folding line extends from medial supra-antennal plate to posterior ends of each eye and connects to the trapezoid marking. Eyes fuscous, ocelli dark red. Postclypeus fairly prominent, ochre with big black spots near frontoclypeal suture and apical part; transverse grooves black, and coloration reduced in middle grooves. Anteclypeus ochre along midline, black laterally. Rostrum light ochre, very long, with fuscous apex extending to half of abdominal sternite II. Thorax (Figs. 7 A, 8 A). Pronotum slightly longer than head, generally light brown. Pronotum disk with following black markings: pair of central longitudinal fasciae, extending from anterior margin of pronotum to pronotal collar, curved outward and dilated both anteriorly and posteriorly; pair of obliquely longitudinal fasciae extending from median parts of paramedian fissures to lateral fissures; pair of fasciae along lateral fissure. Lateral margins of pronotum disk black. Pronotal collar generally olivaceous-tawny, with pair of black markings and two pairs of faint ochreous markings laterally; lateral margins of pronotal collar with pair of black markings and small teeth. Mesonotum fundamentally light brown, with following black markings: a medial black sagittal feature becoming a rhombus towards the cruciform elevation; a pair of broad, irregular fasciae along each parapsidal suture; pair of small black fasciae between parapsidal sutures and lateral sigilla; a huge fasciae along each lateral sigilla, enclosing a small tawny spot; pair of spindly spots on scutal depressions. Cruciform elevation olivaceoustawny with black markings on distal anterior arm. Golden pile in depressions and along lateral mesonotum. Legs (Fig. 7 B). Mostly tawny. Femora, tibiae fuscous basally and distally. Tarsi testaceous distally. Pretarsal claws fuscous. Fore femora distinctly swollen, with three spines fuscous. Wings (Fig. 7 A, B). Hyaline, fore wing with fuscous spots at bases of second and third apical cells. Basal membrane of fore wing tinged light brown. Hind wing jugum not tinged. Abdomen (Figs. 7 A, B, 8 B). Fairly dark brown, slightly longer than distance from head to cruciform elevation. Lateral sides of tergites 2���4 and posterior margins of tergites 2���8 ochre. Tymbal covers wide and long, their lateral margins far from the opercula. Opercula ochre, spoon-shaped, ventrally very close but not adjoining and diverging from the posterior margin of the sternite II; pointed apices extending to two thirds of sternite V. Sternites mostly testaceous, with irregular fuscous markings. Epipleurites fuscous basally and ochre apically. Male genitalia (Fig. 8 C, D). Pygofer elliptical in ventral view, with long, golden pile. Basal lobes of pygofer broad and curved inward. Anal styles light brown and uncus fuscous. Median uncal lobes light brown and fused distally. Lateral uncal lobes fuscous, curved anteriorly, with acute apex distally. Description of female. Body slightly larger than male; pronotal collar teeth more pronounced; abdomen conical, yellowish brown with ochre markings and black apically; ovipositor sheath relatively long, with black at the apex and extending beyond segment 9. Other characteristics similar to male (Boulard, 2013). Distribution. China (Yunnan), Thailand. Remarks. This is a small Haphsa species, and its body color is light brown, making it difficult to be detected in the field (Boulard, 2013). It is similar to H. stellata Lee, 2009 in the small body size and the shape of the uncal lobes, but it can be distinguished from the latter by the absence of the X-shaped marking on the postclypeus and the longer male opercula., Published as part of Wang, Xu, Yang, Mingsheng & Wei, Cong, 2015, A review of the cicada genus Haphsa Distant from China (Hemiptera: Cicadidae), pp. 408-424 in Zootaxa 3957 (4) on pages 416-418, DOI: 10.11646/zootaxa.3957.4.3, http://zenodo.org/record/253752, {"references":["Boulard, M. (2005 a) Taxonomie et statut acoustique de huit cigales thailandaises, incluant cinq especes nouvelles [Rhynchota, Cicadoidea, Cicadidae]. Revue Francaise d'Entomologie, 27 (3), 117 - 143.","Boulard, M. (2008) Les cigales thaies. Liste actualisee incluant la description de deux nouveaux genres, de sept especes nouvelles et les Cartes d'identite Acoustique (CIA) de Chremistica siamensis Bregman et de Leptopsaltria samia (Walker) (Rhynchota, Cicadomorpha, Cicadidae). Ecole Pratique des hautes Etudes, Biologie et Evolution des Insectes Hemipteroidea, 18, 1 - 112.","Boulard, M. (2013) The Cicadas of Thailand. Vol. 2. Taxonomy and Sonic Ethology. Siri Scientific Press, Manchester, 1 - 436.","Lee, Y. J. (2009) Taxonomic notes on the genus Haphsa (Hemiptera: Cicadidae) with descriptions of two new species. Florida Entomologist, 92, 330 - 337. http: // dx. doi. org / 10.1653 / 024.092.0218"]}

