Search

Amino acids are delivered into developing wheat grains to support the accumulation of storage proteins in the starchy endosperm, and transporters play important roles in regulating this process. RNA-seq, RT-qPCR, and promoter-GUS assays showed that three amino acid transporters are differentially expressed in the endosperm transfer cells (TaAAP2), starchy endosperm cells (TaAAP13), and aleurone cells and embryo of the developing grain (TaAAP21), respectively. Yeast complementation revealed that all three transporters can transport a broad spectrum of amino acids. RNAi-mediated suppression of TaAAP13 expression in the starchy endosperm did not reduce the total nitrogen content of the whole grain, but significantly altered the composition and distribution of metabolites in the starchy endosperm, with increasing concentrations of some amino acids (notably glutamine and glycine) from the outer to inner starchy endosperm cells compared with wild type. Overexpression of TaAAP13 under the endosperm-specific HMW-GS (high molecular weight glutenin subunit) promoter significantly increased grain size, grain nitrogen concentration, and thousand grain weight, indicating that the sink strength for nitrogen transport was increased by manipulation of amino acid transporters. However, the total grain number was reduced, suggesting that source nitrogen remobilized from leaves is a limiting factor for productivity. Therefore, simultaneously increasing loading of amino acids into the phloem and delivery to the spike would be required to increase protein content while maintaining grain yield. © 2021 Wan et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Gibberellins (GAs) are involved in the control of a number of key developmental processes in plants, including endosperm mobilisation stem elongation and flowering. In many of these systems, GA modulates the transcription of specific genes. The aim of this paper is to review current progress in identifying and characterising GA-regulated genes; both the control of gene expression and the function of the gene products are discussed. The most well-characterised system in which GA is active in controlling transcription is the aleurone layer of cereal grains, where it induces the synthesis of a range of hydrolytic enzymes, including a-amylase. Analysis of the promoters of a-Amy1 and a-Amy2 genes by transient expression in aleurone cells and protoplasts together with DNase 1 footprinting and gel-retardation assays, has identified a number of cis-acting elements important for high-level, GA-regulated expression. In particular a GA-response element (GARE) including the sequence TAACRRA has been characterised. Recent reports describe cDNA clones encoding trans-acting factors that bind to elements in the a-amylase promoters. Expression of the factor capable of binding to the TAACRRA element is itself induced by GA. In elongating tissues, GA has been shown to control the expression of a number of genes, including the tonoplast intrinsic protein, a water channel which may regulate water flux into the vacuole during cell expansion. In flower development, expression of flavonoid biosynthetic genes, such as chalcone synthase in Petunia corollas, is regulated by GA at the level of transcription. Analysis of GA-response mutants led to the suggestion that one consequence of GA action is to regulate its own biosynthesis. Genes encoding GA 20-oxidase and 3β-hydroxylase have recently been shown to be down-regulated by applied GA, providing a possible mechanism for feedback regulation of the GA biosynthetic pathway. There is evidence that cells perceive GA at the cell surface, implying the existence of a signal transduction system between plasma membrane and nucleus. This signal transduction system has barely begun to be elucidated but is likely to become a major focus of gibberellin research.

cDNA fragments from ten different protein kinases expressed in Avena sativa aleurone cells were amplified from mRNA by RT-PCR with degenerate primers. These could be classified into five groups: Aspk1-3 showed homology to the Snf1-related protein kinases, Aspk4-5 to a wheat ABA up-regulated protein kinase, Aspk6-8 to the Ca-dependent, calmodulin-independent protein kinase family, Aspk9 encoded a MAP kinase and Aspk10 was closely related to a novel Arabidopsis ribosomal protein kinase. GA caused a rapid increase in transcripts hybridising to Aspk10, while inhibiting the dramatic accumulation of transcripts hybridising to Aspk9 that occurred in the absence of GA.

The effects of wheat properties on breakage during First Break roller milling, as described by the Double Normalised Kumaraswamy Breakage Function (DNKBF), were investigated. A set of 45 wheats from nine varieties representing the range of commercial varieties grown in the UK, and grown over three harvest years at several nitrogen fertiliser levels, were milled at five roll gaps under Sharp-to-Sharp and Dull-to-Dull dispositions. The resulting particle size distributions were fitted with a DNKBF in order to understand the physical significance of the DNKBF parameters and to relate them to shape and hardness. The DNKBF parameters related strongly to hardness as measured using either the Single Kernel Characterisation System or Particle Size Index, allowing the particle size distribution over the range 0–4000 μm to be predicted solely from wheat hardness. A residual analysis showed that the remaining variation was correlated with kernel mass, and that more elongated kernels break to give slightly larger particles than more spherical kernels of equivalent hardness. Two types of breakage are identified, one of which principally produces many small endosperm particles along with large bran particles, while the other tends to produce mid-sized particles. The former dominates under Dull-to-Dull milling and for soft wheats, while the latter becomes more prominent under Sharp-to-Sharp milling and for harder wheats.

