Search

Targeting critical epigenetic regulators reverses aberrant transcription in cancer, thereby restoring normal tissue function 1-3 . The interaction of menin with lysine methyltransferase 2A (KMT2A), an epigenetic regulator, is a dependence in acute leukaemia caused by either rearrangement of KMT2A or mutation of the nucleophosmin 1 gene (NPM1) 4-6 . KMT2A rearrangements occur in up to 10% of acute leukaemias and have an adverse prognosis, whereas NPM1 mutations occur in up to 30%, forming the most common genetic alteration in acute myeloid leukaemia 7,8 . Here, we describe the results of the first-in-human phase 1 clinical trial investigating revumenib (SNDX-5613), a potent and selective oral inhibitor of the menin-KMT2A interaction, in patients with relapsed or refractory acute leukaemia (ClinicalTrials.gov, NCT04065399). We show that therapy with revumenib was associated with a low frequency of grade 3 or higher treatment-related adverse events and a 30% rate of complete remission or complete remission with partial haematologic recovery (CR/CRh) in the efficacy analysis population. Asymptomatic prolongation of the QT interval on electrocardiography was identified as the only dose-limiting toxicity. Remissions occurred in leukaemias refractory to multiple previous lines of therapy. We demonstrate clearance of residual disease using sensitive clinical assays and identify hallmarks of differentiation into normal haematopoietic cells, including differentiation syndrome. These data establish menin inhibition as a therapeutic strategy for susceptible acute leukaemia subtypes., (© 2023. The Author(s).)

Nitazoxanide and related thiazolides are a novel class of anti-infectious agents against protozoan parasites, bacteria and viruses. In recent years, it is demonstrated that thiazolides can also induce cell cycle arrest and apoptotic cell death in cancer cells. Due to their fast proliferating nature, cancer cells highly depend on the proteasome system to remove aberrant proteins. Many of these aberrant proteins are regulators of cell cycle progression and apoptosis, such as the cyclins, BCL2 family members and nuclear factor of κB (NF-κB). Here, we demonstrate at both molecular and cellular levels that the 20S proteasome is a direct target of NTZ and related thiazolides. By concurrently inhibiting the multiple catalytic subunits of 20S proteasome, NTZ promotes cell cycle arrest and triggers cell death in colon cancer cells, either directly or as a sensitizer to other anti-tumor agents, especially doxorubicin. We further show that the binding mode of NTZ in the β5 subunit of the 20S proteasome is different from that of bortezomib and other existing proteasome inhibitors. These findings provide new insights in the design of novel small molecular proteasome inhibitors as anti-tumor agents suitable for solid tumor treatment in an oral dosing form., (Copyright © 2022. Published by Elsevier Inc.)

The rare capacity for heat shock protein 90 (Hsp90) chaperones to support almost the entire cellular signaling network was viewed as a potential breakthrough to combat tumor resistance to single-oncogene-based therapeutics. Over 2 decades, several generations of Hsp90 ATP binding inhibitors have entered numerous cancer clinical trials, but few have advanced to FDA approval for treatment of human cancers. Herein, we report that Hsp90 expression varies dramatically, especially among different types of noncancer cells and organs. The highly variable levels of Hsp90, from as low as 1.7% to as high as 9% of their total cellular proteins, were responsible for either an extreme sensitivity or an extreme resistance to a classical Hsp90 ATP-binding inhibitor. Among randomly selected cancer cell lines, the same client proteins for regulation of cell growth exhibited unexpectedly heterogenous reactions in response to an Hsp90 ATP-binding inhibitor, inconsistent with the current understanding. Finally, a minimum amount (<10%) of Hsp90β was still required for client protein stability and cell survival even in the presence of full Hsp90α. These new findings of Hsp90 expression in host and isoform compensation in tumor cells could complicate biomarker selection, toxicity readout, and clinical efficacy of Hsp90-ATP-binding inhibitors in cancer clinical trials.

Igf2bp1 is an oncofetal RNA binding protein whose expression in numerous types of cancers is associated with upregulation of key pro-oncogenic RNAs, poor prognosis, and reduced survival. Importantly, Igf2bp1 synergizes with mutations in Kras to enhance signalling and oncogenic activity, suggesting that molecules inhibiting Igf2bp1 could have therapeutic potential. Here, we isolate a small molecule that interacts with a hydrophobic surface at the boundary of Igf2bp1 KH3 and KH4 domains, and inhibits binding to Kras RNA. In cells, the compound reduces the level of Kras and other Igf2bp1 mRNA targets, lowers Kras protein, and inhibits downstream signalling, wound healing, and growth in soft agar, all in the absence of any toxicity. This work presents an avenue for improving the prognosis of Igf2bp1-expressing tumours in lung, and potentially other, cancer(s).

The co-chaperone Bcl2-associated athanogene-3 (BAG3) maintains cellular protein quality control through the regulation of heat shock protein 70 (HSP70). Cancer cells manipulate BAG3-HSP70-regulated pathways for tumor initiation and proliferation, which has led to the development of promising small molecule therapies, such as JG-98, which inhibit the BAG3-HSP70 interaction and mitigate tumor growth. However, it is not known how these broad therapies impact cardiomyocytes, where the BAG3-HSP70 complex is a key regulator of protein turnover and contractility. Here, we show that JG-98 exposure is toxic in neonatal rat ventricular myocytes (NRVMs). Using immunofluorescence microscopy to assess cell death, we found that apoptosis increased in NRVMs treated with JG-98 doses as low as 10 nM. JG-98 treatment also reduced autophagy flux and altered expression of BAG3 and several binding partners involved in BAG3-dependent autophagy, including SYNPO2 and HSPB8. We next assessed protein half-life with disruption of the BAG3-HSP70 complex by treating with JG-98 in the presence of cycloheximide and found BAG3, HSPB5, and HSPB8 half-lives were reduced, indicating that complex formation with HSP70 is important for their stability. Next, we assessed sarcomere structure using super-resolution microscopy and found that disrupting the interaction with HSP70 leads to sarcomere structural disintegration. To determine whether the effects of JG-98 could be mitigated by pharmacological autophagy induction, we cotreated NRVMs with rapamycin, which partially reduced the extent of apoptosis and sarcomere disarray. Finally, we investigated whether the effects of JG-98 extended to skeletal myocytes using C2C12 myotubes and found again increased apoptosis and reduced autophagic flux. Together, our data suggest that nonspecific targeting of the BAG3-HSP70 complex to treat cancer may be detrimental for cardiac and skeletal myocytes., (© 2021 Wiley Periodicals LLC.)

All current clinically approved androgen deprivation therapies for prostate cancer target the C-terminal ligand-binding domain of the androgen receptor (AR). However, the main transactivation function of the receptor is localized at the AR N-terminal domain (NTD). Targeting the AR NTD directly is a challenge because of its intrinsically disordered structure and the lack of pockets for drugs to bind. Here, we have taken an alternative approach using the cochaperone BAG1L, which interacts with the NTD, to develop a novel AR inhibitor. We describe the identification of 2-(4-fluorophenyl)-5-(trifluoromethyl)-1,3-benzothiazole (A4B17), a small molecule that inhibits BAG1L-AR NTD interaction, attenuates BAG1L-mediated AR NTD activity, downregulates AR target gene expression, and inhibits proliferation of AR-positive prostate cancer cells. This compound represents a prototype of AR antagonists that could be key in the development of future prostate cancer therapeutics.

