Search

Basing on the external morphological characters, an isolated population of the Arctic Apollo, Parnassius arcticus (Eisner, 1968) (Lepidoptera, Papilionidae), from the Arga-Tas Range mountains (North-Eastern Yakutia, Russia) is described here as a new subspecies, Parnassius arcticus shavlovi Yakovlev & Bakhaev, subsp. nov.

Parnassius arcticus shavlovi Yakovlev & Bakhaev, subsp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: 4268E6A7-6D90-4958-B165-A9D59DCEBB6B Figs 9−19 Material examined. Holotype, male, Russia, North-Eastern Yakutia, Verkhnekolymsky District, Arga-Tas Range, uppers of Tuora-Bygyttakh river, H− 1100−1300 m, 20−28.vi. 2022, leg. Y. Bakhaev (Zoological Institute, Saint-Petersburg, Russia). Paratypes. 76 males, 19 females, the same locality and data (Zoological Institute, Saint-Petersburg, Russia; private collection of Roman V. Yakovlev, Barnaul and Yuri I. Bakhaev, Lipetsk). Description. Male. Wingspan of holotype 43 mm, paratypes – 34−46 mm. Antennae coal-black, shorter than half of fore wing in length. Head, thorax and abdomen covered with coal-black scales. Fore wing white from above, with dense sputtering of black scales basally, black scales sputtering also along costal margin from root to apex of wing, clearly expressed black stroke in centre of discal cell, black cuneal or round spot at top of discal cell, series of two-three (partially fused) black strokes between radial veins postdiscally, series of two-four small black strokes between radial cells postdiscally (closer to outer margin of wing), outer margin of wing (from apex to Cu 1) semi-transparent, with sputtering of black scales, fringe white. Fore wing from underside with completely the same pattern as on wing from upside. Hind wing from upside white, with vast black portion, occupying area from anal margin and wing base to middle of discal area and portion along Cu 2 vein, postdiscal area in cell Sc+R− Rs and cell M 1 −M 2 with tiny dark spots translucent from underside; in some males, black spot on wing upside only in cell Sc+R− Rs, very thin rim along wing margin from Rs to М 2 (rarely, M 3) (in almost half of specimens, rim torn into separate strokes), fringe white. Hind wing from underside with more contract pattern than from upside: postdiscally in cell Sc+R− Rs and cell M 1 −M 2 well developed small black spots (often developed in cells M 3 −Cu 1, Cu 1 −Cu 2 and Cu 2 −2A as well); in most specimens, tiny black spots developed submarginally in cells between medial and cubital veins, small black spots between medial veins along wing margin. Male genitalia (Fig. 17) is similar to the nominotypical P. arcticus. Uncus forked, short, with uncinate apices diverged to sides; valve cup-like, with even edges, apically semicircular; conical harpe on inner surface of valve, slightly protruding beyond the apex of valve; juxta oval, with pair of flask-shaped processes directed dorsally; saccus robust, conical; phallus thin, slightly curved along all length, apically needle-like, 1/3 longer than valve. Female. Wingspan 35−46 mm. Antennae coal-black, shorter than half of fore wing in length. Head, thorax and abdomen covered with coal-black scales. Fore wing from upside with intensive black sputtering at root, costal margin with black sputtering; in vast majority of specimens, black sputtering distributed throughout wing field, except for some light spots and bands; black spot of medium size in middle of discal cell, large black spot at top of discal cell; postdiscally from costal margin to M2 – band of fused black spots; postdiscally closer to outer margin – relatively wide light band (or light portion), submarginally – expressed thin (often, fragmentary) light band, outer margin of wing semitransparent, with intensive grey sputtering, fringe white. Fore wing from underside with the same pattern as from upside, but significantly lighter. Hind wing from upside often with very wide dark-grey root portion (sometimes occupying all root, discal and partially postdiscal areas), large black spots (round of shaped as wide longitudinal strokes) postdiscally in cells Sc+R− Rs, M 1 −M 2, M 3 −Cu 1 and Cu 1 −Cu 2; postdiscally (closer to