Search

Hemoglobinopathies are the most common monogenic disorders in the world with an ever increasing global disease burden each year. As most hemoglobinopathies show recessive inheritance carriers are usually clinically silent. Programmes for preconception and antenatal carrier screening, with the option of prenatal diagnosis are considered beneficial in many endemic countries. With the development of genetic tools such as Array analysis and Next Generation Sequencing in addition to state of the art screening at the hematologic, biochemic and genetic level, have contributed to the discovery of an increasing number of rare rearrangements and novel factors influencing the disease severity over the recent years. This review summarizes the basic requirements for adequate carrier screening analysis, the importance of genotype-phenotype correlation and how this may lead to the unrevealing exceptional interactions causing a clinically more severe phenotype in otherwise asymptomatic carriers. A special group of patients are beta-thalassemia carriers presenting with features of beta-thalassemia intermedia of various clinical severity. The disease mechanisms may involve duplicated alpha-globin genes, mosaic partial Uniparental Isodisomy of chromosome 11p15.4 where the HBB gene is located or haplo-insufficiency of a non-linked gene SUPT5H on chromosome 19q, first described in two Dutch families with beta-thalassemia trait without variants in the HBB gene.

Thalassemia is a major public health and economical burden in Lao People's Democratic Republic (Lao PDR). This study is aiming to elaborate the current situation of Thalassemia in Laos. α- and β-thalassemia (α- and β-thal) includes the common Hb S (

Background: Thalassemia is one of the most prevalent inherited single gene diseases. Prevention of β-thalassemia through prenatal diagnosis is the one of the most effective and direct approach to control the spread of this life-threatening disease. This study aims to determine the prenatal diagnosis of α-thalassemia and β-thalassemia in 3049 families among eighteen regions of Hainan Province using molecular diagnosis.Methods: This study enrolled a total of 3049 couples and their fetuses at The First Affiliated Hospital of Hainan Medical University from January 2004 to March 2020. Genomic DNA was extracted from peripheral blood of the couples and villus, amniotic fluid, or fetal cord blood of fetuses. DNA-based diagnosis was performed using polymerase chain reaction. Results: Here, the most commonly detected mutation of α-thalassemia was a South-East Asian deletion (31.53%), followed by –α4.2/αα (11.15%), –α3.7/αα (11.02%). The most common mutation for β-thalassemia was CD41/42, followed by -28, accounting for 30.27% and 2.56%, respectively. The regions with the highest prevalence were the coastal regions and the regions with the lowest prevalence were Wenchang, Lingao and Ding’an. We also examined thalassemia gene mutations in Han people and other minority groups and found that the most common gene mutations in different ethnic were not homogeneous. Prenatal diagnosis showed 556 normal, 118 α-thalassemia hydrops and 161 β-thalassemia major fetuses. Conclusion: Our findings provide important information for clinical genetic counseling of prenatal diagnosis for thalassemia major in Hainan Province.

Thalassemia is a common genetic disorder. We aimed to present thalassemia mutation data that covers a period of 7 years from the Mediterranean region of Turkey by comparing with hemoglobin indices and to contribute to prenatal diagnosis and genetic counseling studies which should be decided very quickly. In this study, in which a retrospective archive was scanned, the cases were first grouped as α and β thalassemia, and then β thalassemia mutations were examined in a total of 5 groups as UTR-Pro, Codon, IVS, β0, and β+. We have reached the family of the proband that analyzed their Hb indices and genetic mutation. All mutations were statistically compared with Hb indices, HbF, and HbA2. We have identified two new β thalassemia mutations that have the feature of not being defined previously [HBB:C*62 A>G. (3'UTR+1536 A>G) and HBB:C*1 G>A (3'UTR+1475 G>A)]. The most commonly encountered 23 mutations account for 74.7% of all mutations which is unlike the literature. In the β thalassemia group, 73 different mutations were detected. The most common β thalassemia mutation was HBB: c.93-21 G>A (IVS I-110 G>A) with a frequency of 19.72%. A statistically significant difference was found when comparing the mutation groups with Hb indices. We think that it may be useful to evaluate the mutations we have newly identified too together with the Hb indices especially in evaluating the carriers of thalassemia and it will contribute to prenatal diagnosis and genetic counseling studies which should be decided very quickly.