NAD(P)H:quinone acceptor oxidoreductase-1 (NQO1) is a ubiquitous flavin adenine dinucleotide-dependent flavoprotein that promotes obligatory two-electron reductions of quinones, quinonimines, nitroaromatics, and azo dyes. NQO1 is a multifunctional antioxidant enzyme whose expression and deletion are linked to reduced and increased oxidative stress susceptibilities. NQO1 acts as both a tumor suppressor and tumor promoter; thus, the inhibition of NQO1 results in less tumor burden. In addition, the high expression of NQO1 is associated with a shorter survival time of cancer patients. Inhibiting NQO1 also enables certain anticancer agents to evade the detoxification process. In this study, a series of phytobioactives were screened based on their chemical classes such as coumarins, flavonoids, and triterpenoids for their action on NQO1. The in silico evaluations were conducted using PyRx virtual screening tools, where the flavone compound, Orientin showed a better binding affinity score of -8.18 when compared with standard inhibitor Dicumarol with favorable ADME properties. An MD simulation study found that the Orientin binding to NQO1 away from the substrate-binding site induces a potential conformational change in the substrate-binding site, thereby inhibiting substrate accessibility towards the FAD-binding domain. Furthermore, with this computational approach we are offering a scope for validation of the new therapeutic components for their in vitro and in vivo efficacy against NQO1.

Syntenin stimulates exosome production and its expression is upregulated in many cancers and implicated in the spread of metastatic tumor. These effects are supported by syntenin PDZ domains interacting with syndecans. We therefore aimed to develop, through a fragment-based drug design approach, novel inhibitors targeting syntenin-syndecan interactions. We describe here the optimization of a fragment, 'hit' C58, identified by in vitro screening of a PDZ-focused fragment library, which binds specifically to the syntenin-PDZ2 domain at the same binding site as the syndecan-2 peptide. X-ray crystallographic structures and computational docking were used to guide our optimization process and lead to compounds 45 and 57 (IC 50  = 33 μM and 47 μM; respectively), two representatives of syntenin-syndecan interactions inhibitors, that selectively affect the syntenin-exosome release. These findings demonstrate that it is possible to identify small molecules inhibiting syntenin-syndecan interaction and exosome release that may be useful for cancer therapy., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2021 Elsevier Masson SAS. All rights reserved.)

ONC201 is a first-in-class imipridone compound that is in clinical trials for the treatment of high-grade gliomas and other advanced cancers. Recent studies identified that ONC201 antagonizes D2-like dopamine receptors at therapeutically relevant concentrations. In the current study, characterization of ONC201 using radioligand binding and multiple functional assays revealed that it was a full antagonist of the D2 and D3 receptors (D2R and D3R) with low micromolar potencies, similar to its potency for antiproliferative effects. Curve-shift experiments using D2R-mediated β -arrestin recruitment and cAMP assays revealed that ONC201 exhibited a mixed form of antagonism. An operational model of allostery was used to analyze these data, which suggested that the predominant modulatory effect of ONC201 was on dopamine efficacy with little to no effect on dopamine affinity. To investigate how ONC201 binds to the D2R, we employed scanning mutagenesis coupled with a D2R-mediated calcium efflux assay. Eight residues were identified as being important for ONC201's functional antagonism of the D2R. Mutation of these residues followed by assessing ONC201 antagonism in multiple signaling assays highlighted specific residues involved in ONC201 binding. Together with computational modeling and simulation studies, our results suggest that ONC201 interacts with the D2R in a bitopic manner where the imipridone core of the molecule protrudes into the orthosteric binding site, but does not compete with dopamine, whereas a secondary phenyl ring engages an allosteric binding pocket that may be associated with negative modulation of receptor activity. SIGNIFICANCE STATEMENT: ONC201 is a novel antagonist of the D2 dopamine receptor with demonstrated efficacy in the treatment of various cancers, especially high-grade glioma. This study demonstrates that ONC201 antagonizes the D2 receptor with novel bitopic and negative allosteric mechanisms of action, which may explain its high selectivity and some of its clinical anticancer properties that are distinct from other D2 receptor antagonists widely used for the treatment of schizophrenia and other neuropsychiatric disorders., (U.S. Government work not protected by U.S. copyright.)

Cancer cells depend on actin cytoskeleton rearrangement to carry out hallmark malignant functions including activation, proliferation, migration and invasiveness. Wiskott-Aldrich Syndrome protein (WASp) is an actin nucleation-promoting factor and is a key regulator of actin polymerization in hematopoietic cells. The involvement of WASp in malignancies is incompletely understood. Since WASp is exclusively expressed in hematopoietic cells, we performed in silico screening to identify small molecule compounds (SMCs) that bind WASp and promote its degradation. We describe here one such identified molecule; this WASp-targeting SMC inhibits key WASp-dependent actin processes in several types of hematopoietic malignancies in vitro and in vivo without affecting naïve healthy cells. This small molecule demonstrates limited toxicity and immunogenic effects, and thus, might serve as an effective strategy to treat specific hematopoietic malignancies in a safe and precisely targeted manner., (© 2021. The Author(s).)

The transcription master regulator MYC plays an essential role in regulating major cellular programs and is a well-established therapeutic target in cancer. However, MYC targeting for drug discovery is challenging. New therapeutic approaches to control MYC-dependent malignancy are urgently needed. The mitogen-activated protein kinase kinase 3 (MKK3) binds and activates MYC in different cell types, and disruption of MKK3-MYC protein-protein interaction may provide a new strategy to target MYC-driven programs. However, there is no perturbagen available to interrogate and control this signaling arm. In this study, we assessed the drugability of the MKK3-MYC complex and discovered the first chemical tool to regulate MKK3-mediated MYC activation. We have designed a short 44-residue inhibitory peptide and developed a cell lysate-based time-resolved fluorescence resonance energy transfer (TR-FRET) assay to discover the first small molecule MKK3-MYC PPI inhibitor. We have optimized and miniaturized the assay into an ultra-high-throughput screening (uHTS) 1536-well plate format. The pilot screen of ~6,000 compounds of a bioactive chemical library followed by multiple secondary and orthogonal assays revealed a quinoline derivative SGI-1027 as a potent inhibitor of MKK3-MYC PPI. We have shown that SGI-1027 disrupts the MKK3-MYC complex in cells and in vitro and inhibits MYC transcriptional activity in colon and breast cancer cells. In contrast, SGI-1027 does not inhibit MKK3 kinase activity and does not interfere with well-known MKK3-p38 and MYC-MAX complexes. Together, our studies demonstrate the drugability of MKK3-MYC PPI, provide the first chemical tool to interrogate its biological functions, and establish a new uHTS assay to enable future discovery of potent and selective inhibitors to regulate this oncogenic complex., (Copyright © 2021 The Authors. Published by Elsevier Ltd.. All rights reserved.)

Epigenetics is nowadays a well-accepted area of research. In the last years, tremendous progress was made regarding molecules targeting EZH2, directly or indirectly. Recently tazemetostat hit the market after FDA-approval for the treatment of lymphoma. However, the impairment of EZH2 activity by orthosteric intervention has proven to be effective only in a limited subset of cancers. Considering the multiproteic nature of the PRC2 complex and the marked dependence of EZH2 functions on the other core subunits such as EED, in recent years, a new targeting approach ascended to prominence. The possibility to cripple the function of the PRC2 complex by interfering with its multimeric integrity fueled the interest in developing EZH2-EED protein-protein interaction and EED inhibitors as indirect modulators of PRC2-dependent methyltransferase activity. In this Perspective, we aim to summarize the latest findings regarding the development and the biological activity of these emerging classes of PRC2 modulators from a medicinal chemist's viewpoint.