The sequence and expression characteristics are described of a wilt-inducible gene in Arabidopsis thaliana. A 1494 encodes a potential thiol protease whose mRNA accumulates rapidly in shoot tissue upon the loss of turgor. A1494 mRNA levels peaked after ca. 4 h and declined thereafter. Dehydration also induced rapid biosynthesis of the phytohormone abscisic acid (ABA), which continued for at least 9 h. Exogenous ABA induced the accumulation of A1494 mRNA, with kinetics similar to those after wilting. Rehydration of wilted shoots led to a rapid decline in the content of both ABA and A1494 mRNA. Wilting and ABA independently induced A1494 expression as evidenced by the effects of ABA and wilting on the ABA-deficient aba-1 and ABA-insensitive abi-1 and abi-3 genotypes. A1494 mRNA was not detectable in aba-1 shoots but accumulated rapidly after either wilting or ABA treatment, whereas the shoot ABA content was increased only by ABA treatment. ABA had no effect on A1494 mRNA levels in the abi-1 and abi-3 mutants but wilting did result in enhanced A1494 expression. Heat shock had only a minor effect on A1494 mRNA levels, whereas exposure to low temperature resulted in substantial accumulation of A1494 mRNA in wild-type shoots. However, this latter response, unlike that to drought, was mediated exclusively via ABA synthesis as demonstrated by the lack of A1494 mRNA accumulation in cold-treated aba-1 shoots.

In a screen to identify novel cellulose deficient mutants, three lines were shown to be allelic and define a novel complementation group, irregular xylem5 ( irx5 ). IRX5 was cloned and encodes a member of the CesA family of cellulose synthase catalytic subunits (AtCesA4). irx5 plants have an identical phenotype to previously described mutations in two other members of this gene family ( IRX1 and IRX3 ). IRX5, IRX3, and IRX1 are coexpressed in exactly the same cells, and all three proteins interact in detergent solubilized extracts, suggesting that three members of this gene family are required for cellulose synthesis in secondary cell walls. The association of IRX1 and IRX3 was reduced to undetectable levels in the absence of IRX5. Consequently, these data suggest that IRX5, IRX3, and IRX1 are all essential components of the cellulose synthesizing complex and the presence of all three subunits is required for the correct assembly of this complex.

The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.

DNA from pea and tobacco chloroplasts hybridizes specifically with probes derived from the gene for a membrane component, the a subunit of ATP synthase of the cyanobacterium, Synechococcus 6301. DNA sequence of the hybridizing region of the pea plastid DNA has revealed that it encodes a protein of 247 amino acids related in sequence to the a subunits of ATP synthase of Escherichia coli, Synechococcus and mitochondria. This is the sixth component of chloroplast ATP synthase that is plastid coded. The gene is located upstream from the genes for three other ATP synthase subunits and a transcript of 6 kb contains coding sequences from each of these genes. Thus the subunit a gene is part of a co-transcribed cluster of four ATP synthase genes arranged in the order a:c(or III):b(or I):alpha. Two other ATP synthase genes, those for beta and epsilon subunits, are known to form a separate cluster. These gene arrangements are most closely related to those found in the cyanobacterium, Synechococcus 6301. Hence, this finding provides strong evidence for a common origin for cyanobacteria and plant chloroplasts.

Summary Free asparagine is the precursor for acrylamide, which forms during the baking, toasting and high‐temperature processing of foods made from wheat. In this study, CRISPR/Cas9 was used to knock out the asparagine synthetase gene, TaASN2, of wheat (Triticum aestivum) cv. Cadenza. A 4‐gRNA polycistronic gene was introduced into wheat embryos by particle bombardment and plants were regenerated. T1 plants derived from 11 of 14 T0 plants were shown to carry edits. Most edits were deletions (up to 173 base pairs), but there were also some single base pair insertions and substitutions. Editing continued beyond the T1 generation. Free asparagine concentrations in the grain of plants carrying edits in all six TaASN2 alleles (both alleles in each genome) were substantially reduced compared with wildtype, with one plant showing a more than 90 % reduction in the T2 seeds. A plant containing edits only in the A genome alleles showed a smaller reduction in free asparagine concentration in the grain, but the concentration was still lower than in wildtype. Free asparagine concentration in the edited plants was also reduced as a proportion of the free amino acid pool. Free asparagine concentration in the T3 seeds remained substantially lower in the edited lines than wildtype, although it was higher than in the T2 seeds, possibly due to stress. In contrast, the concentrations of free glutamine, glutamate and aspartate were all higher in the edited lines than wildtype. Low asparagine seeds showed poor germination but this could be overcome by exogenous application of asparagine.