outer margin of wing) – wide light band with small black strokes in the range of cells from Rs− M 1 to Cu 1 −Cu 2 (steadily developed in cells Rs− M 1 and M 1 −M 2, rarely – in all cells), outer margin dark-grey or black, fringe white. Hind wing from underside in general with the same pattern as on upside but slightly lighter and more contrasting (in root area, discal cell and cell Sc+R− Rs with developed long bright black longitudinal strokes). Diagnosis. The new subspecies clearly differs from the known subspecies in a series of characters. From P. arcticus arcticus: • the new subspecies on an average is larger in size: male wingspan is 34−46 mm, females – 35−46 mm (in P. arcticus arcticus: 32−41 mm and 37−40 mm, respectively); • in the males of the new subspecies, the black spots on the fore wing postdiscally and especially, submarginally, are significantly less developed (in P. arcticus arcticus, the rows of black spots are developed steadily); • in the males of the new subspecies, the black spot on the hind wing in cell M 1 −M 2 is absent steadily; additionally, in most specimens there is no black spot in cell Sc+R− Rs (in P. arcticus arcticus, the black spots of the submarginal row on the hind wing are well expressed); • along the outer margin of the hind wing in most males there are small black spots (in P. arcticus arcticus, the outer margin of the wing is white); • in the females of the new subspecies, the black sputtering on the wings from upside is much more expressed; the orange nucleoli in the black spots of the postdiscal row on the hind wing are very rare (in P. arcticus arcticus, the black sputtering on the wings from above is significantly less expressed; in most specimens, there are orange nucleoli in the black spots of the postdiscal row on the hind wing). From P. arcticus arbugaevi: • in the males of the new subspecies, the black spot is steadily present in the discal cell on the fore wing (in P. arcticus arbugaevi, the black spot in the discal cell on the fore wing is steadily absent); • in the males of the new subspecies, the black spot on the hind wing in cell M 1 −M 2 is steadily absent; additionally, in most specimens there is no black spot in cell Sc+R− Rs (in P. arcticus arbugaevi, the black spots of the submarginal row on the hind wing are clearly expressed); • in most of the males, along the outer margin of the hind wing there are small black spots (in P. arcticus arbugaevi, the outer margin of the wing is white); • in the females of the new subspecies, the black sputtering on the wings from upside is less expressed, the pattern of fore and hind wings is more contrasting, on the fore wing there are well developed postdiscal and submarginal light bands (in P. arcticus arbugaevi, the black sputtering on the wings from upside is significantly more intense, the pattern (especially, on the fore wing) is more blurred, not distinctive; there are no postdiscal and submarginal light bands on the fore wing). Bionomy. The adults were indicated in the middle of June on gravel screes at altitudes of 1100−1300 m (Figs 20−21). The adults were observed feeding on the flower of Smelowskia jacutica (Botsch. & Karav.) Al-Shehbaz & S.I. Warwick (Brassicaceae) (Fig. 22). The leaves damaged by the caterpillars of P. arcticus shavlovi were found on Corydalis gorodkovii Karav. (Papaveraceae) (Figs 23−24). Etymology. The subspecies is named after Roman Shavlov (Yakutsk) − an amateur zoologist well known in Yakutia, a friend on one of the authors of this article. Distribution. Known only from Arga-Tas Range in North-Eastern Yakutia. Discussion. It seems surprising that the new subspecies P. arcticus shavlovi was formed in the same mountain range as P. arcticus arbugaevi (Fig. 25). But there is a large distance between their places (more than 230 km), and most importantly, a biotopic gap (red line) (Fig. 26): a low-mountain zone. As it is known, P. arcticus lives only in the highlands (a zone of stony tundra at a height of more than 1100 m). So, the highmountain areas of the Arga-Tas Range are an isolate, which contributed to the formation of quite significant differences at the subspecies level over time.