Aberrant activation of Wnt/β-catenin signaling is strongly associated with many diseases including cancer invasion and metastasis. Small-molecule targeting of the central signaling node of this pathway, β-catenin, is a biologically rational approach to abolish hyperactivation of β-catenin signaling but has been demonstrated to be a difficult task. Herein, we report a drug-like small molecule, ZW4864 , that binds with β-catenin and selectively disrupts the protein-protein interaction (PPI) between B-cell lymphoma 9 (BCL9) and β-catenin while sparing the β-catenin/E-cadherin PPI. ZW4864 dose-dependently suppresses β-catenin signaling activation, downregulates oncogenic β-catenin target genes, and abrogates invasiveness of β-catenin-dependent cancer cells. More importantly, ZW4864 shows good pharmacokinetic properties and effectively suppresses β-catenin target gene expression in the patient-derived xenograft mouse model. This study offers a selective chemical probe to explore β-catenin-related biology and a drug-like small-molecule β-catenin/BCL9 disruptor for future drug development.

c-Myc is a transcription factor that plays a crucial role in cellular homeostasis, and its deregulation is associated with highly aggressive and chemotherapy-resistant cancers. After binding with partner MAX, the c-Myc-MAX heterodimer regulates the expression of several genes, leading to an oncogenic phenotype. Although considered a crucial therapeutic target, no clinically approved c-Myc-targeted therapy has yet been discovered. Here, we report the discovery via computer-aided drug discovery of a small molecule, L755507, which functions as a c-Myc inhibitor to efficiently restrict the growth of diverse Myc-expressing cells with low micromolar IC 50 values. L755507 successfully disrupts the c-Myc-MAX heterodimer, resulting in decreased expression of c-Myc target genes. Spectroscopic and computational experiments demonstrated that L755507 binds to the c-Myc peptide and thereby stabilizes the helix-loop-helix conformation of the c-Myc transcription factor. Taken together, this study suggests that L755507 effectively inhibits the c-Myc-MAX heterodimerization and may be used for further optimization to develop a c-Myc-targeted antineoplastic drug., Competing Interests: Conflict of interest The authors declare that they have no conflicts of interest with the contents of this article., (Copyright © 2021 The Authors. Published by Elsevier Inc. All rights reserved.)

WD repeat-containing protein 5 (WDR5) is essential for the stability and methyltransferase activity of the mixed lineage leukemia 1 (MLL1) complex. Dysregulation of the MLL1 gene is associated with human acute leukemias, and the direct disruption of the WDR5-MLL1 protein-protein interaction (PPI) is emerging as an alternative strategy for MLL-rearranged cancers. Here, we represent a new aniline pyrimidine scaffold for WDR5-MLL1 inhibitors. A comprehensive structure-activity analysis identified a potent inhibitor 63 ( DDO-2213 ), with an IC 50 of 29 nM in a competitive fluorescence polarization assay and a K d value of 72.9 nM for the WDR5 protein. Compound 63 selectively inhibited MLL histone methyltransferase activity and the proliferation of MLL translocation-harboring cells. Furthermore, 63 displayed good pharmacokinetic properties and suppressed the growth of MV4-11 xenograft tumors in mice after oral administration, first verifying the in vivo efficacy of targeting the WDR5-MLL1 PPI by small molecules.

The p53 protein is one of the most important tumor suppressors that are frequently inactivated in cancer cells. This inactivation occurs either because the TP53 gene is mutated or deleted, or due to the p53 protein inhibition by endogenous negative regulators, particularly murine double minute (MDM)2. Therefore, the reestablishment of p53 activity has received great attention concerning the discovery of new cancer therapeutics. Chalcones are naturally occurring compounds widely described as potential antitumor agents through several mechanisms, including those involving the p53 pathway. The inhibitory effect of these compounds in the interaction between p53 and MDM2 has also been recognized, with this effect associated with binding to a subsite of the p53 binding cleft of MDM2. In this work, a literature review of natural and synthetic chalcones and their analogues potentially interfering with p53 pathway is presented. Moreover, in silico studies of drug-likeness of chalcones recognized as p53-MDM2 interaction inhibitors were accomplished considering molecular descriptors, biophysiochemical properties, and pharmacokinetic parameters in comparison with those from p53-MDM2 in clinical trials. With this review, we expect to guide the design of new and more effective chalcones targeting the p53 pathway.

Acovenoside A (Acov-A) and acobioside A (Acob-A) were isolated from Acokanthera oblongifolia . Their anticancer properties were explored regarding, antiproliferative and antiangiogenic activities. The study included screening phase against six cancer cell lines followed by mechanistic investigation against HepG2 cancer cell line. The sulforhodamine-B (SRB) was used to determine their growth inhibitory power. In the other hand, flow cytometry techniques were recorded the cell death type and cell cycle analysis. The clonogenic (colony formation) and wound healing assays, enzyme-linked immunosorbent assay (ELISA) and molecular docking, were performed to evaluate the antiangiogenesis capability. Both compounds were strongly, inhibited four cancer cell lines at GI 50 less than 100 nM. The in vitro mechanistic investigation against HepG2 resulted in cell accumulations at G2M phase and induction of apoptosis upon treating cells separately, with 400 nM Acov-A and 200 nM Acob-A. Interestingly, the same concentrations were able to activate caspase-3 by 7.2 and 4.8-fold, respectively. Suppressing the clonogenic capacity of HepG2 cells (20 and 40 nM) and inhibiting the migration of the colon Caco-2 cancer cells were provoke the results of vascular endothelial growth factor receptor2 (VEGFR2) kinase enzyme inactivation. The docked study was highly supportive, to the antiangiogenic approach of both cardenolides. The isolated cardenolides could orchestrate pivotal events in fighting cancer., (© 2021 Walter de Gruyter GmbH, Berlin/Boston.)

Wnt/β-catenin signaling is crucial both in normal embryonic development and throughout the life of an organism. Moreover, aberrant Wnt signaling has been associated with various diseases, especially cancer and fibrosis. Recent research suggests that direct targeting of the β-catenin/BCL9 protein-protein interaction (PPI) is a promising strategy to block the Wnt pathway. Progress in understanding the cocrystalline complex and mechanism of action of the β-catenin/BCL9 interaction facilitates the discovery process of its inhibitors, but only a few inhibitors have been reported. In this review, the discovery and development of β-catenin/BCL9 PPI inhibitors in the areas of drug design, structure-activity relationships and biological and biochemical properties are summarized. In addition, perspectives for the future development of β-catenin/BCL9 PPI inhibitors are explored.