BackgroundNoninvasive prenatal testing (NIPT) of recessive monogenic diseases depends heavily on knowing the correct parental haplotypes. However, the currently used family-based haplotyping method requires pedigrees, and molecular haplotyping is highly challenging due to its high cost, long turnaround time, and complexity. Here, we proposed a new two-step approach, population-based haplotyping-NIPT (PBH-NIPT), using α-thalassemia and β-thalassemia as prototypes.MethodsFirst, we deduced parental haplotypes with Beagle 4.0 with training on a large retrospective carrier screening dataset (4356 thalassemia carrier screening-positive cases). Second, we inferred fetal haplotypes using a parental haplotype-assisted hidden Markov model (HMM) and the Viterbi algorithm.ResultsWith this approach, we enrolled 59 couples at risk of having a fetus with thalassemia and successfully inferred 94.1% (111/118) of fetal alleles. We confirmed these alleles by invasive prenatal diagnosis, with 99.1% (110/111) accuracy (95% CI, 95.1–100%).ConclusionsThese results demonstrate that PBH-NIPT is a sensitive, fast, and inexpensive strategy for NIPT of thalassemia.

Aim To investigate the factors influencing decisions concerning prenatal diagnosis (PND) and termination of pregnancy for β-thalassemia in Thai pregnant women. Methods A total of 142 Thai Buddhist pregnant women waiting for PND were asked to undertake semi-structured interviews regarding their reasons for PND and their decisions and reasoning concerning pregnancy if the fetus was found to be affected. The interviews were analyzed using a thematic content approach. Results Thai pregnant women accepted PND for three reasons: to know whether their pregnancies were affected, to confirm that their pregnancies were unaffected and to terminate if their pregnancies were affected. Three decisions identified among the women were to terminate the pregnancy, to continue the pregnancy and undecided. The interview analysis identified five themes and nine sub-themes affecting pregnancy-related decision-making: (i) quality of life (suffering or no disability); (ii) burden (difficulty or acceptability); (iii) sense of motherhood (the best way for the child or I cannot hurt my child); (iv) significant others (support to terminate, support to continue or support to wait for the test result) and (v) conflict in deciding. Conclusion An acceptance of PND in Thai pregnant women was not always associated with pregnancy termination. Multiple factors influenced the decision to terminate, but not their religious affiliation.

β-Thalassemia (β-thal), an autosomal recessive hemoglobinopathy, is one of the most common genetic disorders in Pakistan. Awareness of this disease, genetic counseling, extended family carrier screening and prenatal diagnosis (PND) are helpful in prevention and control. Currently, direct DNA sequencing and multiple amplification refractory mutation system-polymerase chain reaction (MARMS-PCR) are the methods used to detect β-thal mutations, the latter being the most widely used. This study aimed to evaluate PCR-high resolution melting (PCR-HRM) analysis for the detection of most common β-thal mutations that are found in Pakistan. This study was designed to identify the β-thal mutations using PCR-HRM analysis in a total of 90 samples [blood and chorionic villus sampling (CVS)]. These samples were first screened for routine mutations by MARMS-PCR and then evaluated by PCR-HRM analysis. The results of PCR-HRM analyses were further confirmed by direct DNA sequencing and all analyses interpreted the same results in all 90 samples. Eleven cases (36.6%) were detected to carry IVS-I-5 (GC) (

