Search

In mouse atrium, M₂ and M₃ muscarinic receptors (M₂R and M₃R) are involved in biphasic (negative and positive) inotropic actions of muscarinic agonists, and the positive inotropic action is reduced by indomethacin. The aim of our study was to determine the localization of M₂R, M₃R and cyclo-oxygenase (COX) in mouse atrium and to characterize muscarinic receptor-mediated positive inotropy. M₂R immunoreactivity was found only on atrial myocardium, but M₃R immunoreactivity was localized on both the myocardium and endocardial endothelium. COX-1 and COX-2 immunoreactivities were identified in both myocardial and endocardial endothelium. In electrically stimulated left atria, carbachol caused M₂R-mediated negative inotropy followed by M₃R-mediated positive inotropy. Removal of atrial endothelium reduced the positive inotropy without affecting the negative inotropy, suggesting that stimulation of endothelial M₃R mediates the positive inotropy. N-[2-(cyclohexyloxy)-4-nitrophenyl]-methanesulfonamide (NS398, COX-2 inhibitor) decreased the carbachol-induced positive inotropy; however, 5-(4-chlorophenyl)-1-(4-methoxyphenyl)-3-trifluoromethylpyrazole (SC560, COX-1 inhibitor), 1-[[4,5-bis(4-methoxyphenyl)-2-thiazolyl]carbonyl]-4-methylpiperazine (FR122047, COX-1 inhibitor) and L-nitroarginine methylester did not affect the inotropic response. M₃R activation caused positive chronotropy in spontaneously beating right atria when M₂R-mediated negative chronotropy was suppressed and rate of contraction was low,350 beats min⁻¹. Our results indicate that although M₃Rs are located on both myocardial cells and endocardial endothelial cells, only endothelial M₃Rs mediate positive inotropy in response to muscarinic agonists via activation of COX-2 in the mouse atrium. M₃R-mediated positive chronotropy counteracting M₂R-mediated negative chronotropy was also demonstrated.

The effects of trimebutine on Ca2+ release and modulation of Ca2+ sensitivity of contractile elements induced by carbachol (CCh) were investigated using a tension measuring method in beta-escin-treated skinned smooth muscle of the longitudinal muscle layer of guinea pig ileum. Trimebutine (10-100 microM) concentration-dependently inhibited tension development brought about by Ca2+ release from intracellular stores induced by CCh (10 microM), but did not affect those induced by inositol 1,4,5-trisphosphate (IP3, 25 microM) or caffeine (5 mM). The inhibitory effect was reversible. Trimebutine (100 microM) neither altered the Ca2+ sensitivity of the contractile elements nor affected the effects of GTP gamma S (50 microM) and CCh (100 microM) in potentiating Ca2+ sensitivity of the contractile elements after the Ca2+ storage function had been eliminated by A23187. These results suggest that trimebutine inhibits CCh-induced Ca2+ release by acting at some point during the coupling of muscarinic receptors through a G-protein to phospholipase C and thus reducing the accumulation of IP3.

Clonal deletion and anergy are two major mechanisms of self-tolerance. However, the molecular mechanisms underlying clonal deletion and anergy, as well as the threshold of TCR affinity/avidity required for these processes, are not known. Expression of the V beta 8.1 TCR correlates with the reactivity of the T cells to the minor lymphocyte stimulating locus-1a (Mls-1a) and T cells expressing this TCR are deleted in the thymus of Mls-1a mice. Similarly, in TCR V beta 8.1 transgenic mice, the number of CD4+CD8-T cells is reduced in Mls-1a mice. However, small numbers of CD4+CD8-T cells remain in the periphery of adult Mls-1a transgenic mice. We have generated T cell clones from TCR V beta 8.1 transgenic mice by stimulation of lymph node T cells with C57BL/6 alloantigens. Interestingly, CD4+CD8-V beta 8.1+ clones isolated from the transgenic mice of Mls-1a background responded to the self-antigen Mls-1a, to which they did not respond in primary assay. Reactive patterns of the clones were compared with clones derived from Mls-1b mice. Proliferation and cytokine production of the clones from Mls-1a mice to the self-antigen Mls-1a were generally reduced when compared with clones from Mls-1b mice. More importantly, T cell clones from Mls-1a mice required more Mls-1a antigen for their activation, and were more susceptible to the inhibitory effects of anti-CD4 antibody on the proliferative responses to Mls-1a than those from Mls-1b mice. These results suggest that the T cell receptor on clones derived from Mls-1a mice have functional but reduced affinity/avidity for self-antigen Mls-1a.