Peptides are being developed as targeted anticancer drugs to modulate cytosolic protein-protein interactions involved in cancer progression. However, their use as therapeutics is often limited by their low cell membrane permeation and/or inability to reach cytosolic targets. Conjugation to cell penetrating peptides has been successfully used to improve the cytosolic delivery of high affinity binder peptides, but cellular uptake does not always result in modulation of the targeted pathway. To overcome this limitation, we developed "angler peptides" by conjugating KD3, a noncell permeable but potent and specific peptide inhibitor of p53:MDM2 and p53:MDMX interactions, with a set of cyclic cell-penetrating peptides. We examined their binding affinity for MDM2 and MDMX, the cell entry mechanism, and role in reactivation of the p53 pathway. We identified two angler peptides, cTAT-KD3 and cR10-KD3, able to activate the p53 pathway in cancer cells. cTAT-KD3 entered cells via endocytic pathways, escaped endosomes, and activated the p53 pathway in breast (MCF7), lung (A549), and colon (HCT116) cancer cell lines at concentrations in the range of 1-12 μM. cR10-KD3 reached the cytosol via direct membrane translocation and activated the p53 pathway at 1 μM in all the tested cell lines. Our work demonstrates that nonpermeable anticancer peptides can be delivered into the cytosol and inhibit intracellular cancer pathways when they are conjugated with stable cell penetrating peptides. The mechanistic studies suggest that direct translocation leads to less toxicity, higher cytosol delivery at lower concentrations, and lower dependencies on the membrane of the tested cell line than occurs for an endocytic pathway with endosomal escape. The angler strategy can rescue high affinity peptide binders identified from high throughput screening and convert them into targeted anticancer therapeutics, but investigation of their cellular uptake and cell death mechanisms is essential to confirming modulation of the targeted cancer pathways.

The Wnt/β-catenin signaling pathway plays crucial roles in embryonic development and the development of multiple types of cancer, and its aberrant activation provides cancer cells with escape mechanisms from immune checkpoint inhibitors. E7386, an orally active selective inhibitor of the interaction between β-catenin and CREB binding protein, which is part of the Wnt/β-catenin signaling pathway, disrupts the Wnt/β-catenin signaling pathway in HEK293 and adenomatous polyposis coli ( APC )-mutated human gastric cancer ECC10 cells. It also inhibited tumor growth in an ECC10 xenograft model and suppressed polyp formation in the intestinal tract of Apc Min /+ mice, in which mutation of Apc activates the Wnt/β-catenin signaling pathway. E7386 demonstrated antitumor activity against mouse mammary tumors developed in mouse mammary tumor virus (MMTV)-Wnt1 transgenic mice. Gene expression profiling using RNA sequencing data of MMTV-Wnt1 tumor tissue from mice treated with E7386 showed that E7386 downregulated genes in the hypoxia signaling pathway and immune responses related to the CCL2, and IHC analysis showed that E7386 induced infiltration of CD8 + cells into tumor tissues. Furthermore, E7386 showed synergistic antitumor activity against MMTV-Wnt1 tumor in combination with anti-PD-1 antibody. In conclusion, E7386 demonstrates clear antitumor activity via modulation of the Wnt/β-catenin signaling pathway and alteration of the tumor and immune microenvironments, and its antitumor activity can be enhanced in combination with anti-PD-1 antibody. SIGNIFICANCE: These findings demonstrate that the novel anticancer agent, E7386, modulates Wnt/β-catenin signaling, altering the tumor immune microenvironment and exhibiting synergistic antitumor activity in combination with anti-PD-1 antibody., (©2021 American Association for Cancer Research.)

Poly-(ADP-ribose) polymerase 1 and 2 (PARP1 and PARP2) are key enzymes in the DNA damage response. Four different inhibitors (PARPi) are currently in the clinic for treatment of ovarian and breast cancer. Recently, histone PARylation Factor 1 (HPF1) has been shown to play an essential role in the PARP1- and PARP2-dependent poly-(ADP-ribosylation) (PARylation) of histones, by forming a complex with both enzymes and altering their catalytic properties. Given the proximity of HPF1 to the inhibitor binding site both PARPs, we hypothesized that HPF1 may modulate the affinity of inhibitors toward PARP1 and/or PARP2. Here we demonstrate that HPF1 significantly increases the affinity for a PARP1 - DNA complex of some PARPi (i.e., olaparib), but not others (i.e., veliparib). This effect of HPF1 on the binding affinity of Olaparib also holds true for the more physiologically relevant PARP1 - nucleosome complex but does not extend to PARP2. Our results have important implications for the interpretation of PARP inhibition by current PARPi as well as for the design and analysis of the next generation of clinically relevant PARP inhibitors.

Superparamagnetic iron oxide nanoparticles have been synthesized using chain length of (3-aminopropyl) triethoxysilane for cancer therapy. First, we have developed a layer by layer functionalized with grafting 2,4-toluene diisocyanate as a bi-functional covalent linker onto a nano-Fe 3 O 4 support. Then, they were characterized by Fourier transform infrared, X-ray powder diffraction, field emission scanning electron microscopy, energy-dispersive X-ray spectroscopy, and VSM techniques. Finally, all nanoparticles with positive or negative surface charges were tested against K562 (myelogenous leukemia cancer) cell lines to demonstrate their therapeutic efficacy by MTT assay test. We found that the higher toxicity of Fe 3 O 4 @SiO 2 @APTS ∼ Schiff base-Cu(II) (IC 50 : 1000 μg/mL) is due to their stronger in situ degradation, with larger intracellular release of iron ions, as compared to surface passivated NPs. For first time, the molecular dynamic simulations of all compounds were carried out afterwards optimizing using MM+, Semi-empirical (AM1) and Ab-initio (STO-3G), Forcite Gemo Opt, Forcite Dynamics, Forcite Energy and CASTEP in Materials studio 2017. The energy (eV), space group, lattice parameters (Å), unit cell parameters (Å), and electron density of the predicted structures were taken from the CASTEP module of Materials Studio. The docking methods were used to predict the DNA binding affinity, ribonucleotide reductase, and topoisomerase II.

A series of 2-(1 H -indol-3-yl)-5-substituted-1,3,4-oxadiazoles, 4a-m, were designed, synthesized and tested in vitro as potential pro-apoptotic Bcl-2 inhibitory anticancer agents based on our previously reported hit compounds. Synthesis of the target 1,3,4-oxadiazoles was readily accomplished through a cyclization reaction of indole carboxylic acid hydrazide 2 with substituted carboxylic acid derivatives 3a-m in the presence of phosphorus oxychloride. New compounds 4a-m showed a range of IC 50 values concentrated in the low micromolar range selectively in Bcl-2 positive human cancer cell lines. The most potent candidate 4-trifluoromethyl substituted analogue 4j showed selective IC 50 values of 0.52-0.88 μM against Bcl-2 expressing cell lines with no inhibitory effects in the Bcl-2 negative cell line. Moreover, 4j showed binding that was two-fold more potent than the positive control gossypol in the Bcl-2 ELISA binding affinity assay. Molecular modeling studies helped to further rationalize anti-apoptotic Bcl-2 binding and identified compound 4j as a candidate with drug-like properties for further investigation as a selective Bcl-2 inhibitory anticancer agent.

The inhibition of protein function by small compounds plays a critical role in controlling cell proliferation. We report on a new class of small molecule (NCTU-Alan-2026) inhibitors for cell proliferation. NCTU-Alan-2026 blocks the interaction between FGF1 and its receptor FGF1R2D2. Extensive NMR studies combined with fluorescence experiments provided the specific mechanism of how NCTU-Alan-2026 could inhibit cell proliferation. We describe an innovative therapeutic approach for anti-proliferation and demonstrate an example of inhibition of small molecules by blocking the protein-protein interaction. We found that the compound NCTU-Alan-2026 blocked the interaction between the two proteins FGF1 and FGF1R2D2 and inhibited cell proliferation. The toxicity of NCTU-Alan-2026 is lower than that of suramin. Thus, NCTU-Alan-2026 could be a better drug than suramin in the treatment of cancer., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2020 The Authors. Published by Elsevier Masson SAS.. All rights reserved.)