Key to the males of the species of Kosemia Matsumura 1. Fore wing with basal half infuscated...................................................... K. mogannia comb. n. - Fore wing hyaline without infuscations.................................................................... 2 2. Abdominal sternites mostly black with narrow testaceous red posterior margins; male clasper with a tiny spine at the median part of inner margin.................................................................. K. chinensis comb. n. - Abdominal sternites not as above; clasper without such tiny spine............................................... 3 3. Veins M and CuA of fore wing fused at basal cell................................................... K. yezoensis - Veins M and CuA of fore wing contiguous at basal cell but not fused............................................. 4 4. Vertex generally reddish brown; mesonotum castaneous or brown............................................... 5 - Vertex generally black; mesonotum black with some heterochromatic markings.................................... 6 5. Abdominal tergites castaneous with narrow ochraceous posterior margins; clasper with basal half closely meeting the other one, apical half nearly straight............................................................. K. castanea sp. n. - Abdominal tergites black with narrow yellow posterior margins; clasper meeting the other one at base then strongly curved anterolaterally..................................................................... K. guanzhonensis sp. n. 6. Fore wing with costal vein remarkably arched, testaceous red...................................... K. fuscoclavalis - Fore wing with costal vein almost straight or slightly arched, olivaceous, light brown or pale ochraceous................ 7 7. Mesonotum with two central deltoid spots always distinctly pale yellow; cruciform elevation large, with anterior arms dis- tinctly longer than posterior arms......................................................................... 8 - Mesonotum entirely black or with two central deltoid spots fuzzy brown; cruciform elevation small, with anterior arms as long as posterior arms...................................................................................... 9 8. Mesonotum with a slender line in the same color of deltoid spot on each side of disk, which is connected with corresponding deltoid spot and extends posteriorly to anterior arm of cruciform elevation................................ K. radiator - Mesonotum without markings behind the deltoid spot on each side of disk............................. K. admirabilis 9. Venter of abdomen black or black brown......................................................... K. yamashitai - Venter of abdomen reddish brown or tawny................................................................ 10 10. Postclypeus black with a tawny or reddish brown patch apically; abdominal sternite VII smoothly narrowing caudally; upper lobe of pygofer large, with apex broadly rounded in lateral view.......................................... K. phaea - Postclypeus black, without markings; abdominal sternite VII broad at base and abruptly narrowed at half length; upper lobe of pygofer small, with apex somewhat acute in lateral view............................................ K. prominentis, Published as part of Qi, Shengping, Hayashi, Masami & Wei, Cong, 2015, A review of the cicada genus Kosemia Matsumura (Hemiptera: Cicadidae), pp. 451-492 in Zootaxa 3911 (4) on pages 453-454, DOI: 10.11646/zootaxa.3911.4.1, http://zenodo.org/record/235745