Introduction A high frequency of β-thalassemia in Lao People's Democratic Republic necessitates the importance of complete molecular data before a prevention and control program could be established. Limited data are available for Lao PDR. We have now reported an extended information on the molecular basis of β-hemoglobinopathies in this population. Methods The study was done on 519 unrelated Laos subjects requested for thalassemia investigation. Hematological data were recorded. Hb profiles were obtained using a capillary electrophoresis system. α-And β-globin genotyping was performed using PCR and related techniques. Results Among the 519 subjects, 287 (55.3%) were found to carry β-hemoglobinopathies based on Hb and DNA analyses. These included Hb E carriers (n = 135), homozygous Hb E (n = 47), β-thalassemia carriers (n = 70), Hb E-β-thalassemia (n = 25), homozygous β-thalassemia (n = 4), heterozygous δβ0 -thalassemia (n = 2), and carriers of the β-Hb variant (n = 3). Mutation analysis identified in addition to the Hb E, 8 different β-thalassemia mutations including codon 17 (A-T), codons 41/42 (-TTCT), NT-28 (A-G), codons 71/72 (+A), IVS1-1 (G-T), 3.4 kb deletion, an initiation codon (T-G) and IVS2-654 (C-T). Two δβ0 -thalassemia carriers (12.6 kb deletion) and three subjects with Hb Hope (β136GGT-GAT ) were identified. Hematological features associated with these β-hemoglobinopathies were presented. Conclusion β-hemoglobinopathies in the Laos population is heterogeneous. This information is relevant for setting up a molecular diagnostics and can provide a basis for genetic counseling and enable prenatal diagnosis.

Beta thalassemia in Pakistan is a serious health concern with an estimated 5-8% carrier frequency and birth of 5000 major children every year in the country. The treatment of beta thalassemia major patients poses a great economic burden; hence, the ideal approach towards this disease should encompass effective prevention services. At present only one government funded project “Punjab Thalassemia Prevention Program” existed in Punjab province, and providing free of cost services for beta thalassemia screening and prenatal diagnosis. Complete blood count and hemoglobin electrophoresis remains the preliminary test for screening, while chorionic villi sampling and amplification refractory mutation system method have been most widely used for molecular diagnosis of beta thalassemia. Modern molecular techniques, non-invasive prenatal diagnosis, and pre-implantation diagnosis are in trial phases. In this review we have discussed the available diagnostic facilities and status of prevention programs for beta thalassemia in Pakistan as well as future perspectives.Continuous..

Purpose The purpose of this research is to study the clinical outcomes using a next-generation sequencing-based protocol allowing for simultaneous testing of mutations in the beta thalassemia (HBB) gene, including single nucleotide polymorphism (SNP) markers for PGT-M along with low-pass whole genome analysis of chromosome aneuploidies for PGT-A. Methods A combined PGT-M (thalassemia) plus PGT-A system was developed for patients undergoing IVF in Vietnam. Here we developed a system for testing numerous thalassemia mutations plus SNP-based testing for backup mutation analysis and contamination control using next-generation sequencing (NGS). Low -pass next-generation sequencing was used to assess aneuploidy in some of the clinical PGT cases. Patients underwent IVF followed by embryo biopsy at the blastocyst stage for combined PGT-A/M. Results Two cases have completed the entire process including transfer of embryos, while a further nine cases have completed the IVF and PGT-M/A analysis but have not completed embryo transfer. In the two cases with embryo transfer, both patients achieved pregnancy with an unaffected, euploid embryo confirmed through prenatal diagnosis. In the further nine cases, 39 embryos were biopsied and all passed QC for amplification. There were 8 unaffected embryos, 31 carrier embryos, and 11 affected embryos. A subset of 24 embryos also had PGT-A analysis with 22 euploid embryos and 2 aneuploid embryos. Conclusions Here we report the development and clinical application of a combined PGT-M for HBB and PGT-A for gross chromosome aneuploidies from 11 patients with detailed laboratory findings along with 2 cases that have completed embryo transfer.