Proteomics has played an important role in elucidating the fundamental processes occuring in living cells. Translating these methods to metallodrug research ('metalloproteomics') has provided a means for molecular target identification of metal-based anticancer agents which should signifcantly advance the research field. In combination with biological assays, these techniques have enabled the mechanisms of action of metallodrugs to be linked to their interactions with molecular targets and aid understanding of their biological properties. Such investigations have profoundly increased our knowledge of the complex and dynamic nature of metallodrug-biomolecule interactions and have provided, at least for some compound types, a more detailed picture on their specific protein-binding patterns. This perspective highlights the progression of metallodrug proteomics research for the identification of non-DNA targets from standard analytical techniques to powerful metallodrug pull-down methods.

Many reports have indicated that the insulin receptor (IR) causes tumorigenesis and the development of breast cancer. It has been considered a potential target for treating IR-related tumors. Traditionally, there are two categories of insulin receptor (IR) antagonists, they are small molecule antagonists and anti-IR antibodies. Here, we describe a new method (anti-idiotypic antibody strategy) for the development of IR antagonist. Hybridoma technology was employed to design and identify a series of anti-idiotypic antibodies against insulin. After repeated screening and identification, an anti-idiotypic antibody against IR (AK98) was obtained. Analysis through competitive ELISA and competitive receptor binding indicated that AK98 mimicked the receptor binding epitope of insulin. The interaction between AK98 and IR was determined using indirect immunofluorescence, immunoelectron microscopy, and Immunoprecipitation-Western (IP-WB). Further research using a tumor cell model revealed that AK98 inhibited insulin-IR binding and IR-mediated intracellular signaling pathways. Conclusively, the main purpose of this paper is that we proposed a new method (anti-idiotypic antibody strategy) to develop the insulin receptor (IR) antagonist (AK98), and a series of experiments showed that the anti-idiotypic antibody (AK98) exhibited good antagonistic activity against IR. This work suggests that the anti-idiotypic antibody may be a potential strategy to develop IR antagonists that can be used in treating breast cancer.

Protein-protein interactions (PPIs), many of which are dominated by α-helical recognition domains, play key roles in many essential cellular processes, and the dysregulation of these interactions can cause detrimental effects. For instance, aberrant PPIs involving the Bcl-2 protein family can lead to several diseases including cancer, neurodegenerative diseases, and diabetes. Interactions between Bcl-2 pro-life proteins, such as Mcl-1, and pro-death proteins, such as Bim, regulate the intrinsic pathway of apoptosis. p53, a tumor-suppressor protein, also has a pivotal role in apoptosis and is negatively regulated by its E3 ubiquitin ligase HDM2. Both Mcl-1 and HDM2 are upregulated in numerous cancers, and, interestingly, there is crosstalk between both protein pathways. Recently, synergy has been observed between Mcl-1 and HDM2 inhibitors. Towards the development of new anticancer drugs, we herein describe a polypharmacology approach for the dual inhibition of Mcl-1 and HDM2 by employing three densely functionalized isoxazoles, pyrazoles, and thiazoles as mimetics of key α-helical domains of their partner proteins., (© 2020 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.)

Molecular-glue degraders mediate interactions between target proteins and components of the ubiquitin-proteasome system to cause selective protein degradation. Here, we report a new molecular glue HQ461 discovered by high-throughput screening. Using loss-of-function and gain-of-function genetic screening in human cancer cells followed by biochemical reconstitution, we show that HQ461 acts by promoting an interaction between CDK12 and DDB1-CUL4-RBX1 E3 ubiquitin ligase, leading to polyubiquitination and degradation of CDK12-interacting protein Cyclin K (CCNK). Degradation of CCNK mediated by HQ461 compromised CDK12 function, leading to reduced phosphorylation of a CDK12 substrate, downregulation of DNA damage response genes, and cell death. Structure-activity relationship analysis of HQ461 revealed the importance of a 5-methylthiazol-2-amine pharmacophore and resulted in an HQ461 derivate with improved potency. Our studies reveal a new molecular glue that recruits its target protein directly to DDB1 to bypass the requirement of a substrate-specific receptor, presenting a new strategy for targeted protein degradation., Competing Interests: LL, PC, LC, YL, QW, JL, TH A provisional patent application (PCT/CN2020/095482) has been filed for the application of HQ461 and related small molecules as molecular glues regulating CDK12-DDB1 interaction to degrade CCNK. ZZ, YC, JW, MD, XQ No competing interests declared, (© 2020, Lv et al.)

Noscapine is a natural alkaloid that is used as an antitussive medicine. However, it also acts as a weak anticancer agent in certain in vivo models through a mechanism that is largely unknown. Here, we performed structural studies and show that the cytotoxic agent 7A- O -demethoxy-amino-noscapine (7A-aminonoscapine) binds to the colchicine site of tubulin. We suggest that the 7A-methoxy group of noscapine prevents binding to tubulin due to a steric clash of the compound with the T5-loop of α-tubulin. We further propose that the anticancer activity of noscapine arises from a bioactive metabolite that binds to the colchicine site of tubulin to induce mitotic arrest through a microtubule cytoskeleton-based mechanism.

The human pregnane X receptor (hPXR) is activated by a large set of endogenous and exogenous compounds and plays a critical role in the control of detoxifying enzymes and transporters regulating liver and gastrointestinal drug metabolism and clearance. hPXR is also involved in both the development of multidrug resistance and enhanced cancer cells aggressiveness. Moreover, its unintentional activation by pharmaceutical drugs can mediate drug-drug interactions and cause severe adverse events. In that context, the potential of the anticancer BRAF inhibitor dabrafenib suspected to activate hPXR and the human constitutive androstane receptor (hCAR) has not been thoroughly investigated yet. Using different reporter cellular assays, we demonstrate that dabrafenib can activate hPXR as efficiently as its reference agonist SR12813, whereas it does not activate mouse or zebrafish PXR nor hCAR. We also showed that dabrafenib binds to recombinant hPXR, induces the expression of hPXR responsive genes in colon LS174T-hPXR cancer cells and human hepatocytes and finally increases the proliferation in LS174T-hPXR cells. Our study reveals that by using a panel of different cellular techniques it is possible to improve the assessment of hPXR agonist activity for new developed drugs.

Astragalus membranaceus (HUANG QI, HQ) is a kind of traditional Chinese medicine. Researchers have widely concerned its antitumor effect. At present, there is still a lack of research on the treatment of laryngeal cancer with HQ. In this study, we integrated data from the weighted gene co-expression network of laryngeal cancer samples and the components and targets of HQ. A new method for dividing PPI network modules is proposed. Important targets of HQ treatment for laryngeal cancer were obtained through the screening of critical modules. These nodes performed differential expression analysis and survival analysis through external data sets. GSEA enrichment analysis reveals pathways for important targets participation. Finally, molecular docking screened active ingredients in HQ that could interact with important targets. Combined with the laryngeal cancer gene co expression network and HQ PPI network, we obtained the critical module related to laryngeal cancer. Among them, MMP1, MMP3, and MMP10 were chosen as important targets. External data sets demonstrate that their expression in tumor samples is significantly higher than in normal samples. The survival time of patients with high expression group was significantly shortened, which is a negative factor for prognosis. GSEA enrichment analysis found that they are mainly involved in tumor-related pathways such as ECM receptor interaction and Small cell lung cancer. The docking results show that the components that can well bind to important targets of HQ are quercetin, rutin, and Chlorogenic acid, which may be the primary mechanism of the anti-cancer effect of HQ. These findings provide a preliminary research basis for Chinese medicine treatment of laryngeal cancer and offer ideas to related drug design.