Qi, Shengping, Hayashi, Masami, Wei, Cong (2015): A review of the cicada genus Kosemia Matsumura (Hemiptera: Cicadidae). Zootaxa 3911 (4): 451-492, DOI: http://dx.doi.org/10.11646/zootaxa.3911.4.1

Haphsa karenensis (Ollenbach, 1928), new record to China (Figs. 9���11) Haphsa karenensis Ollenbach, 1928: 273. Meimuna nauhkae, Boulard, 2005 b: 40. Material examined. 1 ♀ (NWAFU), China: Mangshi, Yunnan Province, 900 m, 16.v. 1955, coll. Xue Yufeng; 1 ♂ (NWAFU), China: Xishuangbannan, Yunnan Province, 650 m, 1.v. 1964, coll. Zhang Baolin; 1 ♂ (NWAFU), China: Zhenyuan County, Yunnan Province, 1020 m, 4.vi. 1971, coll. Zhou Yao & Yuan Feng; 1 ♂ (NWAFU), China: Menglun County, Xishuangbanna, Yunnan Province, 640 m, 21.iv. 1974, coll. Zhou Yao & Yuan Feng; 1 ♂ (NWAFU), China: Menglun County, Xishuangbanna, Yunnan Provinc, 570 m, 1.v. 1974, coll. Zhou Yao & Yuan Feng; 2 ♂♂ (NWAFU), China: Mengla County, Xishuangbanna, Yunnan Province, 11.iv. 1994, coll. Wang Dun & Du Yuzhou; 1 ♂ (NWAFU), China: Daluo County, Yunnan Province, 679 m, 22.v. 2011 coll. Chen Xiao; 1 ♂ (NWAFU), China: Jingdong County, Yunnan Province, 2459 m, 10.vi. 2011, coll. Lv Lin; 1 ♀ (NWAFU), China: Jingdong County, Yunnan Province, 2.vi. 2013, coll. Yang Mingsheng. Measurements (in mm). (8 ♂♂, 2 ♀♀): Body length: male 28.8���30.1, female 30.1���30.3; fore wing length: male 39.7���41.6, female 41.0��� 41.6; fore wing width: male 11.8���13.1, female 12.1���12.4; width of head including eyes: male 9.3���10.2, female 10.0��� 10.2; pronotum width (including pronotal collar): male 10.0���11.0, female 10.3��� 10.8; mesonotum width: male 8.3���9.3, female 8.6���8.7. Description of male. Head (Figs. 9 A, B, 10 A). Wider the mesonotum, olivaceous-tawny with the following black markings: a median hourglass shaped marking enclosing ocelli; pair of broad rectangle markings extending from medial supra-antennal plate to lateral side of lateral ocellus; pair of thin fasciae connected to posterior ends of rectangle markings, extending to eyes. Eyes green, ocelli red. Postclypeus fairly prominent, ochre with black rhombic marking near frontoclypeal suture; transverse grooves black, and coloration more developed in apical grooves. Anteclypeus ochre along midline, black laterally. Rostrum light ochre, with fuscous apex reaching base of abdominal sternite I. Thorax (Figs. 9 A, 10 A). Pronotum slightly wider than head, generally ochre. Pronotum disk with following black markings: pair of central longitudinal fasciae, extending from anterior margin of pronotum to pronotal collar, curved outward and dilated both anteriorly and posteriorly; pair of small spots lied on anterior margin of pronotum disk; rather indistinct light brown fasciae between paramedian and lateral fissures. Pronotal collar generally ochre, with two pairs of light brown fasciae laterally; margins of pronotal collar black and lateral margins bearing a small tooth in their middle, ochre. Mesonotum olivaceous-tawny, with following black markings: a medial black sagittal feature becoming a rhombus towards the cruciform elevation; a broad, interrupted fasciae along each lateral sigilla; pair of small black fasciae between parapsidal sutures and lateral sigilla; pair of small spots on scutal depressions. Cruciform elevation olivaceous-tawny with black anterior apical parts and median posterior margin. Legs (Fig. 9 B). Mostly tawny. Fore femora with black markings near posterior margin in lateral view. Tibiae fuscous basally and distally. Tarsi testaceous distally. Pretarsal claws fuscous. Fore femora with three spines tawny. Wings (Fig. 9 A, B). Hyaline, fore wing with fuscous spots at bases of second and third apical cells. Costal vein green ochre. Basal membrane of fore wing tinged with light yellow. Hind wing jugum not tinged with light yellow. Abdomen (Figs. 9 A, B, 10 B). Fairly dark brown, shorter than distance from head to cruciform elevation. Tergites 2���8 with black markings on anterior margins. Timbal covers semicircular and tawny. Opercula long, wide and ochre, their medial edges diverging at the level of the posterior margin of sternite II; rounded apices extending to middle of sternite VI. Sternites mostly