Thalassemia is the most common congenital monogenic disorder in Bangladesh. Prenatal diagnosis (PND) and pregnation termination of an affected child is one of the best options to reduce the burden of thalassemic children. This article reports the results of DNA analyses of chorionic villus sampling (CVS) and amniocentesis of fetuses of mothers who came to the thalassemia center of Dhaka Shishu (Children) Hospital, Dhaka, Bangladesh. DNA analysis was done by real-time polymerase chain reaction (qPCR) and Sanger sequencing. Maternal contamination was ruled out by variable number of tandem repeats (VNTRs). A total of 232 samples were analyzed. Hb E (HBB: c.79G>A)/β-thalassemia (Hb E/β-thal) was the most common type of thalassemia seen in 32 samples (13.79%) followed by β-thal major (β-TM) in 10 cases (4.31%). Molecular characterization of the most predominant mutation was IVS-I-5 (G>A) (HBB: c.92+5G>C). The analysis also revealed five rare mutations: IVS-II-654 (C>T) (HBB: c.316-197C>T), IVS-II-1 (G>A) (HBB: c.315+5G>A), codon 44 (-C) (HBB: c.135delC), -86 (C>A) (HBB: c.-136C>A) and codons 14/15 (+G) (HBB: c.45_46insG), which have not been reported previously in Bangladesh. This study provides important information for PND and will help in the development of similar diagnostic programs for other DNA centers in Bangladesh.

Chinese Gγ+(Aγδβ)0-thalassemia and SEA-HPFH are the most common types of β-globin gene cluster deletion in Chinese population. The aim of the study was to analyze clinical features of deletional Chinese Gγ+(Aγδβ)0-thalassemia and Southeast Asian hereditary persistence of fetal hemoglobin (SEA-HPFH) in South China. A total of 930 subjects with fetal hemoglobin (HbF) level ≥ 2% were selected on genetic research of Chinese Gγ+(Aγδβ)0-thalassemia and SEA-HPFH. The gap polymerase chain reaction was performed to identify the deletions. One hundred cases of Chinese Gγ+(Aγδβ)0-thalassemia were detected, including 90 cases of Chinese Gγ+(Aγδβ)0/βN-thalassemia, 7 cases of Chinese Gγ+(Aγδβ)0 /βN-thalassemia combined with α-thalassemia, 2 cases of Chinese Gγ+(Aγδβ)0-thalassemia combined with β-thalassemia, and 1 case of Chinese Gγ+(Aγδβ)0-thalassemia combined with β-gene mutation. One hundred nine cases of SEA-HPFH were detected, including 97 cases of SEA-HPFH/βN, 9 cases of SEA-HPFH/βN combined with α-thalassemia, 2 cases of SEA-HPFH combined with β-thalassemia, and 1 case of SEA-HPFH combined with β-gene mutation. Statistical analysis indicates significant differences in MCV (mean corpuscular volume), MCH (mean corpuscular hemoglobin), and HbA2 and HbF levels between Chinese Gγ+(Aγδβ)0-thalassemia heterozygotes and SEA-HPFH heterozygotes (P < 0.001). There are statistical differences in hematological parameters between them. Clinical phenotypic analysis can provide guidance for genetic counseling and prenatal diagnosis.