Metastasis is the major cause of mortality for patients with cancer, and dysregulation of developmental signaling pathways can significantly contribute to the metastatic process. The Sine oculis homeobox homolog 1 (SIX1)/eyes absent (EYA) transcriptional complex plays a critical role in the development of multiple organs and is typically downregulated after development is complete. In breast cancer, aberrant expression of SIX1 has been demonstrated to stimulate metastasis through activation of TGFβ signaling and subsequent induction of epithelial-mesenchymal transition (EMT). In addition, SIX1 can induce metastasis via non-cell autonomous means, including activation of GLI-signaling in neighboring tumor cells and activation of VEGFC-induced lymphangiogenesis. Thus, targeting SIX1 would be expected to inhibit metastasis while conferring limited side effects. However, transcription factors are notoriously difficult to target, and thus novel approaches to inhibit their action must be taken. Here we identified a novel small molecule compound, NCGC00378430 (abbreviated as 8430), that reduces the SIX1/EYA2 interaction. 8430 partially reversed transcriptional and metabolic profiles mediated by SIX1 overexpression and reversed SIX1-induced TGFβ signaling and EMT. 8430 was well tolerated when delivered to mice and significantly suppressed breast cancer-associated metastasis in vivo without significantly altering primary tumor growth. Thus, we have demonstrated for the first time that pharmacologic inhibition of the SIX1/EYA2 complex and associated phenotypes is sufficient to suppress breast cancer metastasis. SIGNIFICANCE: These findings identify and characterize a novel inhibitor of the SIX1/EYA2 complex that reverses EMT phenotypes suppressing breast cancer metastasis., (©2020 American Association for Cancer Research.)

SHQ1 was reported to control the biogenesis and assembly of H/ACA ribonucleoprotein particles (RNPs). It was independently isolated as a growth suppressor, GRIM1, in a genetic screen. Recent studies have indicated that SHQ1 inhibits prostate cancer growth and metastasis. SHQ1 facilitates MYC RNA splicing to promote T-acute lymphoblastic leukemia (T-ALL) development. Thus, the mechanisms of SHQ1 in cancers remain largely unknown. We report here that SHQ1 promotes tumor apoptosis and chemo-sensitivity in hepatocellular carcinoma (HCC) cells. In HCC tissues from patients, expression of SHQ1 was significantly decreased in the tumor compared to adjacent tissues. Experiments with HCC xenograft models revealed that restoring SHQ1 levels enhanced the anti-tumor activity of the endoplasmic reticulum (ER) stress inducer tunicamycin (TM) and common chemotherapy drug paclitaxel (PTX). Mechanistically, SHQ1 is an ER-stress response gene which is regulated by p50ATF6 and XBP1s through an ER stress response like element located on the SHQ1 promoter. SHQ1 interacts with the ER chaperone GRP78 to release ER sensors PERK/IRE1α/ATF6 from GRP78/ER-sensor complexes, leading to hyper-activation of unfolded protein response (UPR). In the persistent ER stress conditions of a HepG2 xenograft tumor model, SHQ1-mediated hyper-activation of ER-sensor signaling induces apoptosis. Our study thus demonstrates a SHQ1-mediated ER-stress response feedback loop that promotes tumor sensitivity to chemotherapeutics.

A series of novel pyrazoline derivatives containing methyl-1H-indole moiety were discovered as potential inhibitors for blocking APC-Asef interactions. The top hit Q19 suggested potency of inhibiting APC-Asef interactions and attractive preference for human-sourced colorectal cells. It was already comparable with the previous representative and the positive control Regorafenib before further pharmacokinetic optimization. The introduction of methyl-1H-indole moiety realized the Mitochondrial affection thus might connect the impact on the protein-interaction level with the apoptosis events. The molecular docking simulation inferred that bringing trifluoromethyl groups seemed a promising approach for causing more key interactions such as H-bonds. This work raised referable information for further discovery of inhibitors for blocking APC-Asef interactions., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2020 Elsevier Inc. All rights reserved.)

Human Bruton's tyrosine kinase (hBtk) plays a key role in growth and metabolism of B cells, but its dysfunctions cause various B-cell malignancies. Inhibitors targeting the ATP-binding pocket of hBtk have been developed, but they have several drawbacks such as adverse side effects and occurrence of drug-resistant mutations. Here, we present a protein binder which specifically binds to an allosteric regulatory SH2 domain of hBtk. The protein binder effectively inhibited the hBtk activity, indicating a critical role of the SH2 domain in allosteric regulation of the hBtk activity. Cytosolic delivery of the protein binder led to a significant inhibition on the BCR-mediated signaling and viability of B lymphoma cells. The utility of our approach was demonstrated by effective inhibition of drug-resistant hBtk variants by the protein binder. Based on the computationally predicted binding mode, the protein binder is likely to inhibit the hBtk activity by disrupting the interaction between the SH2 domain and kinase domain. The present approach can be used for developing therapeutic agents with improved efficacy for B-cell lymphoma., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2020 Elsevier Inc. All rights reserved.)

Speckle-type POZ protein (SPOP) is overexpressed in the nucleus and misallocated in the cytoplasm in almost all the clear-cell renal cell carcinomas (ccRCCs), which leads to kidney tumorigenesis. Previously, we elucidated that the oncogenic SPOP-signaling pathway in ccRCC could be suppressed by 6b that inhibits SPOP-mediated protein interactions. Herein, we have established a structure-activity relationship for 6b analogues as SPOP inhibitors. Compound 6lc suppresses the viability and inhibits the colony formation of ccRCC cell lines driven by cytoplasmic SPOP, superior to 6b . Compound 6lc binds to the SPOP protein in vitro and disrupts SPOP binding to phosphatase-and-tensin homologue (PTEN) in HEK293T cells, which causes the observable phenomena: a decline in the ubiquitination of PTEN, elevated levels of both PTEN and dual-specificity phosphatase 7, and decreased levels of phosphorylated AKT and ERK when ccRCC cell lines are exposed to 6lc in a dose-response manner. Taken together, compound 6lc is a potent candidate against kidney tumorigenesis.

Targeting the menin-MLL protein-protein interaction is a new therapeutic strategy for the treatment of acute leukemia carrying MLL fusion (MLL leukemia). We describe herein the structure-based optimization of a class of covalent menin inhibitors, which led to the discovery of M-808 ( 16 ) as a highly potent and efficacious covalent menin inhibitor. M-808 effectively inhibits leukemia cell growth at low nanomolar concentrations and is capable of achieving partial tumor regression in an MV4;11 xenograft tumor model in mice at a well-tolerated dose schedule. Determination of the co-crystal structure of M-808 in complex with menin provides a structural basis for their high-affinity, covalent interactions. M-808 represents a promising, covalent menin inhibitor for further optimization and evaluation toward developing a new therapy for the treatment of MLL leukemia.