Parnassius arcticus (Eisner, 1968) Tadumia simo arctica Eisner, 1968: 15 Type locality: den Bergen östlich von Werchnosensk [Verkhoyansk?, Yakutia, Russia]., Published as part of Yakovlev, Roman V. & Bakhaev, Yuri I., 2023, A new subspecies of Arctic Apollo - Parnassius arcticus (Eisner, 1968) (Lepidoptera, Papilionidae) from the Arga-Tas Range (North-Eastern Yakutia), pp. 1-14 in Ecologica Montenegrina 63 on page 1, DOI: 10.37828/em.2023.63.1, http://zenodo.org/record/8029884, {"references":["Eisner, C. (1968) Parnassiana Nova. XLIII. Nachtragliche Betrachtungen zu der Revision der Subfamilie Parnassiinae (Fortsetzung 16). Zoologische Mededelingen, 43 (2), 9 - 17."]}

Parnassius arcticus arbugaevi Yakovlev & Shapoval, 2020 Figs 5−8 Yakovlev et al. 2020: 99−103. Type locality: Russia, North-Eastern Yakutia, Momsky District, 70 km E of Khonuu village. Distribution: Momsky Range (North-Eastern Yakutia). The conspecificity of P. arcticus and P. ammosovi does not look completely convincing due to the fact that there is still no good comparative material from the type locality of P. arcticus. Also, the subspecies belonging of the specimen collected on Yablonovyi Pass in Magadan Territory (Gorbunov 2008) is not known., Published as part of Yakovlev, Roman V. & Bakhaev, Yuri I., 2023, A new subspecies of Arctic Apollo - Parnassius arcticus (Eisner, 1968) (Lepidoptera, Papilionidae) from the Arga-Tas Range (North-Eastern Yakutia), pp. 1-14 in Ecologica Montenegrina 63 on page 4, DOI: 10.37828/em.2023.63.1, http://zenodo.org/record/8029884, {"references":["Yakovlev, R. V., Shapoval, N. A., Bakhaev, Y. I., Kuftina, G. N., Khramov, B. A. (2020) A new subspecies of Parnassius arcticus (Eisner, 1968) from the Momsky Range (Yakutia, Russia). Acta Biologica Sibirica, 6, 93 - 105. https: // doi. org / 10.3897 / abs. 6. e 55925","Gorbunov, P. Y. (2008) 3. Apollon arctichesky. In: Chereshnev I. A. (Ed.) Red Data Book of Magadan Region. Administration of Magadan Region, Department of natural resources; Institute of Biological problems of North, Magadan, 30 - 31. [in Russian]."]}

Parnassius arcticus shavlovi Yakovlev & Bakhaev, subsp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: 4268E6A7-6D90-4958-B165-A9D59DCEBB6B Figs 9−19 Material examined. Holotype, male, Russia, North-Eastern Yakutia, Verkhnekolymsky District, Arga-Tas Range, uppers of Tuora-Bygyttakh river, H− 1100−1300 m, 20−28.vi. 2022, leg. Y. Bakhaev (Zoological Institute, Saint-Petersburg, Russia). Paratypes. 76 males, 19 females, the same locality and data (Zoological Institute, Saint-Petersburg, Russia; private collection of Roman V. Yakovlev, Barnaul and Yuri I. Bakhaev, Lipetsk). Description. Male. Wingspan of holotype 43 mm, paratypes – 34−46 mm. Antennae coal-black, shorter than half of fore wing in length. Head, thorax and abdomen covered with coal-black scales. Fore wing white from above, with dense sputtering of black scales basally, black scales sputtering also along costal margin from root to apex of wing, clearly expressed black stroke in centre of discal cell, black cuneal or round spot at top of discal cell, series of two-three (partially fused) black strokes between radial veins postdiscally, series of two-four small black strokes between radial cells postdiscally (closer to outer margin of wing), outer margin of wing (from apex to Cu 1) semi-transparent, with sputtering of black scales, fringe white. Fore wing from underside with completely the same pattern as on wing from upside. Hind wing from upside white, with vast black portion, occupying area from anal margin and wing base to middle of discal area and portion along Cu 2 vein, postdiscal area in cell Sc+R− Rs and cell M 1 −M 2 with tiny dark spots translucent from underside; in some males, black spot on wing upside only in cell Sc+R− Rs, very thin rim along wing margin from Rs to М 2 (rarely, M 3) (in almost half of specimens, rim torn into separate strokes), fringe white. Hind wing from underside with more contract pattern than from upside: postdiscally in cell Sc+R− Rs and cell M 1 −M 2 well developed small black spots (often developed in cells M 3 −Cu 1, Cu 1 −Cu 2 and Cu 2 −2A as well); in most specimens, tiny black spots developed submarginally in cells between medial and cubital veins, small black spots between medial veins along wing margin. Male genitalia (Fig. 17) is similar to the nominotypical P. arcticus. Uncus forked, short, with uncinate apices diverged to