PURPOSE: To evaluate the efficacy of preimplantation genetic testing (PGT) for α- and β-double thalassemia combined with aneuploidy screening using next-generation sequencing (NGS). METHODS: An NGS-based PGT protocol was performed between 2017 and 2018 for twelve couples, each of which carried both α- and β-thalassemia mutations. Trophectoderm biopsy samples underwent whole-genome amplification using multiple displacement amplification (MDA), followed by NGS for thalassemia detection and aneuploidy screening. A selection of several informative single nucleotide polymorphisms (SNPs) established haplotypes. Aneuploidy screening was performed only on unaffected noncarriers and carriers. Unaffected and euploid embryos were transferred into the uterus through frozen-thawed embryo transfer (FET). RESULTS: A total of 280 oocytes were retrieved following 18 ovum pick-up (OPU) cycles, with 182 normally fertilized and 112 cultured to become blastocysts. One hundred and seven (95.5%, 107/112) blastocysts received conclusive PGT results, showing 56 (52.3%, 56/107) were unaffected. Thirty-seven (66.1%, 37/56) of the unaffected were also identified as euploid. One family had no transferable embryos. Unaffected and euploid embryos were then transferred into the uterus of the other 11 couples resulting in 11 healthy live births. The clinical pregnancy rate was 61.1% (11/18) per OPU and 68.8% (11/16) per FET, with no miscarriage reported. Seven families accepted the prenatal diagnosis and received consistent results with the NGS-based PGT. CONCLUSION: This study indicated that NGS could realize the simultaneous PGT of double thalassemia and aneuploidy screening in a reliable and accurate manner. Moreover, it eliminated the need for multiple biopsies, alleviating the potential damages to the pre-implanted blastocysts. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (10.1007/s10815-020-01732-7) contains supplementary material, which is available to authorized users.

Background Individuals with δβ-thalassemia/HPFH and β-thalassemia usually present with intermedia or thalassemia major. No large-scale survey on HPFH/δβ-thalassemia in southern China has been reported to date. The purpose of this study was to examine the molecular epidemiology and hematologic characteristics of these disorders in Guangzhou, the largest city in Southern China, to offer advice for thalassemia screening programs and genetic counseling. Methods A total of 125,661 couples participated in pregestational thalassemia screening. 654 subjects with fetal hemoglobin (HbF) level ≥ 5% were selected for further investigation. Gap-PCR combined with Multiplex ligation dependent probe amplification (MLPA) was used to screen for β-globin gene cluster deletions. Gene sequencing for the promoter region of HBG1 /HBG2 gene was performed for all those subjects. Results A total of 654 individuals had hemoglobin (HbF) levels≥5, and 0.12% of the couples were found to be heterozygous for HPFH/δβ-thalassemia, including Chinese Gγ (Aγδβ)0-thal, Southeast Asia HPFH (SEA-HPFH), Taiwanese deletion and Hb Lepore–Boston–Washington. The highest prevalence was observed in the Huadu district and the lowest in the Nansha district. Three cases were identified as carrying β-globin gene cluster deletions, which had not been previously reported. Two at-risk couples (0.0015%) were required to receive prenatal diagnosis. We also found 55cases of nondeletional-HPFH (nd-HPFH), including 54 with Italian nd-HPFH and one with the Aγ-197C-T heterozygous state. It is difficult to discriminate between Chinese Gγ (Aγδβ)0-thal and Italian nd-HPFH carriers using hemoglobin (Hb) analysis. Conclusions This study is the first to describe the familial prevalence of HPFH/δβ-thalassemia and the high-risk rate in Greater Guangzhou Area, and the findings will support the implementation of thalassemia screening for three common deletions by gap-PCR. We also presented a systematic description of genotype-phenotype relationships which will be useful for genetic counseling and prenatal diagnostic services for β-thalassemia intermedia.

Reproductive carrier screening started in some countries in the 1970s for hemoglobinopathies and Tay-Sachs disease. Cystic fibrosis carrier screening became possible in the late 1980s and with technical advances, screening of an ever increasing number of genes has become possible. The goal of carrier screening is to inform people about their risk of having children with autosomal recessive and X-linked recessive disorders, to allow for informed decision making about reproductive options. The consequence may be a decrease in the birth prevalence of these conditions, which has occurred in several countries for some conditions. Different programs target different groups (high school, premarital, couples before conception, couples attending fertility clinics, and pregnant women) as does the governance structure (public health initiative and user pays). Ancestry-based offers of screening are being replaced by expanded carrier screening panels with multiple genes that is independent of ancestry. This review describes screening in Australia, Cyprus, Israel, Italy, Malaysia, the Netherlands, Saudi Arabia, the United Kingdom, and the United States. It provides an insight into the enormous variability in how reproductive carrier screening is offered across the globe. This largely relates to geographical variation in carrier frequencies of genetic conditions and local health care, financial, cultural, and religious factors.