The histone demethylase lysine-specific demethylase 4A (KDM4A) is reported to be overexpressed and plays a vital in multiple cancers through controlling gene expression by epigenetic regulation of H3K9 or H3K36 methylation marks. However, the biological role and mechanism of KDM4A in prostate cancer (PC) remain unclear. Herein, we reported KDM4A expression was upregulation in phosphatase and tensin homolog knockout mouse prostate tissue. Depletion of KDM4A in PC cells inhibited their proliferation and survival in vivo and vitro. Further studies reveal that USP1 is a deubiquitinase that regulates KDM4A K48-linked deubiquitin and stability. Interestingly, we found c-Myc was a key downstream effector of the USP1-KDM4A/androgen receptor axis in driving PC cell proliferation. Notably, upregulation of KDM4A expression with high USP1 expression was observed in most prostate tumors and inhibition of USP1 promotes PC cells response to therapeutic agent enzalutamide. Our studies propose USP1 could be an anticancer therapeutic target in PC., (© 2020 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.)

The Y-box binding protein 1 (YB1) is an established metastatic marker: high expression and nuclear localization of YB1 correlate with tumor aggressiveness, drug resistance, and poor patient survival in various tumors. In the nucleus, YB1 interacts with and regulates the activities of several nuclear proteins, including the DNA glycosylase, human endonuclease III (hNTH1). In the present study, we used Förster resonance energy transfer (FRET) and AlphaLISA technologies to further characterize this interaction and define the minimal regions of hNTH1 and YB1 required for complex formation. This work led us to design an original and cost-effective FRET-based biosensor for the rapid in vitro high-throughput screening for potential inhibitors of the hNTH1-YB1 complex. Two pilot screens were carried out, allowing the selection of several promising compounds exhibiting IC 50 values in the low micromolar range. Interestingly, two of these compounds bind to YB1 and sensitize drug-resistant breast tumor cells to the chemotherapeutic agent, cisplatin. Taken together, these findings demonstrate that the hNTH1-YB1 interface is a druggable target for the development of new therapeutic strategies for the treatment of drug-resistant tumors. Moreover, beyond this study, the simple design of our biosensor defines an innovative and efficient strategy for the screening of inhibitors of therapeutically relevant protein-protein interfaces.

Although both the incidence and the mortality rate of breast cancer is rising, there is no potent and practical option for the treatment of these patients, particularly in advanced stages. One of the most critical challenges for treatment is the presence of complicated and extensive tumor escape mechanisms in the tumor microenvironment. Immune checkpoint molecules are of the main immunosuppressive mechanisms used by cancerous cells to block anti-cancer immune responses. Among these molecules, PD-1 (Programmed cell death) and PD-L1 (programmed cell death-ligand 1) have been considered as worthy therapeutic targets for breast cancer therapy. In this review, we intend to discuss the immunobiology and signaling of the PD-1/PD-L1 axis and highlight its importance as a worthy therapeutic target in breast cancer. We believe that the prognostic value of PD-L1 depends on the breast cancer subtype. Moreover, the combination of PD-1/PD-L1 targeting with immune-stimulating vaccines can be considered as an effective therapeutic strategy in breast cancer., Competing Interests: Declaration of competing interest There is no conflict of interest., (Copyright © 2020 Elsevier Inc. All rights reserved.)

Aims: Inhibition of P53-MDM2/X interaction is known as an effective cancer therapy strategy. In this regard, pDI peptide was introduced previously with the potential of targeting MDM2. In this research, the large-scale peptide mutation screening was used to achieve the best sequence of pDI with the highest affinity for inhibition activity against MDM2/X., Main Methods: Three mutant peptides of pDI as dual inhibitor peptides including single mutations of pDIm/4W, pDIm/11M and double mutations of pDIdm/4W11M were presented with the high affinities to inhibit both MDM2/X. The selected mutants were then evaluated comprehensively to confirm their ability as potent MDM2/X inhibitors, using a theoretical simulation approach., Key Findings: MD simulations analyses confirmed their dual inhibition potential against both MDM2/X interactions with p53 protein. The developed pDIm and mainly pDIdm peptides showed stable conformations over the simulation time with conserved secondary structure and effective interaction with MDM2/X by physical binding such as hydrogen bonding. Besides, umbrella sampling free energy calculation indicated higher binding energy, ΔG binding , of pDIm-MDM2/X and pDIdm-MDM2/X compared to pDI-MDM2/X., Significance: The optimized and improved mutant pDI, pDIdm, with more effective ΔG binding values of -30 and -25 kcal/mol to MDMX and MDM2, respectively, is recommended as a promising anticancer agent and suitable candidate for experimental evaluations., Competing Interests: Declaration of competing interest The authors declare that they have no competing interests., (Copyright © 2020 Elsevier Inc. All rights reserved.)

NF-κB is a pro-inflammatory transcription factor that critically regulates immune responses and other distinct cellular pathways. However, many NF-κB-mediated pathways for cell survival and apoptosis signaling in cancer remain to be elucidated. Cell cycle and apoptosis regulatory protein 1 (CARP-1 or CCAR1) is a perinuclear phosphoprotein that regulates signaling induced by anticancer chemotherapy and growth factors. Although previous studies have reported that CARP-1 is a part of the NF-κB proteome, regulation of NF-κB signaling by CARP-1 and the molecular mechanism(s) involved are unclear. Here, we report that CARP-1 directly binds the NF-κB-activating kinase IκB kinase subunit γ (NEMO or NF-κB essential modulator) and regulates the chemotherapy-activated canonical NF-κB pathway. Importantly, blockade of NEMO-CARP-1 binding diminished NF-κB activation, indicated by reduced phosphorylation of its subunit p65/RelA by the chemotherapeutic agent adriamycin (ADR), but not NF-κB activation induced by tumor necrosis factor α (TNFα), interleukin (IL)-1β, or epidermal growth factor. High-throughput screening of a chemical library yielded a small molecule inhibitor of NEMO-CARP-1 binding, termed selective NF-κB inhibitor 1 (SNI)-1). We noted that SNI-1 enhances chemotherapy-dependent growth inhibition of a variety of cancer cells, including human triple-negative breast cancer (TNBC) and patient-derived TNBC cells in vitro , and attenuates chemotherapy-induced secretion of the pro-inflammatory cytokines TNFα, IL-1β, and IL-8. SNI-1 also enhanced ADR or cisplatin inhibition of murine TNBC tumors in vivo and reduced systemic levels of pro-inflammatory cytokines. We conclude that inhibition of NEMO-CARP-1 binding enhances responses of cancer cells to chemotherapy.

Efficient enrichment and transmembrane transport of cytotoxic reagents are considered to be effective strategies to increase the efficiency and selectivity of antitumor drugs targeting solid tumors. In the present study, a recombinant protein ABD‑LDP‑Ec consisting of the albumin‑binding domain (ABD), the apoprotein (LDP) of lidamycin (LDM) and an EGFR‑targeting oligopeptide (Ec) was prepared by DNA recombination and bacterial fermentation, and was integrated with the enediyne chromophore (AE) of lidamycin to generate its enediyne‑integrated analogue ABD‑LDP‑Ec‑AE. ABD‑LDP‑Ec exhibited high binding capacity to both albumin and EGFR‑positive pancreatic cancer cells, and was internalized into the cytoplasm through receptor‑mediated endocytosis and albumin‑driven macropinocytosis of K‑ras mutant cells. In animal experiments, ABD‑LDP‑Ec demonstrated notable selective distribution in pancreatic carcinoma xenografts by passive targeting of albumin captured in the blood and was retained in the tumor for 48 h. ABD‑LDP‑Ec and ABD‑LDP‑Ec‑AE exhibited inhibitory activity in cell proliferation and AsPC‑1 xenograft growth, and ABD‑LDP‑Ec‑AE increased the tumor growth inhibition rate by 20% compared with natural LDM. The results indicated that the introduction of ABD‑based multi‑functional drug delivery may be an effective approach to improve the efficacy of antitumor drugs, especially for K‑ras mutant cancers.