sides; valve cup-like, with even edges, apically semicircular; conical harpe on inner surface of valve, slightly protruding beyond the apex of valve; juxta oval, with pair of flask-shaped processes directed dorsally; saccus robust, conical; phallus thin, slightly curved along all length, apically needle-like, 1/3 longer than valve. Female. Wingspan 35−46 mm. Antennae coal-black, shorter than half of fore wing in length. Head, thorax and abdomen covered with coal-black scales. Fore wing from upside with intensive black sputtering at root, costal margin with black sputtering; in vast majority of specimens, black sputtering distributed throughout wing field, except for some light spots and bands; black spot of medium size in middle of discal cell, large black spot at top of discal cell; postdiscally from costal margin to M2 – band of fused black spots; postdiscally closer to outer margin – relatively wide light band (or light portion), submarginally – expressed thin (often, fragmentary) light band, outer margin of wing semitransparent, with intensive grey sputtering, fringe white. Fore wing from underside with the same pattern as from upside, but significantly lighter. Hind wing from upside often with very wide dark-grey root portion (sometimes occupying all root, discal and partially postdiscal areas), large black spots (round of shaped as wide longitudinal strokes) postdiscally in cells Sc+R− Rs, M 1 −M 2, M 3 −Cu 1 and Cu 1 −Cu 2; postdiscally (closer to outer margin of wing) – wide light band with small black strokes in the range of cells from Rs− M 1 to Cu 1 −Cu 2 (steadily developed in cells Rs− M 1 and M 1 −M 2, rarely – in all cells), outer margin dark-grey or black, fringe white. Hind wing from underside in general with the same pattern as on upside but slightly lighter and more contrasting (in root area, discal cell and cell Sc+R− Rs with developed long bright black longitudinal strokes). Diagnosis. The new subspecies clearly differs from the known subspecies in a series of characters. From P. arcticus arcticus: • the new subspecies on an average is larger in size: male wingspan is 34−46 mm, females – 35−46 mm (in P. arcticus arcticus: 32−41 mm and 37−40 mm, respectively); • in the males of the new subspecies, the black spots on the fore wing postdiscally and especially, submarginally, are significantly less developed (in P. arcticus arcticus, the rows of black spots are developed steadily); • in the males of the new subspecies, the black spot on the hind wing in cell M 1 −M 2 is absent steadily; additionally, in most specimens there is no black spot in cell Sc+R− Rs (in P. arcticus arcticus, the black spots of the submarginal row on the hind wing are well expressed); • along the outer margin of the hind wing in most males there are small black spots (in P. arcticus arcticus, the outer margin of the wing is white); • in the females of the new subspecies, the black sputtering on the wings from upside is much more expressed; the orange nucleoli in the black spots of the postdiscal row on the hind wing are very rare (in P. arcticus arcticus, the black sputtering on the wings from above is significantly less expressed; in most specimens, there are orange nucleoli in the black spots of the postdiscal row on the hind wing). From P. arcticus arbugaevi: • in the males of the new subspecies, the black spot is steadily present in the discal cell on the fore wing (in P. arcticus arbugaevi, the black spot in the discal cell on the fore wing is steadily absent); • in the males of the new subspecies, the black spot on the hind wing in cell M 1 −M 2 is steadily absent; additionally, in most specimens there is no black spot in cell Sc+R− Rs (in P. arcticus arbugaevi, the black spots of the submarginal row on the hind wing are clearly expressed); • in most of the males, along the outer margin of the hind wing there are small black spots (in P. arcticus arbugaevi, the outer margin of the wing is white); • in the females of the new subspecies, the black sputtering on the wings from upside is less expressed, the pattern of fore and hind wings is more contrasting, on the fore wing there are well developed postdiscal and submarginal light bands (in P. arcticus arbugaevi, the black sputtering on the wings from upside is significantly more intense, the pattern (especially, on the fore wing) is more blurred, not distinctive; there are no postdiscal and submarginal light bands on the fore wing). Bionomy. The