We report our work on prenatal diagnosis of α-thalassemia, β-thalassemia and other hemoglobinopathies in southern Thailand. DNA-based diagnosis was offered to 1906 pregnancies at risk for thalassemia using a combination method of multiplex-PCR and reverse dot blot analysis to detect seven α-globin and 47 β-globin mutations. The most commonly detected mutation of α0-thalassemia was a South-East Asian deletion (98%), followed by a Thai deletion (2%). Twenty-eight β-globin mutations were identified. Fourteen common mutations, including cod 19 A-G (18.6%), cod 41/42 -TCTT (14.4%), IVS1#5 G-C (13.2%), 3.5 kb deletion (9.2%), cod 17 A-T (7.7%), -28 A-G (7.3%), IVSI#1 G-T (7.1%), 12.5 kb deletion (δβ)0 (5.7%), HPFH6 (4.2%), IVS2#654 C-T (2.7%), 45 kb deletion (1.9%), Asian Indian-inversion-deletion Gγ(Aγδβ)0 (1.6%), cod 41 -C (1.5%) and cod 71/72 +A (1.3%) were detected, accounting for 96.5% of all mutations detected. The most common hemoglobin variant was Hb E, accounting for 97.86%. Prenatal diagnosis of 1906 couples at risk showed 22.0% normal, 51.2% carrier and 26.8% affected. The present study provides important information for diagnosis and control of severe thalassemia diseases.

Background Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α‐thalassemia and two novel cases of β‐thalassemia caused by five different mutations in the globin gene. Methods Next‐generation sequencing (NGS) was used to identify novel α‐ and β‐thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. Results NGS revealed five novel cases of α‐ and β‐thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α‐globin mRNA were analyzed. Conclusion Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population., In this study, we identified five novel mutations in the five families: HBA2:c.245C>T, HBA2:c.54delC, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for the isoelectric point, amino acid conservation, and pathogenicity of the missense mutation.

Background: Hemoglobin A (Hb A) (α2β2) in the normal adult subject constitutes 96–98% of hemoglobin, and Hb F is normally less than 1%, while for hemoglobin A2 (Hb A2) (α2δ2), the normal reference values are between 2.0 and 3.3%. It is important to evaluate the presence of possible delta gene mutations in a population at high risk for globin gene defects in order to correctly diagnose the β-thalassemia carrier. Methods: The most used methods for the quantification of Hb A2 are based on automated high performance liquid chromatography (HPLC) or capillary electrophoresis (CE). In particular Hb analyses were performed by HPLC on three dedicated devices. DNA analyses were performed according to local standard protocols. Results: Here, we described eight new δ-globin gene variants discovered and characterized in some laboratories in Northern Italy in recent years. These new variants were added to the many already known Hb A2 variants that were found with an estimated frequency of about 1–2% during the screening tests in our laboratories. Conclusions: The knowledge recognition of the delta variant on Hb analysis and accurate molecular characterization is crucial to provide an accurate definitive thalassemia diagnosis, particularly in young subjects who would like to ask for a prenatal diagnosis or preimplantation genetic diagnosis.