Genetic rearrangements of the mixed lineage leukemia (MLL) leading to oncogenic MLL-fusion proteins (MLL-FPs). MLL-FPs occur in about 10% of acute leukemias and are associated with dismal prognosis and treatment outcomes which emphasized the need for new therapeutic strategies. In present study, by a cell-based screening in-house compound collection, we disclosed that Rabeprazole specially inhibited the proliferation of leukemia cells harboring MLL-FPs with little toxicity to non-MLL cells. Mechanism study showed Rabeprazole down-regulated the transcription of MLL-FPs related Hox and Meis1 genes and effectively inhibited MLL1 H3K4 methyltransferase (HMT) activity in MV4-11 cells bearing MLL-AF4 fusion protein. Displacement of MLL1 probe from WDR5 protein suggested that Rabeprazole may inhibit MLL1 HMT activity through disturbing MLL1-WDR5 protein-protein interaction. Moreover, other proton pump inhibitors (PPIs) also indicated the inhibition activity of MLL1-WDR5. Preliminary SARs showed the structural characteristics of PPIs were also essential for the activities of MLL1-WDR5 inhibition. Our results indicated the drug reposition of PPIs for MLL-rearranged leukemias and provided new insight for further optimization of targeting MLL1 methyltransferase activity, the MLL1-WDR5 interaction or WDR5., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2020 Elsevier Masson SAS. All rights reserved.)

Cell division cycle 37 (Cdc37) is known to work as a kinase-specific cochaperone, which selectively regulates the maturation of kinases through protein-protein interaction (PPI) with Hsp90. Directly disrupting the Hsp90-Cdc37 PPI is emerging as an alternative strategy to develop anticancer agents through a specific inhibition manner of kinase clients of Hsp90. Based on a first specific small-molecule inhibitor targeting Hsp90-Cdc37 PPI ( DDO-5936 ), which was previously reported by our group, we conducted a preliminary investigation of the structure-activity relationships and pharmacodynamic evaluations to improve the potency and drug-like properties. Here, our efforts resulted in the currently best inhibitor 18h with improved binding affinity ( K d = 0.5 μM) and cellular inhibitory activity (IC 50 = 1.73 μM). Both in vitro and in vivo assays revealed that 18h could efficiently block the Hsp90-Cdc37 interaction to specifically inhibit kinase clients of Hsp90. Furthermore, 18h showed ideal physiochemical properties with favorable stability, leading to an oral efficacy in vivo.

Despite prophylactic vaccination campaigns, human papillomavirus (HPV)-induced cancers still represent a major medical issue for global population, thus specific anti-HPV drugs are needed. Since the ability of HPV E6 oncoprotein to promote p53 degradation is linked to tumor progression, E6 has been proposed as an ideal target for cancer treatment. Using the crystal structure of the E6/E6AP/p53 complex, we performed an in silico screening of small-molecule libraries against a highly conserved alpha-helix in the N-terminal domain of E6 involved in the E6-p53 interaction. We discovered a compound able to inhibit the E6-mediated degradation of p53 through disruption of E6-p53 binding both in vitro and in cells. This compound could restore p53 intracellular levels and transcriptional activity, reduce the viability and proliferation of HPV-positive cancer cells, and block 3D cervospheres formation. Mechanistic studies revealed that the compound anti-tumor activity mainly relies on induction of cell cycle arrest and senescence. Our data demonstrate that the disruption of the direct E6-p53 interaction can be obtained with a small-molecule compound leading to specific antitumoral activity in HPV-positive cancer cells and thus represents a new approach for anti-HPV drug development., (Copyright © 2019 Elsevier B.V. All rights reserved.)

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

Activin-like kinase 5 (ALK-5) is involved in the physiopathology of several conditions, such as pancreatic carcinoma, cervical cancer and liver hepatoma. Cellular events that are landmarks of tumorigenesis, such as loss of cell polarity and acquisition of motile properties and mesenchymal phenotype, are associated to deregulated ALK-5 signaling. ALK-5 inhibitors, such as SB505154, GW6604, SD208, and LY2157299, have recently been reported to inhibit ALK-5 autophosphorylation and induce the transcription of matrix genes. Due to their ability to impair cell migration, invasion and metastasis, ALK-5 inhibitors have been explored as worthwhile hits as anticancer agents. This work reports the development of a structure-based virtual screening (SBVS) protocol aimed to prospect promising hits for further studies as novel ALK-5 inhibitors. From a lead-like subset of purchasable compounds, five molecules were identified as putative ALK-5 inhibitors. In addition, molecular dynamics and binding free energy calculations combined with pharmacokinetics and toxicity profiling demonstrated the suitability of these compounds to be further investigated as novel ALK-5 inhibitors.

Targeting of MDM2-p53 protein-protein interaction is a current approach for the development of potent anticancer agents. The classical pharmacophore hypothesis for the design of such molecules describes the three point binding of a small molecule inhibitor to the MDM2 protein. However, this hypothesis is not confirmed when considering the activity of a number of known potent MDM2 inhibitors. Here we demonstrate the important role of the flexible N-terminal region of the MDM2 protein in the binding with small molecule compounds, which contributes to the transition from three point binding to four point binding during the development of new anticancer agents. To evaluate the contribution of the MDM2 N-terminal region to the structure-activity relationship of known MDM2 inhibitors, compounds of nutlin series, whose spatial configuration was shown to dramatically affect the target activity, were used as objects of the study. The key amino acid residues within the N-terminal region involved in the interaction with small molecule ligands were determined by means of molecular dynamics. The conformational stability of the flexible MDM2 fragment was simulated under different conditions. The effects of point mutations on the N-terminal region stability were also demonstrated.

Curcumin is a natural phytochemical with potent anti-neoplastic properties including modulation of p53. Targeting p53 activity has been suggested as an important strategy in cancer therapy. The purpose of this study was to describe a mechanism by which curcumin restores p53 levels in human cancer cell lines. HeLa, SiHa, CaSki and MDA-MB-231 cells were exposed to curcumin and a pulse and chase and immunoprecipitation assays were performed. Here we showed that curcumin increases the half-life of p53 by a physical interaction between p53-NQO1 (p53 - NAD(P)H:quinone oxidoreductase 1) proteins after treatment with curcumin. Interestingly, the cell viability assay after treatment with curcumin showed that the cytotoxic activity was selectively higher in cervical cancer cells contained wild type p53 but not in breast cancer cells contained mutated p53. The cytotoxic effect of curcumin in cervical cancer cells was related to the complex p53-NQO1 that avoids the interaction between p53 and its negative regulator ubiquitin ligase E6-associated protein (E6AP). Finally, we demonstrated that in pancreatic epithelioid carcinoma cells (PANC1) that are knockout for NQO1, the reestablishment of NQO1 expression can stabilize p53 in presence of curcumin. Collectively, our findings showed that curcumin is necessary to promote the protein interaction of NQO1 with p53, therefore, it increases the half-life of p53, and permits the cytotoxic effect of curcumin in cancer cells containing wild type p53. Our findings suggest that the use of curcumin may reactivate the p53 pathway in cancer cells with p53 wild-type., (Copyright © 2019 The Authors. Published by Elsevier B.V. All rights reserved.)