In single cells obtained by enzymic treatment of rabbit small-intestinal smooth muscle, and held under voltage clamp by patch pipette in the whole-cell recording mode, release of inositol trisphosphate (InsP3) from its caged precursor by flash photolysis caused complete inhibition of the voltage-dependent calcium current. No inhibition was seen in control experiments where the cage (2-nitrosoacetophenone) was released by flash photolysis from caged ATP. The inhibition by InsP3 of the calcium current was prevented if 10 mM EGTA or 2 mg/ml heparin was included in the pipette solution. Heparin is known to block InsP3 receptors. These results suggest that release of calcium stores by InsP3 raises Cai and that calcium ions inhibit the calcium current by acting either directly or otherwise on the internal mouth of the calcium channel.

5-Hydroxytryptamine (5-HT) receptor subtypes involved in 5-HT-induced contraction of the chicken gastrointestinal tract were characterized pharmacologically using subtype-selective agonists and antagonists. The proventriculus (area of stomach adjacent to the oesophagus) and ileum are examined. 5-HT applied cumulatively caused sustained contraction of the proventriculus that was not decreased by tetrodotoxin, atropine or l-nitro-arginine methylester (l-NAME). alpha-Methyl-5-HT showed the same potency as that of 5-HT, indicating the involvement of the 5-HT(2) receptor. (+/-)-1-(2,5-dimethoxy-4-iodophenyl)-2-amino-propane (DOI), 5-methoxytryptamine and 1-(3-chlorophenyl)piperazine hydrochloride (mCPP) were potent, and 2-methyl-5-HT, 5-carboxamidotryptamine, BW723C86 and 6-chloro-2-(1-piperazinyl)pyrazine hydrochloride (MK212) were moderate, but (+/-)-8-hydroxy-2-dipropylaminotetralin hydrobromide (8-OH-DPAT), [endo-N-8-methyl-8-azabicyclo-(3,2,1)oct-3-yl]-2,3-dihydro-(1-methyl)ethyl-2-oxo-1H-benzimidazol-1-carboxamide (BIMU-8) and cisapride were weak agonists. Correlation of pEC(50) values of these agonists with documented pEC(50) values for 5-HT(2C) receptor was higher than 5-HT(2A) and 5-HT(2B). Cinanserin, ketanserin, methiothepin, methysergide, mianserin, (8-[5-(2,4-dimethoxy-5-(4-trifluoromethylphenylsulphonamido)phenyl-5-oxopentyl)-1,3,8-triazaspiro[4,5]decane-2,4-dione hydrochloride (RS102221), N-(1-methyl-1H-indolyl-5-yl)-N'-(3-methyl-5-isothiazolyl)urea (SB204741), spiperone and N-desmethylclozapine concentration-dependently inhibited the contractile responses to 5-HT. Correlation of pK(b)/pA(2) of antagonists with documented pK(i) for 5-HT(2C) receptor was highest among 5-HT(2) receptor subtypes. In the methysergide- and ketanserin-treated proventriculus, 5-HT, 2-methyl-5-HT and cisapride did not enhance the electrical field stimulation (5 Hz)-induced cholinergic contractions. 5-HT applied non-cumulatively caused transient contraction of ileum, and the responses were partly decreased by atropine or tetrodotoxin. 5-Methoxytryptamine, alpha-methyl-5-HT, 5-carboxamidotryptamine, L692,247 and DOI were potent agonists. However, 2-methyl-5-HT, cisapride, BW723C86, 8-OH-DPAT and 5-nonyloxytryptamine, mCPP and MK212 were less effective. Ketanserin and methysergide decreased the 5-HT-induced ileal contraction, but neither GR113808 nor SB269970 inhibited the responses. In conclusion, 5-HT causes contraction of the proventriculus via 5-HT(2C)-like receptors present on smooth muscle. 5-HT also causes contraction of the ileum, but the underlying mechanisms are complex, involving neural and smooth muscle components, and both 5-HT(1)- and 5-HT(2)-like receptors. Neural 5-HT receptors similar to 5-HT(3)/5-HT(4) receptors were not found in the chicken proventriculus and ileum.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