Background Current study focused on discovering protein biomarkers from the maternal serum of β-thalassemic trait mothers carrying the normal fetus and β-thalassemic major fetus. Method Serum samples from β-thalassemic trait mothers carrying major (N=5) and normal fetuses (N=5) were studied. IVS1-5 thalassemia mutation was common among β-thalassemic trait mothers who were carrying homozygous β-thalassemic fetus (IVS1-5/ IVS1-5 mutation) or normal fetus (no mutation). We employed two-dimensional gel electrophoresis and mass spectrometric analysis to explore differentially expressed maternal serum proteins from thalassemia carrier couples having the same β-thalassemia mutation. Western blotting was performed for one of the identified proteins to validate our data. Results Ten proteins were identified in maternal serum of β-thalassemic trait mothers carrying the β-thalassemic major fetus and normal fetus. Among these, Serotransferrin, Haptoglobin, Alpha-1 anti-trypsin (A1AT), Apo-lipoprotein A1, and Fibrinogen-beta chain were found to be up-regulated in mothers carrying major fetuses and are known to be associated with pregnancy-related disorders. The expression of A1AT was validated through western blotting. Conclusion Proteins identified in the current study from maternal serum are reported to contribute to hereditary disorders. We suggest that these can serve as putative screening markers for non-invasive prenatal diagnosis in β-thalassemic pregnancies.

Background: Beta thalassemia is a common disorder with autosomal recessive inheritance. The most prenatal diagnostic methods are the invasive techniques that have the risk of miscarriage. Now the non-invasive methods will be gradually alternative for these invasive techniques. Objective: The aim of this study is to evaluate and compare the diagnostic value of two non-invasive diagnostic methods for fetal thalassemia using cell free fetal DNA (cff-DNA) and nucleated RBC (NRBC) in one sampling community. Methods: 10 ml of blood was taken in two k3EDTA tube from 32 pregnant women (mean of gestational age = 11 weeks), who themselves and their husbands had minor thalassemia. One tube was used to enrich NRBC and other was used for cff-DNA extraction. NRBCs were isolated by MACS method and immunohistochemistry; the genome of stained cells was amplified by multiple displacement amplification (MDA) procedure. These products were used as template in b-globin segments PCR. cff-DNA was extracted by THP method and 300 bp areas were recovered from the agarose gel as fetus DNA. These DNA were used as template in touch down PCR to amplify b-globin gen. The amplified b-globin segments were sequenced and the results compared with CVS resul. Results: The data showed that sensitivity and specificity of thalassemia diagnosis by NRBC were 100% and 92% respectively and sensitivity and specificity of thalassemia diagnosis by cff-DNA were 100% and 84% respectively. Conclusion: These methods with high sensitivity can be used as screening test but due to their lower specificity than CVS, they cannot be used as diagnostic test.

Thalassemia and hemoglobinopathy are two common inherited disorders, which are highly prevalent in southern China. However, there is little knowledge on the genotypes of thalassemia and hemoglobinopathy in Southeastern China. In this study, we present a large-scale genetic detection and molecular characterization of thalassemia and hemoglobinopathy in Fujian province, Southeastern China. A total of 189414 subjects screened for thalassemia were recruited, and the hemoglobin components and levels were investigated. Furthermore, suspected common thalassemia was identified, and the suspected rare forms of common thalassemias and hemoglobinopathy were detected. Among the total subjects screened, the overall prevalence of thalassemia and hemoglobinopathy was 6.8% and 0.26%, and rare α-thalassemia genotypes HKαα, –THAI/αα and −α27.6/αα, and novel β-thalassemia gene mutations CD90(G → T) and IVS-I-110(G > A) were identified. Additionally, Hb Q-Thailand hemoglobinopathy and five other types of hemoglobinopathies (Hb New York, Hb J-Bangkok, Hb G-Taipei, Hb G-Coushatta and Hb Maputo) were found. The results of this 10-year large-scale study demonstrate high prevalence of thalassemia with complicated gene mutations in Southeastern China, which provides valuable baseline data for genetic counseling and prenatal diagnosis. In addition to detection of common thalassemia genes, detection of rare thalassemia genotypes and hemoglobinopathies is recommended.