ochre, with testaceous on sternite VIII. Epipleurites ochre, with fuscous to black patches. Male genitalia (Fig. 10 C, D). Pygofer elliptical in ventral view, with long, golden pile. Basal lobes of pygofer narrow and adjacent to lateral side of pygofer. Anal styles fuscous. Uncus fuscous to black. Median uncal lobe short, membranous and fused. Lateral uncal lobe broad and developed, parallel to each other, and slightly curved inward distally. Description of female (Fig. 11). Opercula smaller than those of male, broadly separated from each other, posterior margin just extending to abdominal sternite II.; Abdominal segment 9 mostly tawny, with black patches circled; ovipositor sheath relatively long, extending beyond segment 9, posterior margin of segment VII incised at middle. Other characteristics similar to male. Distribution. China (Yunnan), Thailand. Remarks. This species is similar to H. karenensis in the male genitalia and the shape of uncal lobe, but can be easily distinguished from the latter by the combination of the following characters: hyaline apical portion of fore wing, smaller body size and wider base of male operculum. This species is also similar to H. conformis, but can be easily distinguished from the latter by the lesser wingspan and the shorter male opercula., Published as part of Wang, Xu, Yang, Mingsheng & Wei, Cong, 2015, A review of the cicada genus Haphsa Distant from China (Hemiptera: Cicadidae), pp. 408-424 in Zootaxa 3957 (4) on pages 419-422, DOI: 10.11646/zootaxa.3957.4.3, http://zenodo.org/record/253752, {"references":["Ollenbach, O. C. (1928) New species of Cicadidae and Fulgoridae from India and Burma. (Hemiptera). Indian Forest Records, Calcutta, 13 (6), 271 - 282.","Boulard, M. (2005 b) Donnees statutaires et ethologiques sur des cigales thailandaises, incluant la description de huit especes nouvelles, ou mal connues. Ecole Pratique des Hautes Etudes, Travaux du Laboratoire Biologie et Evolution des Insectes Hemipteroidea, 15, 5 - 57."]}

Genus Kosemia Matsumura, 1927 Kosemia Matsumura, 1927: 55. Type species: Cicadetta sachalinensis Matsumura, 1917 [Type locality: Russia (���Saghalien (Odomari, Toyohara)���)], by original designation. Leptopsalta Kato, 1928: 185. Type species: Melampsalta radiator Uhler, 1896 [Type locality: Japan], by original designation. Karapsalta Matsumura, 1931: 1233. [nomen nudum] Type species: Cicadetta sachalinensis Matsumura, 1917 [Type locality: Russia (���Saghalien (Odomari, Toyohara)���)], by monotypy. Small to medium sized species for Cicadettini (body length male: 14.0���27.0 mm; female: 18.0���27.0 mm). Head (Fig. 14 C) including eyes nearly as wide as base of mesonotum. Distance between lateral ocellus and nearest eye about as long as distance between lateral ocelli. Postclypeus (Fig. 14 D) a little prominent anteriorly and shape in transverse cross-section rounded, with central longitudinal sulcus and lateral transverse grooves. Rostrum (Fig. 14 D) reaching beyond middle coxae. Lateral part of pronotal collar (Fig. 14 C) ampliate, lateral angle of pronotal collar well ampliate posterolaterally. Wings (Figs. 14 A���B) hyaline (except for K. mogannia comb. n. whose wings with basal half infuscated); fore wing with eight apical cells; hind wing with six apical cells; veins M and CuA of fore wing contiguous at basal cell but not fused (except for males of K. chinensis comb. n. and both sexes of K. yezoensis whose veins M and CuA of fore wing fused at basal cell); hind wing with veins RP and M fused at base. Male operculum (Fig. 14 E) slightly oblique; distomedial margin oval or obtusely angulated, approaching to the other one but not meeting it medially; posterior margin not extending to abdominal sternite II. Female operculum (Fig. 15 B) very small, rounded posteriorly. Meracanthus (Fig. 13 E) small, triangular, slightly curved laterally, pointing posteriorly. Male abdomen (Fig. 14 A) cylindrical, not keeled mid-dorsally; sternite VIII (Fig. 14 E) about as long as or shorter than sternite VII. Female abdomen (Figs. 16 A���B) conical, gradually narrowed caudally; posterior margin of sternite VII (Fig. 16 D) with median incision very deep and broad, to about 4 / 5 the