adults were indicated in the middle of June on gravel screes at altitudes of 1100−1300 m (Figs 20−21). The adults were observed feeding on the flower of Smelowskia jacutica (Botsch. & Karav.) Al-Shehbaz & S.I. Warwick (Brassicaceae) (Fig. 22). The leaves damaged by the caterpillars of P. arcticus shavlovi were found on Corydalis gorodkovii Karav. (Papaveraceae) (Figs 23−24). Etymology. The subspecies is named after Roman Shavlov (Yakutsk) − an amateur zoologist well known in Yakutia, a friend on one of the authors of this article. Distribution. Known only from Arga-Tas Range in North-Eastern Yakutia. Discussion. It seems surprising that the new subspecies P. arcticus shavlovi was formed in the same mountain range as P. arcticus arbugaevi (Fig. 25). But there is a large distance between their places (more than 230 km), and most importantly, a biotopic gap (red line) (Fig. 26): a low-mountain zone. As it is known, P. arcticus lives only in the highlands (a zone of stony tundra at a height of more than 1100 m). So, the highmountain areas of the Arga-Tas Range are an isolate, which contributed to the formation of quite significant differences at the subspecies level over time., Published as part of Yakovlev, Roman V. & Bakhaev, Yuri I., 2023, A new subspecies of Arctic Apollo - Parnassius arcticus (Eisner, 1968) (Lepidoptera, Papilionidae) from the Arga-Tas Range (North-Eastern Yakutia), pp. 1-14 in Ecologica Montenegrina 63 on pages 4-13, DOI: 10.37828/em.2023.63.1, http://zenodo.org/record/8029884

Parnassius arcticus arcticus (Eisner, 1968) Figs 1−4 =? Parnassius ammosovi Korshunov, 1988: 69. Type locality: Russia, Yakutia, Suntar-Khayata Range, 180 km ENE from the Khandyga settlement, river Vostochnaya Khandyga upper flow, 232nd km of the road from Khandyga to Magadan. Distribution: Verkhoyansky and Suntar-Khayata Range (North-Eastern Yakutia)., Published as part of Yakovlev, Roman V. & Bakhaev, Yuri I., 2023, A new subspecies of Arctic Apollo - Parnassius arcticus (Eisner, 1968) (Lepidoptera, Papilionidae) from the Arga-Tas Range (North-Eastern Yakutia), pp. 1-14 in Ecologica Montenegrina 63 on pages 1-4, DOI: 10.37828/em.2023.63.1, http://zenodo.org/record/8029884, {"references":["Eisner, C. (1968) Parnassiana Nova. XLIII. Nachtragliche Betrachtungen zu der Revision der Subfamilie Parnassiinae (Fortsetzung 16). Zoologische Mededelingen, 43 (2), 9 - 17.","Korshunov, Y. P. (1988) New butterflies (Lepidoptera, Rhopalocera) from Khakassia, Tuva and Yakutia. In: Zolotarenko G. S. (Ed.) Taxonomy of animals of Siberia, Nauka, Novosibirsk, 65 - 80. [in Russian]."]}

Vavizola hela sp. n. https://zoobank.org/ urn:lsid:zoobank.org:act: 2883141C-35E7-487C-8365-D3C74CB66789 (Figs 1–10, 21–22, 28, 34) Holotype: ♂, Tanzania, Arusha National Park, Miriakamba Hut, -3.2294225707906707, 36.79956440000001, 2500 m, 20.X.2004, slide 17.446, LBEOW1233-11 (MWM/ZSM). Paratypes (2♂, 3♀). Tanzania: ♂, like holotype, slide 1267 (CGM). Kenya: ♂, Taita- Taveta, Voi, 19.XII.1911, leg. Svatosh (ZISP); ♀, Taita- Taveta, SW of Voi, 8–12.XII.2009, leg. Snižek, slide 17.447, LBEOW975-11 (CGM); ♂, Lamu, E of Garsen, W of Witu, 28.IV.2011, leg. Snižek, slide 20.690 (CGM); ♀, Kitui, 202 km E Thika, Sosoma, 4.XII.2010, leg. Snižek, slide 0501 (CGM); ♀, Kitui, E of Mwingi, W of Enguni, 1.XII.2010, leg. Snižek (CGM). Description. Male (Figs 1, 5–6, 8–9). Flagellum covered with creamy and brown scales, rami brown. Head and thorax speckled creamy and brown; thorax dorsally has longitudinal dark stripes. Abdomen brown or reddish brown. Forewing. Forewing length: 19–23 mm; wingspan: 38–45 mm. Elongated, apex blunt, outer margin with indentation on veins and concavity between M 2 and CuA 1. Background color speckled creamy with brown scales. Pattern diagonal (Fig. 1), consist of more or less pronounced discal stroke, speckled medial field, postmedial fascia with dark edges vanishing towards apex, postmedial field and external fascia practically merged into speckled field with dark lines vanishing towards apex as well, and dark external field. Cilia creamy on vines and dark brown between them. Hindwing. Somewhat ovaloid with some indentation on veins. Background color brown or dark brown with dark external field. Cilia speckled creamy and brown, darker between veins. Genitalia (Figs 3, 21–22). Tegumen a narrow band bearing a pair of socia laterally. Socii papilla-shaped, covered with chaetae. Vinculum ventrally elongated, distally bears