Introduction The hemoglobinopathies pose a significant health burden in India. Apart from the β thalassemias and sickle cell disorders, α thalassemias and structural hemoglobin variants are also common. Here we have reviewed the phenotypic and molecular diversity of hemoglobinopathies encountered at a referral center in western India over a period of 15 years. Materials and methods Screening for hemoglobinopathies was done using HPLC and cellulose acetate electrophoresis. Molecular characterization was done using Covalent Reverse Dot Blot Hybridization (CRDB), Amplification Refractory Mutation System (ARMS), GAP PCR and direct DNA sequencing. Results The study includes 31 075 individuals who were referred for diagnosis of hemoglobinopathies and prenatal diagnosis. Of these 14 423 individuals showed various hemoglobin abnormalities. Beta genotyping in 5615 individuals showed the presence of 49 β thalassemia mutations. 143 β thalassemia heterozygotes had normal or borderline HbA2 levels. We identified three δ gene mutations (HbA2 Pellendri, HbA2 St.George, HbA2 Saurashtra) in β thalassemia heterozygotes leading to normal HbA2 levels. The commonest defects among the raised Hb F determinants were Gγ(Αγδβ)0 Indian inversion and the HPFH-3 Indian deletion. A total of 312 individuals showed the presence of α thalassemia, of which 12.0% had a single α gene deletion (-α/αα). HbH disease was identified in 29 cases with 10 different genotypes. Alpha globin gene triplication was seen in 2.1% of β thalassemia heterozygotes with a thalassemia intermedia phenotype. Seven unusual α chain variants and eight uncommon β chain variants were identified. Conclusion The repertoire of molecular defects seen in the different globin genes will be valuable for management and control of these disorders both in India as well as in other countries where there is a huge influx of migrant populations from India.

The aim of this study was to retrospectively compare hematological parameters among normal, α-, and β-thalassemia fetuses between 17 and 38 weeks of gestation. Pregnant women at risk of having fetuses with thalassemia major and underwent cordocentesis for prenatal diagnosis were recruited. Fetal cord blood samples were collected from 249 fetuses for hematological and DNA analysis. Fetuses were divided into subgroups according to thalassemia DNA genotypes. The average and gestational age of subjects were 27.95 ± 5.78 years and 27.78 ± 3.57 weeks, respectively. The distribution of α-thalassemia, β-thalassemia, and normal cases was 67.87%, 19.68%, and 12.45%, respectively. Significant differences in almost all the hematological parameters (HbF, HbA, Hb, HCT, MCV, MCH, MCHC, RDW, and NBRCs) were observed in three groups (P P = 0.446). These differences were also observed in four α-thalassemia subgroups (P P +/β+ fetuses’ MCV, MCH, and RDW levels with gestation age were opposite to those of normal fetuses. We compared the distribution of hematological parameters in fetuses affected by most genotypes of thalassemia, as well as their trends in relation to gestational age for the first time, which is a good reference for future studies and prenatal diagnostic practices. The investigated hematological parameters are also valuable in diagnosing and differentiating thalassemia.

Objective Prenatal and postnatal diagnosis of hemoglobin E-β 0-thalassemia can be made using polymerase chain reaction (PCR) analysis mostly on purified DNA. We have establihed a direct amplification method without DNA extraction on whole blood (WB) and amniotic fluid (AF) specimens to diagnose the disease. Methods Three reactions of WB PCR assays and 7 reactions of AF PCR tests were developed for postnatal and prenatal diagnosis, respectively. Assays were validated against routine tests in a blinded trial. Results The results showed 100% concordance with routine DNA PCR assays. Among 309 β-thalassemia carriers, 191 patients (61.8%) carried common β-thalassemia mutations. Among 448 AF specimens, 116 (25.9%) fetuses were found to be affected, 247 (55.1%) fetuses were carriers, and 85 (19%) fetuses were unaffected. Conclusion We found that WB and AF PCR assays are simple, rapid, and reliable. The developed techniques could be applicable in routine settings.