length of sternite VII. Timbal covers absent; timbals usually with two or three long ribs, lacking prominent intermediate short ribs, basal dome large. Male pygofer (Figs. 15 A, B, D, E) in ventral view ovoid to sub-ovoid in shape, dorsal beak with apex pointed; upper lobe well developed, triangular in lateral view, with apex obtuse; basal lobe moderately developed, tending to be broadly angled in lateral view, somewhat tucked submarginally. Median lobe of uncus (Figs. 15 A, B, D, E) somewhat duck-bill shaped; apex slightly upswept; paramedian area slightly convex in ventral view, weakly developed but much smaller than anal styles. Clasper (Figs. 15 A, B, D, E; 18 A, B, D, E) moderately elongated, digitate, meeting the other one at base then separated, apex obtuse. Aedeagus (Figs. 15 C, F; 18 C, F) arched, ventral support present; thecal pseudoparameres on dorsal side of theca originated near thecal base, protruding beyond endotheca; ejaculatory duct tubular, slender, with apical portion terminated in endotheca; basal plate of aedeagus broadened anteriorly in dorsal/ventral view. Dorsal beak of female pygofer (Figs. 16 C, D; 19 C, D) short, sharply pointed apically in lateral view, protruding beyond anal styles; ovipositor sheath extending beyond dorsal beak of pygofer. Distribution. China (Inner Mongolia, Heilongjiang, Liaoning, Hebei, Shanxi, Henan, Shaanxi, Gansu, Qinghai, Ningxia, Xinjiang, Hubei, Zhejiang, Sichuan, Fujian, Yunnan, Tibet, Hong Kong), Russia, Mongolia, Korea, Japan. Remarks. This genus is similar to Cicadetta Kolenati, but can be distinguished from the latter by the following characteristics: lateral part of pronotal collar ampliate (lateral part of pronotal collar not developed or dilated.in Cicadetta); median lobe of uncus weakly developed and much smaller than anal styles (median lobe of uncus developed, lobe-like, much longer than anal styles in Cicadetta); clasper elongate anterolaterally, digitate, apex obtuse (clasper stout, apex somewhat acute in Cicadetta); aedeagus with pseudoparameres short and acute, slightly protruding beyond the endotheca (aedeagus with pseudoparameres exceedingly long, surpassing the distal end of theca by about half its length in Cicadetta)., Published as part of Qi, Shengping, Hayashi, Masami & Wei, Cong, 2015, A review of the cicada genus Kosemia Matsumura (Hemiptera: Cicadidae), pp. 451-492 in Zootaxa 3911 (4) on pages 452-453, DOI: 10.11646/zootaxa.3911.4.1, http://zenodo.org/record/235745, {"references":["Matsumura, S. (1927) New species of Cicadidae from the Japanese Empire. Insecta Matsumurana, 2, 46 - 58, pl. 2.","Matsumura, S. (1917) A list of the Japanese and Formosan Cicadidae, with descriptions of new species and genera. Transactions of the Sapporo Natural History Society, 6, 186 - 212.","Kato, M. (1928) Descriptions of two new genera of Japanese Cicadidae and corredtions of some species. Insect World, 32, 182 - 188.","Uhler, P. R. (1896) Summary of the hemiptera of Japan, presented to the United States National Museum by Professor Mitzukuri. Proceedings of the United States National Museum, 19, 276 - 277. http: // dx. doi. org / 10.5479 / si. 00963801.1108.255","Matsumura, S. (1931) 6000 illustrated insects of Japan-Empire. Toko shoin, 1689 pp."]}

Kosemia prominentis (Lei & Chou, 1997) Figures 28���29 Leptopsalta prominentis Lei & Chou, 1997: 55. Kosemia prominentis: Sanborn, 2013: 525. Material examined. 1 ♂ (NWAFU), Tibet, Yigong, 2300 m, 14 -vi- 1976, coll. Li Fasheng; 1 ♂ (NWAFU), Tibet, Bomi County, 29 -v- 1983, coll. Li Houhun; 3 ♂ (NWAFU), Tibet, Tongmai, 7 -vi- 1983, coll. Li Houhun; 1 ♂ (NWAFU), Shaanxi Prov., Wugong County, viii- 1984, coll. unknown. Description. Male. Small cicadas, body almost black with black brown pubescence and golden short pile. Head (Figs. 28 A���D). Head including eyes about as wide as base of mesonotum. paramedian posterior margin of vertex, supra-antennal plates, lateral margins of postclypeus all brown. Eyes grey brown. Ocelli orange-reddish, distance between lateral ocelli distinctly longer than distance between lateral ocellus and front ocellus. Genae and anteclypeus black, with dense, grey brown pubescence. Rostrum black, basal