cubile. Cubile clearly divided medially into a pair of somewhat triangle processes with caudal dent. Cucullus tubercle-like with papilla-shaped medial extension. Sacculus about twice bigger than cucullus, tubercle-like with elongated finger-like apically pointed extension loosely covered with chaetae. Juxta a tiny medial extension of aedeagus. Aedeagus c-shaped with ventral apical spur. Vesica short, wrinkled, caudally narrows. Eight sternite a c-shaped band, posterior margin with medial concavity. Eight tergite somewhat oval widened posteriorly. Female (Figs 2, 7, 10). Reminds male in pattern but paler, larger in size, antenna pectination much shorter. Head and thorax speckled creamy with brown scales. Thorax medially paler with two longitudinal dark stripes. Abdomen brown or orangish with creamy speckles. Forewing. Forewing length: 33–35 mm; wingspan: 67–68 mm. Elongated, apex blunt, outer margin with indentation on veins. Background color speckled creamy with brown scales. Pattern diagonal (Fig. 2), consist of speckled medial field, wavy postmedial fascia with faded dark edges, pale postmedial field, wavy external fascia with faded dark edges, and dark external field. Cilia creamy on vines and dark brown between them. Hindwing. Somewhat ovaloid with some indentation on veins. Background color creamy with dark speckled external field. Cilia speckled creamy and brown, darker between veins. Genitalia (Figs 4, 28). Papillae anales oval, densely covered with chaetae. Posterior and anterior apophyses about the same length. Antevaginal plate somewhat pentagonal with round corners, bends outwards with help of male cubile; together with postvaginal plate forms cup-like antrum. Ostium wrinkled, amorphous. Ductus bursae short. Corpus bursae wrinkled. Variability. Male. One paratype male (Fig. 8) looks distinct compared to the others (Figs 5–6, 9). It was collected in the lowlands, in April. The other adults were collected from altitudes above 500 meters in October and December. It has no significant difference in genitalia and originates near the others, so we consider it within the same species. Overall, male may have more (Fig. 8) or less pronounced and contrasting pattern (Figs 5–6, 9). Dark stroke in forewing medial field may present (Fig. 8) or absent (Figs 5–6, 9). Hindwing may have dark blurred medial fascia (Fig. 8). Cubile may be more sclerotized basally (Fig. 21). Female. Females have stable wing patterns, only the abdomen may get more or less orangish. Antevaginal plate with more (Fig. 4) or less (Fig. 28) protruded medial extension. Etymology. The species is named in honor of Dr. Hela Gayatri. She has a motto: “To live in sync with nature with deep appreciation of even the smallest part of it.” In addition to being an ardent lover of nature, she is also a distinguished scientist and a successful inventor and entrepreneur. She has a master’s degree in organic chemistry, a doctorate in chemistry and has international research experience with the Medical Research Council (UK), École Normale Supérieure (France), Texas Medical Center (USA) and National Tsing Hua University (Taiwan). Dr. Hela Gayatri also has expertise in synthetic chemistry, nanotechnology and other leading technologies. She is a serial entrepreneur and graduated from Goldman Sachs 10K (Cohort 2) initiative at NSRCEL, IIM, Bangalore and is an alumni of Goldman Sachs 10K Women Entrepreneur program, reimagining business at ISB, India. Distribution. Southern Kenya and north-eastern Tanzania (for details visit https://bit.ly/ Vavizola _hela). Biology. Adults were collected in April, October, and December from lowlands up to 2,500 meters a.s.l. Preimaginal stages are unknown.

Vavizola gen. n. https://zoobank.org/ urn:lsid:zoobank.org:act: 06558427-344F-44B3-A355-3686BD8978B9 (Figs 1–10, 21–22, 28, 34) Diagnosis. The detailed description of morphology is provided for the new species below, since the genus is monotypic. Habitus of Vavizola gen. n. reminds us of some other members of “ Pachypasa sensu lato ” revised by Zolotuhin & Gurkovich (2009): 1) Seydelora Zolotuhin & Gurkovich, 2009; 2) Gufria Zolotuhin & Gurkovich, 2009; 3) Lasiocesa Koçak, 2013; 4) Braura Walker, 1865; and 5) Eutricha Hübner, 1814. Adults of all genera have a diagonal wing pattern, cubile in male genitalia and a corresponding antevaginal plate in female genitalia. 