(1) The effects on the whole-cell carbachol-induced muscarinic cationic current (mIcat) of antibodies against the alpha-subunits of various G proteins, as well as the effect of a Gbetagamma subunit, were studied in single guinea-pig ileal smooth muscle cells voltage-clamped at -50 mV. Ionized intracellular calcium concentration, [Ca(2+)](i), was clamped at 100 nM using a 1,2-bis(2-aminophenoxyl-ethane-N,N,N',N'-tetraacetic acid)/Ca(2+) mixture. (2) Application of ascending concentrations of carbachol (1-300 micro M) activated mIcat (mean amplitude 0.83 nA at 300 micro M carbachol; EC(50) 8 micro M; Hill slope 1.0). A 20 min or longer intracellular application via the pipette solution of G(i3)/G(o) or G(o) antibodies resulted in about a 70% depression of the maximum response without change in the EC(50) value. In contrast, antibodies against alpha-subunits of G(i1), G(i1)/G(i2), G(i3), G(q)/G(11) or G(s) protein over a similar or longer period did not significantly reduce mIcat. Antibodies to common Gbeta or infusion of the Gbetagamma subunit itself had no effect on mIcat. (3) If cells were exposed briefly to carbachol (50 or 100 micro M) at early times (3 min) after infusion of antibodies to Galpha(i3)/Galpha(o) or to Galpha(o) had begun, carbachol responses remained unchanged even after 20-60 min; that is, the depression of mIcat by these antibodies was prevented. (4) These data show that Galpha(o) protein couples the muscarinic receptor to the cationic channel in guinea-pig ileal longitudinal smooth muscle and that Gbetagamma is not involved. They also show that prior activation of the muscarinic receptor presumably causes a long-lasting postactivation change of the G protein, which is not reflected in mIcat, but acts to hinder antibody binding.

1. The abilities of muscarinic agonists (arecoline, bethanechol, carbachol, McN-A343, methacholine, pilocarpine) to inhibit isoprenaline-induced cyclic AMP production in chopped fragments (via M(2) receptors), and to evoke cationic current (I(cat)) (via M(2) receptors) or calcium store release (via M3 receptors) in enzyme-dispersed, single voltage-clamped cells from longitudinal smooth muscle of the guinea-pig small intestine were examined. 2. All muscarinic agonists (1 - 300 microM) examined inhibited isoprenaline (1 microM)-induced accumulation of cyclic AMP, the IC(50) varying from 52 to 248 microM. However, their relative potencies to evoke this M(2) effect were not significantly correlated with their ability to evoke I(cat), also a M(2) effect, whether or not calcium stores were depleted; pilocarpine and McN-A343 inhibited the I(cat) response to carbachol. 3. Muscarinic agonists (concentration 300 or 1000 microM), except pilocarpine and McN-A343 which were ineffective, evoked Ca(2+)-activated K(+) current (I(K-Ca)) resulting from Ca(2+) store release (M(3) effect). Their effectiveness was tested by estimating residual stored calcium by subsequent application of caffeine (10 mM). The relative potencies to evoke Ca(2+) store release (M(3)) and for I(cat) activation (M(2)) were closely correlated (P0.001). 4. These data might be explained if M(2)-mediated adenylyl cyclase inhibition and I(cat) activation involve different G proteins, or involve different populations of M(2) receptors. The observed correlation of agonist potency between I(cat) activation and Ca(2+) store release supports the proposal (ZholosBolton, 1997) that M(3) activation can potentiate M(2)-cationic channel coupling through Ca(2+)-independent mechanisms.

Protein kinase C (PKC) has been known to play an important role in ischemic preconditioning (IP). This study was designed to examine whether the translocation of PKC is associated with the cardioprotective effects of IP in vivo on infarct size and ventricular arrhythmias in a rat model. Using anesthetized rats, heart rate, systolic blood pressure, infarct size and ventricular arrhythmias during 45 min of coronary occlusion were measured. PKC activity was assayed in both the cytosolic and cell membrane fraction. Brief 3-min periods ofischemia followed by 10 min ofreperfusion were used to precondition the myocardium. Calphostin C was used to inhibit PKC. Infarct size was significantly reduced by IP (68.1 (2.5)%, mean (S.E.) vs. 45.2 (3.4)%, p0.01). The reduction in infarct size by IP was abolished by pretreatment with calphostin C. The total number of ventricular premature complex (VPC) during 45 min of coronary occlusion was reduced by IP (1474 (169) beats/45 min vs. 256 (82) beats/45 min, p0.05). The reduction the total number of VPC induced by IP was abolished by the administration of calphostin C before the episode of brief ischemia. The same tendency was observed in the duration of ventricular tachycardia and the incidence of ventricular fibrillation. PKC activity in the cell membrane fraction transiently increased immediately after IP (100 vs. 142%, p0.01) and returned to baseline 15 min after IP. Pretreatment with calphostin C prevented the translocation of PKC. The translocation of PKC plays an important role in the cardioprotective effect of IP on infarct size and ventricular arrhythmias in anesthetized rats.