joint of rostrum somewhat brown. Thorax (Figs. 28 C���D). Pronotum black with anterior and posterior margin red brown. Lateral part of pronotal collar ampliate laterally and broadly angled; lateral angle well ampliate posterolaterally. Mesonotum black, with two central deltoid spots and lateral margins fuzzy yellowish brown in some specimens. Cruciform elevation yellowish brown. Wings (Figs. 28 A���B). Wings hyaline. Fore wing with costal, basal and ulnar veins light brown; anal veins and apical margin dusky; basal membrane sanguineous; veins M and CuA adjacent to one another at basal cell, but not fused as one; veins RA 2 and RP fused at base in two specimens. Hind wing with faintly brown infuscation narrowly along vein 2 A to its distal end and around ambient vein of cubital cell 2 and anal cell 1; plaga on 3 A and basal part of jugum slightly infuscated. Legs (Fig. 28 G). General color brown, with long silvery pubescence. Fore leg with fascia of coxa, one or two spot(s) of trochanter, two longitudinal fasciae and tips of femur, tips and longitudinal fasciae of tibiae, all black or black brown. Fore femur with three strong spines beneath all black basally and red brown apically, decreasing in size from primary to tertiary spine; primary and tertiary spines slanted, secondary spine almost erected. Tibiae of mid and hind legs each with an indistinct, light brownish annulate marking at about one-third from base. Opercula (Fig. 28 E). Operculum almost brown and slightly fuscous basally, coarsely covered with grey silvery pubescence; inner margin obtusely angulated; lateral and posterior margins rounded. Meracanthus generally pale yellow. Abdomen (Figs. 26 A���B, E���F). Abdomen slightly shorter than head and thorax together. Timbal with two long ribs. Abdominal tergites I���II black; posterior margins of tergites III���VII and posterior portion of tergite VIII orange-yellow. Abdominal sternites orange-yellow with silvery pile; middle of sternites III���VI striped with a series of black semicircular spots; sternite VIII shorter than of sternite VII. Genitalia (Figs. 29 A���D). Pygofer black dorsally, pale brown laterally. Dorsal beak of pygofer moderately long and spine-shaped, narrowly pointed at apex. Upper lobe of pygofer triangular in lateral view, apex obtuse; basal lobe of pygofer broadly angled in lateral view. Median lobe of uncus small, black, apex slightly upswept in lateral view, paramedian area slightly convex in ventral view. Clasper shiny dark red with black at base, slightly elongated, digitate, and contiguous to the other one at base then separated anterolaterally; apex obtuse. Measurements. (6 ♂♂), mean (range) (in mm). Body length: 16.8 (16.0���18.0); fore wing length: 18.5 (17.4���19.4); fore wing width: 6.8 (6.5���7.1); width of head including eyes: 4.8 (4.8 ���5.0); pronotum width (including pronotal collar): 5.8 (5.4���6.1); mesonotum width: 5.1 (4.8���5.4). Distribution. China (Shaanxi, Tibet). Remarks. This species resembles K. yamashitai (Esaki & Ishihara, 1950) in general appearance, but can be distinguished from the latter by the following characteristics: secondary spine of fore femur almost erected; posterior margins of tergites III���VII and posterior portion of tergite VIII orange-yellow; abdominal sternites orange-yellow, striped with a series of black semicircular spots; sternite VII broad at base and abruptly narrowed at half length; upper lobe of pygofer small, with apex somewhat acute in lateral view., Published as part of Qi, Shengping, Hayashi, Masami & Wei, Cong, 2015, A review of the cicada genus Kosemia Matsumura (Hemiptera: Cicadidae), pp. 451-492 in Zootaxa 3911 (4) on pages 484-485, DOI: 10.11646/zootaxa.3911.4.1, http://zenodo.org/record/235745, {"references":["Chou, I., Lei, Z., Li, L., Lu, X. & Yao, W. (1997) The Cicadidae of China (Homoptera: Cicadoidea). Tianze Eldoneio, Hong Kong, 380 pp., 16 pls. [in Chinses with title and partial summary in English]","Sanborn, A. F. (2013) Catalogue of the Cicadoidea (Hemiptera: Auchenorrhyncha), 1 st Edition. Academic Press, USA, 1001 pp.","Esaki, T. & Ishihara, T. (1950) Hemiptera of Shansi, North China. Hemiptera. Homoptera. Mushi, 21, 39 - 48, 3 pls."]}