1) Seydelora includes only Seydelora semna (Hering, 1941) from DRC. It has very dark forewings with dark brown medial, postmedial and external fields and a complex speckled white or yellow and brown external fascia; hindwings have a well pronounced dark external field (Figs 13–14). Male adults of Vavizola gen. n. are overall lighter, their forewings are more elongated, medial field is more elongated towards the wing apex, postmedial fascia is developed, the medial white triangle on thorax is absent (compare Figs 5–6, 8–9 and 13); male genitalia of Vavizola gen. n. differ by shorter cucullus and sacculus, and smaller apodema of cubile (compare Figs 21–22 and 25). Female adults of Vavizola gen. n. are overall lighter, their forewings are more elongated, forewing pattern is shifted more towards the wing apex, postmedial and external lines are doubled, medial pale speckled thoracic spot is absent (compare Figs 7, 10 and 14); female genitalia of Vavizola gen. n. differ in the shape of sterigma and presence of cup-like antrum (compare Figs 28 and 29). 2) Zolotuhin & Gurkovich (2009) considered the genus Gufria to be monotypic with the only member Gufria limosa de Villiers, 1827 distributed from Southern Europe to North Africa. We suppose that European and African populations will show a genetic divergence, sufficient to be considered a separate species, similar to experiences with Lemonia philopalus (Donzel, 1842) (see Prozorov et al., 2022b). Here, for comparison, we take adults of G. limosa from Tunisia and Morocco and call them Gufria limosa powelli (Oberthür, 1916) – the earliest taxon from North Africa. Adults are colored in combinations of grey, creamy and brown; medial field on forewing stretches until the wing apex, postmedial field is paler than the others (Figs 17–18). Male adults of Vavizola gen. n. have more elongated forewings with medial field not reaching the wing apex, and postmedial lines (compare Figs 5–6, 8–9 and 17); male genitalia of Vavizola gen. n. differ with shorter cucullus and sacculus, shorter distal outgrowths and lack of lateral dents (compare Figs 21–22 and 23). Female adults of Vavizola gen. n. have more elongated forewings, their forewing pattern consists of more elements and both wings have dark external field (compare Figs 7, 10 and 18); antevaginal plate in female genitalia of Vavizola gen. n. is better developed and antrum is wider (compare Figs 28 and 31). 3) Lasiocesa includes 4 species. Here, for comparison, we take adults (Figs 15–16) and male genitalia (Fig. 26) of the type-species Lasiocesa fulgurata (Aurivillius, 1909) and female genitalia (Fig. 32) of Lasiocesa lanceolata (Hering, 1932) due to only one known bad quality slide of female genitalia of L. fulgurata, all from DRC. Adults are colored in combinations of brown and creamy, forewing has full set of fields and fasciae, while hindwing may be completely brown or creamy with brown external field. Wing pattern of both genera is very similar, however, Vavizola gen. n. is much paler and duller, have narrower postmedial field (compare Figs 5–10 and 15–16). Male genitalia of Vavizola gen. n. differ with shorter cucullus, larger sacculus, and lack medial ridges on processes of cubile (compare Figs 21–22 and 26). Female genitalia of Vavizola gen. n. differ with larger antevaginal plate and presence of cup-like antrum (compare Figs 28 and 32). 4) Braura includes 9 species. For comparison, we take the type-species Braura ligniclusa (Walker, 1865) from RSA. Adults have dark brown forewings with occasionally paler medial field, hind wings dark brown or creamy with darker external field. Male adults of Vavizola gen. n. are overall lighter, but head and thorax cranially are not contrasting (compare Figs 5–6, 8–9 and 11); male genitalia of Vavizola gen. n. differ with smaller cucullus and basally larger sacculus, smaller caudal processes of cubile (compare Figs 21–22 and 24). Female adults of Vavizola gen. n. are overall lighter, but head, thorax cranially, and forewing medial field are not contrasting (compare Figs 7, 10 and 12); female genitalia of Vavizola gen. n. differ in better developed antevaginal plate and presence of cup-like antrum (compare Figs 28 and 30). 