HNS-32 (N1,N1-dimethyl-N2-(2-pyridylmethyl)-5-isopropyl-3, 8-dimethylazulene-1-carboxamidine: CAS 186086-10-2) is a newly synthesized compound, and possesses antiarrhythmic properties with vasodilator action in dog hearts. The aim of this study was to investigate the dose-dependent effects of HNS-32 on ischemia- and/or reperfusion-induced ventricular arrhythmias in anesthetized rats in vivo and compared with those of mexiletine. Saline or drugs were administered intravenously 5 min prior to coronary artery occlusion. On the ischemia-induced ventricular arrhythmias, HNS-32 showed dose-dependent reduction of total number of premature ventricular complexes (PVC) from 2091+/-225 to 656+/-116 and 286+/-69 beats/30 min (p0.05), the ventricular tachycardia (VT) duration from 183+/-33 to 28+/-9 and 4+/-2 sec (p0.05), the incidence of VT from 100 to 90 (n.s.) and 40% (p0.05), and the incidence of ventricular fibrillation (VF) from 50 to 0 and 0% (p0.05) with 3 and 5 mg/kg, respectively. Mexiletine also reduced these parameters to 936+/-159 beats/30 min (p0.05), 39+/-22 sec (p0.05), 90% (n.s.) and 10% (n.s.), respectively. HNS-32 completely suppressed the late reperfusion-induced arrhythmias, however mexiletine did not affect them. On the early reperfusion-induced ventricular arrhythmias, HNS-32 showed dose-dependent reduction of VT duration from 126+/-34 to 37+/-12 and 3+/-2 sec (p0.05), incidence of VT from 100 to 90 (n.s.) and 40% (p0.05), incidence of VF from 100 to 10 and 0% (p0.05), and mortality rate from 90 to 0 and 0% (p0.05), with 3 and 5 mg/kg, respectively. Mexiletine also reduced these parameters to 16+/-9 sec (p0.05), 80 (n.s.), 50 (p0.05), and 10% (p0.05), respectively. HNS-32 significantly reduced the heart rate in a dose-dependent manner, from 399+/-14 to 350+/-8 and 299+/-10 beats/min (p0.05) with 3 and 5 mg/kg, respectively. The antiarrhythmic effects of HNS-32 were more potent than that of the similar dose of mexiletine against occlusion-induced and reperfusion-induced arrhythmias in in vivo rats.

The antiarrhythmic effect of magnesium sulfate (Mg) as well as the hemodynamics were studied using the coronary ligation and reperfusion models in rats. In the study on coronary ligation arrhythmia, i.v. administration of Mg (0.6, 2, 6, 20 and 60 micromol) was conducted at 5 min after coronary ligation. Mg had an action to decrease the total number of premature ventricular contraction (PVC), the duration of ventricular tachycardia (VT), the frequency of VT and ventricular fibrillation (Vf) and the mortality ratio for 30 min after coronary ligation. In the 6-60 micromol groups, significant antiarrhythmic action (p0.01 vs. control) was attained. In the study on reperfusion arrhythmia, i.v. administration of Mg (20, 60 and 200 micromol) was conducted at 4 min after coronary ligation, and at 1 min after ligation, the coronary artery was reperfused. Mg had an action to decrease the frequency of Vf, the mortality ratio and the duration of VT and Vf and to extend the interval between the initiation of reperfusion and the occurrence of VT and Vf for 10 min after reperfusion. In the 200 micromol group, significant antiarrhythmic action (p0.05 vs. control) was attained. Administration of Mg decreased the heart rate and blood pressure. We concluded that Mg can control myocardial ischemia-induced and reperfusion-induced arrhythmia and that sudden cardiac death which occurs as a result of arrhythmia can be prevented.

1. The effect on membrane currents of infection of mouse neuroblastoma NA cells with rabies virus was studied by using the whole-cell patch clamp technique. 2. Three types of membrane currents, namely voltage-dependent Na+ current (I(Na)), delayed rectifier K+ current (I(K-DR)) and inward rectifier K+ current (I(K-IR)) were elicited in uninfected cells. 3. In cells 3 days after infection with the virus, no detectable change was observed in morphology and membrane capacitance, but I(Na) and I(K-IR) were significantly decreased in amplitude without any appreciable difference in the time course of current activation and inactivation. The voltage-dependence of I(Na) activation was significantly shifted in the positive direction along the voltage axis with a decreased slope. I(K-DR) remained almost unaltered after the viral infection. 4. The resting membrane potential, measured with a physiological K+ gradient across the cell membrane, was decreased (depolarized) after the viral infection. The depolarization was associated with the decreased amplitude of I(K-IR). 5. These results suggest that infection of mouse neuroblastoma NA cells with rabies virus causes reduction of functional expression of ion channels responsible for I(Na) and I(K-IR), and provide evidence for possible involvement of the change in membrane properties in the pathogenesis of rabies disease.

1. Non-adrenergic, non-cholinergic (NANC) inhibitory transmission in chicken gizzard was studied by use of intracellular microelectrode techniques. Changes in membrane potential in response to NANC nerve stimulation were recorded in the gizzard smooth muscle pretreated with atropine (1 microM) and guanethidine (1 microM). 2. Field stimulation of the intramural nerves (FS) evoked inhibitory junction potentials (i.j.ps) which were abolished by tetrodotoxin (1 microM), but not inhibited at all by K+ channel blockers including apamin (0.5 microM), tetraethylammonium (TEA, 10 mM), charybdotoxin (0.2 microM) and glibenclamide (10 microM). 3. NG-nitro-L-arginine (3 mM), an inhibitor of nitric oxide (NO) synthase, inhibited i.j.ps. The effect was reversed by L-arginine (3 mM), but not by D-arginine (3 mM). 4. 8-Bromo cyclic GMP (100 microM), a membrane permeable analogue of cyclic GMP, produced a membrane hyperpolarization which was blocked by TEA (10 mM) or glibenclamide (10 microM). 5. NO at concentrations of up to 400 microM affected neither i.j.ps nor resting membrane potential. On the other hand, NO (80 microM) caused the membrane to hyperpolarize in the smooth muscle of guinea-pig ileum. 6. These results suggest that in the chicken gizzard, NANC i.j.ps may not arise from opening of conventional types of K+ channel and that NO seems unlikely to be involved in the generation of i.j.ps. A possible mechanism by which the inhibitory effect of NG-nitro-L-arginine on i.j.ps was brought about will be discussed.

The activities of D-glucose transport (D-GT) and cytosolic enzymes were significantly higher in mammary adenocarcinoma of dogs than in mammary gland from normal dogs. The activities of D-GT in adenocarcinoma were over three-and-a-half times higher than in the controls. The K(m) value of the D-GT activity for glucose in both the adenocarcinoma and normal mammary gland was approximately 0.9 mM. The activities of the key glycolytic enzymes, hexokinase and pyruvate kinase, in the adenocarcinoma were also more than three-and-a-half times higher than in the controls. The increased activities of D-GT are considered to be accompanied by an acceleration of glucose utilisation in the adenocarcinoma of dogs.

To determine whether pacing would have a protective effect similar to preconditioning on reperfusion-induced ventricular arrhythmias and whether this protective effect would be induced by pacing-induced myocardial ischemia.Isolated rat hearts (n = 36) were perfused by the Langendorff technique and the working heart mode. Global ischemia was induced for 10 mins followed by reperfusion for 15 mins. The control group had no pacing, while in the other groups, the hearts were electrically paced three times at 300, 400 and 600 beats/min, respectively, for 5 mins with 1 min intervals between pacings.The incidence of reperfusion-induced ventricular fibrillation in controls was 100%, whereas that in the 300, 400 and 600 beats/min groups was reduced to 67% (not significant), 50% (P0.03) and 30% (P0.01), respectively. The mean duration of reperfusion-induced ventricular fibrillation was also significantly reduced in the 300, 400 and 600 beats/min groups compared with the control group. Coronary flow during pacing in the 400 and 600 beats/min groups, but not the 300 beats/min group, was reduced significantly compared with controls. In the 300 beats/min group, oxygen tension of the coronary effluent during pacing was decreased significantly, and proton production and lactate release of coronary effluent during pacing were increased significantly compared with the control group.Pacing exerted a protective effect similar to preconditioning against reperfusion-induced ventricular arrhythmias. Pacing-induced mild myocardial ischemia, in which coronary flow was maintained, may be involved in the mechanism of this protective effect.

A monoclonal autoantibody (MAb) to mouse sperm was established from a vasectomized mouse. The MAb, termed 4A11, reacted exclusively to mouse and rat live sperm tail, without any cross-reaction with sperm of other mammalian species or any somatic organ tissues in the mouse. MAb 4A11 significantly inhibited in vitro fertilization of mouse ova. Western blotting showed a single band of 67 kDa as the corresponding antigen protein of MAb 4A11. By screening a mouse testis cDNA library with MAb 4A11, one positive clone (964bp) was obtained. DNA sequence of the clone showed no homology with any previously reported mammalian genes, but showed 54% homology with a bacterial gene of sucrose-specific phosphotransferase enzyme II. The rabbit antisera raised to the recombinant protein of the 4A11 cDNA gene showed reaction to mouse, rat, hamster and guinea-pig sperm.

1. Single smooth muscle cells from the longitudinal muscle layer of guinea-pig small intestine were voltage clamped using patch pipettes in the whole-cell mode. 2. When D-myo-inositol 1,4,5-trisphosphate (InsP3) was released at intervals, by photolysis of 'caged' InsP3 within the cell, increases in [Ca2+]i in many cells, as judged from Ca(2+)-activated K(+)-current, were all-or-none; release of InsP3 before a critical interval had elapsed, which was quite stable for an individual cell, resulted in no response. After Ca(2+)-induced Ca2+ release had been evoked by depolarization, the InsP3 response was inhibited. Oscillations in [Ca2+]i evoked by muscarinic receptor activation were unaffected by Ruthenium Red; during these oscillations exogenous InsP3 was not effective close to, or shortly after, peak [Ca2+]i but was effective at other times. 3. Reproducible release of Ca2+ and elevation of [Ca2+]i could be produced by brief (up to 0.5 s) pressure applications of 10 mM caffeine at intervals of 10 s or greater but caffeine itself rarely evoked oscillations in [Ca2+]i. Responses to flash release of InsP3 were reduced after caffeine-induced responses and recovery of caffeine-induced Ca2+ release was faster than recovery of InsP3-induced Ca2+ release. 4. The results support the idea that InsP3-induced Ca(2+)-store release can be inhibited by a certain level of [Ca2+]i at a time when Ca2+ stores have refilled and can be released by caffeine; they also support the suggestion that during oscillations of [Ca2+]i evoked by muscarinic receptor activation, Ca2+ inhibition of InsP3-induced Ca2+ release at some critical level of [Ca2+]i allows Ca2+ stores to refill and leads to a fall in [Ca2+]i so contributing to the oscillations which are observed.

T cell tolerance to superantigen can be mediated by clonal anergy in which Ag-specific mature T cells are physically present but are not able to mount an immune response. We induced T cell unresponsiveness to minor lymphocyte stimulations locus antigen (Mls)-1a in mice transgenic for TCR V beta 8.1 in three different systems: 1) injection of Mls-1a spleen cells, 2) mating with Mls-1a mice, and 3) bone marrow (BM) chimeras in which Mls-1a is present only on nonhematopoietic cells. CD4+8-V beta 8.1+ cells from all these groups did not proliferate in response to irradiated spleen cells from Mls-1a mice. We compared the response of these cells by T cell/stimulator cell conjugate formation, Ca2+ mobilization, and proliferation assays. The mechanisms underlying the unresponsiveness of these T cells appear to differ. CD4+8-V beta 8.1+ cells from Mls-1a spleen cell-injected mice mobilized cytoplasmic Ca2+ but proliferated at a reduced level in response to cross-linking with anti-TCR mAb. However, these cells formed conjugates, mobilized Ca2+, and proliferated in response to Mls-1a when activated B cells were used as stimulators, although they produced reduced levels of IL-2. In Mls-1a/b V beta 8.1 transgenic mice, a subset in CD4+8-V beta 8.1+ cells did not mobilize cytoplasmic Ca2+ after TCR cross-linking. Their conjugate formation, Ca2+ mobilization, or proliferation in response to Mls-1a on activated B cells was undetectable. Finally, CD4+8-V beta 8.1+ cells from the BM chimeras proliferated to TCR cross-linking at a partially reduced level and formed conjugates, mobilized Ca2+, and proliferated in response to Mls-1a on activated B cells. These features suggest that the mechanisms underlying the maintenance of anergy in Mls-1a spleen cell-injected mice are distinct from those in Mls-1a mice.

1. Single smooth muscle cells were isolated by enzymic digestion from the longitudinal muscle layer of rabbit jejunum, and the response of the cells to calcium (Ca2+) release by InsP3 (D-myo-inositol 1,4,5-trisphosphate) was studied. Changes in internal Ca2+ concentration were monitored by measuring Ca(2+)-activated K+ currents (outward currents) using the whole-cell voltage-clamp technique. 2. At break-through from cell-attached patch to whole-cell recording mode using a 100 microM-InsP3-filled pipette, cells exhibited a brief outward current which reached its peak in 1.1 s and terminated within 10 s. Following this the generation of spontaneous transient outward currents (STOCs) was inhibited. (STOCs are considered to represent bursts of openings of Ca(2+)-activated K+ channels in response to spontaneous discharges of Ca2+ from the stores.) When a pipette filled with 20 microM-InsP3 was used, similar current responses were also evoked, but some cells failed to respond. 3. The InsP3-induced outward current at membrane break-through was similar in size and time course to the outward current response of normal cells to bath-applied carbachol (CCh, 100 microM) or caffeine (20 mM). 4. Dialysis with InsP3-containing solution inhibited the caffeine-induced outward current, depending on the pipette InsP3 concentration. Inclusion of heparin (5 mg/ml) in the pipette completely prevented inhibition by InsP3 of the caffeine response and of STOC discharge. However, the InsP3-induced current at break-through remained unchanged, probably because of the slower rate of diffusion of heparin. 5. In cells dialysed with pipette solution containing 30 or 100 microM-caged InsP3, flash photolysis (producing up to 1.5 microM-InsP3) induced an outward current response after a latency of 31.0 +/- 1.8 ms (n = 15), which was followed by inhibition of STOCs. The reversal potential of the current to flash-release of InsP3 followed closely the Nernst potential for K+ ions (EK), suggesting negligible contributions from channels other than Ca(2+)-activated K+ channels. 6. Photolysis of caged InsP3 (30 or 100 microM) still produced a current response after 3-6 min in Ca(2+)-free (3 mM-EGTA added) bathing solution, but no response occurred if the cell was exposed to either caffeine (20 mM) or CCh (100 microM) to deplete Ca stores.(ABSTRACT TRUNCATED AT 400 WORDS)

1. Single smooth muscle cells obtained by enzymic dispersion of the longitudinal muscle layer of rabbit jejunum were held under voltage clamp using patch pipettes and membrane currents measured. The effects of carbachol or caffeine applied externally were examined in cells dialysed with normal pipette solutions or with a solution containing heparin (which blocks receptors for D-myo-inositol 1,4,5-trisphosphate, InsP3), guanosine 5-O-(gamma-thio)triphosphate (GTP gamma S) or guanosine 5-O-(beta-thio)diphosphate (GDP beta S). 2. Outward current in response to application of carbachol or caffeine was considered to represent the opening of calcium-activated potassium channels in response to a localized rise in the free ionized calcium concentration occasioned by the rapid discharge of stored calcium (Ca) by these agents. 3. Heparin included in the pipette solution blocked outward current to muscarinic receptor activation by carbachol but not that to caffeine, suggesting that receptor-evoked discharge of stored cellular Ca is caused by InsP3 action. However, heparin did not affect muscarinic-receptor inward current. 4. After dialysis with 0.1-0.5 mM-GTP gamma S, carbachol inward current was evoked in two out of three of the cells; after dialysis with 0.1-0.2 mM-GTP gamma S for an average of 7.7 min it was 80% of the normal response; after dialysis for an average of 8.6 min with 0.5 mM-GTP gamma S it was 31% of the normal response. In contrast, 0.1 mM-GTP gamma S reduced caffeine outward current by 93% after an average 4.5 min dialysis and spontaneous transient outward currents (STOCs) were abolished in 2.9 min on average. 5. Carbachol inward current (at -40 or -50 mV) and carbachol outward current (at 0 mV) in responding cells were reduced only by half after 8-10 min dialysis with 1 mM-GDP beta S which has been shown in portal vein cells to antagonize the depletion of Ca stores by intracellular GTP gamma S (Komori & Bolton, 1989). After 8-10 min dialysis with 5 mM-GDP beta S outward current was 27% of normal. However, if GDP beta S was present, outward current generally could not be evoked by a second application of carbachol. 6. The discharge of Ca stores by dialysis with 0.1 mM-GTP gamma S was prevented completely by heparin included in the pipette solution, suggesting that activation of a G-protein associated with phospholipase C (PLC) enzyme accelerates PLC activity. InsP3 production and depletion of Ca stores.(ABSTRACT TRUNCATED AT 400 WORDS)

1. Single smooth muscle cells were obtained from the rabbit portal vein by enzymic digestion and membrane currents under voltage clamp measured by whole-cell patch clamp technique. 2. When held at depolarized potentials, spontaneous outward currents (STOCs) were discharged; it is likely that these represent the cyclical storage and release within the cell of calcium in relation to Ca-activated K-channels. 3. Application of lower concentrations of carbachol (10(-5)M) or caffeine (10(-3)M) accelerated STOC discharge. Higher concentrations of caffeine (10(-2)M) or carbachol (10(-4)M), or noradrenaline (10(-5)M), produced an outward current of 1-5 nA which disappeared within 5-15s and which was considered to result from the discharge of calcium stores; STOC discharge was abolished for a period. 4. Ryanodine (10(-5)-10(-4)M) or a non-hydrolysable GTP analogue, GTP gamma S (10(-5)-10(-3)M) introduced into the cell abolished STOC discharge within 2-5 min. STOCs were large in cells filled with GDP beta S (10(-3)M) and the action of GTP gamma S introduced at various concentrations was antagonized. 5. GTP gamma S (10(-4)-10(-3)M) in the cell reduced or abolished outward current to caffeine (10(-2)M) noradrenaline (10(-5)M) or carbachol (10(-4)M); the effect on caffeine outward current was antagonized by GDP beta S (10(-3)M) introduced into the cell. GDP beta S reduced noradrenaline outward current but not caffeine outward current implying the existence of a G-protein step in noradrenaline-evoked Ca-store release, possibly regulating phospholipase C enzyme activity and D-myo inositol 1,4,5 trisphosphate formation. 6. If cyclic AMP (10(-3)M) or cyclic GMP (10(-3)M) was introduced into the cell, or 8-bromo cyclic AMP (0.5 x 10(-3)M) or 8-bromo cyclic GMP (0.5 x 10(-3)M) applied to the cell in the bathing solution, STOC discharge was only slightly affected. However, the outward current to caffeine applied after noradrenaline was much enhanced. 7. The results could be explained if cyclic GMP and cyclic AMP enhance calcium storage whereas GTP gamma S depletes calcium stores, an action antagonized by GDP beta S.

Muscarinic, cholinergic depression of adrenergic excitatory transmission was investigated by the microelectrode method in isolated dog retractor penis muscle. Electrical stimulation of the intramural nerves with single or repetitive stimuli elicited adrenergic contractions and excitatory junction potentials (e.j.p.s). The mechanical response and e.j.p. were suppressed by physostigmine (5 x 10(-7) g/ml) and carbachol (up to 5 x 10(-8) g/ml) without changing the sensitivity of the muscle to noradrenaline and muscle membrane resistance measured by electrotonic potentials. Atropine reversed the drug-induced attenuation of these responses, but atropine itself had no effect on them. Carbachol at 5 x 10(-8) g/ml, where the e.j.p. was blocked, caused a depolarization of the muscle membrane (less than 5 mV), whereas the same extent of depolarization produced by high K solution resulted in only a small decrease in e.j.p. amplitude. These results suggest that excitatory adrenergic transmission in the dog retractor penis muscle is depressed prejunctionally by a cholinergic mechanism.

BALB/c mouse thymoma-derived T cell line, CAK4.4 (Thy-1+, L3T4-, Lyt-2-), produced a large amount of TCR-gamma mRNA, a trace amount of TCR-beta mRNA but no detectable level of TCR-alpha mRNA. Another BALB/c mouse thymoma-derived T cell line, CAK1.3 (Thy-1+, L3T4+, Lyt-2+), synthesized a high level of TCR-alpha as well as TCR-beta mRNA but did not produce any amount of TCR-gamma mRNA. HAT-sensitive clones were established from the two T cell lines. Azaguanine-resistant, HPRT- CAK4.4 cells and bromodeoxyuridine-resistant, TK- CAK1.3 cells were fused by electrofusion method and the resultant hybrids were analyzed for expression of TCR genes as well as the changes of their cell surface phenotypes. Transcription of TCR-gamma gene was completely suppressed in all hybrids tested, although Southern blot analysis showed that the hybrids maintained TCR-gamma chain genes derived from both parental cells. TCR-alpha gene transcription occurred normally in one hybrid. In two other hybrids, TCR-alpha gene transcription was strongly suppressed. Treatment of the hybrid cells with 12-O-tetradecanoyl phorbol-13-acetate reversed the suppression of TCR-alpha gene transcription, but TCR-gamma gene transcription was not recovered by the same treatment. However, transcription level of TCR-beta gene was not changed in all hybrids. Our results suggested that the different trans-acting regulatory mechanisms control the transcription levels of TCR-alpha and TCR-gamma genes and that such a transcriptional control may play a crucial role in the determination of orderly appearance of TCR-gamma and TCR-alpha gene products during T cell ontogeny in the thymus.