5) Eutricha includes 5 species ranging in coloration from creamy to dark brown. Here, for comparison, we use Eutricha capensis (Linnaeus, 1767) from RSA, the type-species of the genus. Adults have well pronounced contrasting postmedial and external fasciae. Male adults of Vavizola gen. n. are overall lighter, their forewings are more elongated, medial field is more elongated towards the wing apex (compare Figs 5–6, 8–9 and 19); male genitalia of Vavizola gen. n. differ with smaller cucullus and sacculus, smaller apical dent of aedeagus (compare Figs 21–22 and 27). Female adults of Vavizola gen. n. are overall paler and duller with contrasting external field (compare Figs 7, 10 and 20); female genitalia of Vavizola gen. n. differ in shape of sterigma (compare Figs 28 and 33). DNA comparison (Fig. 34). Two specimens of Vavizola hela sp. n. were sequenced: the holotype male from Tanzania (Fig. 5) and the paratype female from Kenya (Fig. 10). The two have a 0.8% p -distance which is a little higher than we expected for specimens of a single species collected so closely together. It may be explained by the1200 meters difference in the altitude between collecting localities of the two. The new genus is compared with 18 sequences belonging to 12 biological index numbers (BINs) and 9 genera from the “ Pachypasa sensu lato ” group, missing Seydelora; Pachyna Weymer, 1892; Beriola Zolotuhin & Gurkovich, 2009; Euphorea Zolotuhin & Gurkovich, 2009; and Sophyrita Zolotuhin & Gurkovich, 2009 (see Table 1). We will only compare the new genus with the others without investigation of their internal concerns such as potential polyphyly of Pachytrina Zolotuhin & Gurkovich, 2009 or polytypy of Muzunguja which follow from the tree and p -distances. These differences require a detailed investigation. We can see that intergeneric p -distance lays between 4.7 and 12% (Fig. 34), where the lowest is between Pallastica Zolotuhin & Gurkovich, 2009 and Cleopatrina Zolotuhin & Gurkovich, 2009, and the highest is between Muzunguja and Lasiocesa. The nearest neighbor of Vavizola gen. n. (BOLD:AAV0301) found on BOLD is Eutricha morosa (Walker, 1865) from Malawi (BOLD:ABZ6351) at 5.92%. We selected two other Eutricha species which are not much farther: 6.4 and 7.4%. Other sequences, except Pachytrina sp. at 6.1% (Fig. 34, 10), are farther than any Eutricha. Etymology. Name of the new genus is devoted to Prof. Dr. Vadim Viktorovich Zolotuhin (1967–2021), Russian entomologist specialized on the Old World Lasiocampidae. It is formed by a combination of the first letters of his name by analogy with Tarsozeuzera vavizola Yakovlev, 2006 (Cossidae)., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Nedoshivina, Svetlana V., Yakovlev, Roman V., Volkova, Julia S., Saldaitis, Aidas, Revay, Edita E. & Müller, Günter C., 2023, Vavizola hela - new species and genus of Afrotropic Lasiocampini (Lepidoptera, Lasiocampidae), pp. 55-66 in Ecologica Montenegrina 62 on pages 57-63, DOI: 10.37828/em.2023.62.8, http://zenodo.org/record/8044383, {"references":["Zolotuhin, V. V. & Gurkovich, A. V. (2009) A review of the genus Pachypasa Walker, 1855 sensu lato in Africa (Lepidoptera, Lasiocampidae). Neue Entomologische Nachrichten, 63, 1 - 75.","Kocak, A. O. (2013) Nomenclatural notes in the family Lasiocampidae (Lepidoptera). Miscellaneous Papers, 160, 1 - 5.","Walker, F. (1865) List of the Specimens of Lepidopterous Insects in the Collection of the British Museum. Part XXXII. Supplement Part 2, 323 - 706.","Hering, E. M. (1941) Neue Heteroceren aus dem Congo-Gebiet. Revue de Zoologie et Botanique Africaines, 35 (1), 72 - 84.","de Villiers, A. - P. (1827) Note sur trois Lepidopteres inedits ou peu connus de la France meridionale. Memoires de la Societe Linneenne de Paris, 5, 471 - 485.","Donzel, M. H. (1842) Description de deux lepidopteres nouveaux recueillis en Barbarie par le capitaine Charlon. Annales de la Societe entomologique de France, 11, 197 - 199.","Prozorov, A. M., Prozorova, T. A., Volkova, Ju. S., Yakovlev, R. V., Nedoshivina, S. V., Pinzari, M., Pinzari, M., Scalercio, S., Bianco, G., Saldaitis, A., Hausmann, A., Revay, E. E. & Muller, G. C. (2022 b) Revision of the Lemonia taraxaci complex, with a description of a new species from Italy and clarification of the status of Lemonia strigata (Lepidoptera: Brahmaeidae: Lemoniinae). Zootaxa, 5195 (4), 337 - 360. https: // doi. org / 10.11646 / zootaxa. 5195.4.2","Oberthur, Ch. (1916) Etudes de lepidopterologie comparee, 12. Imprimerie Oberthur, Rennes, 527 pp. https: // doi. org / 10.5962 / bhl. title. 8792","Aurivillius, Ch. (1909) Diagnosen neuer Lepidopteren aus Afrika. 9. Arkiv for Zoologi, 5 (5), 1 - 29. https: // doi. org / 10.5962 / bhl. part. 3496","Hering, E. M. (1932) Neue Heteroceren aus Afrika. Revue de Zoologie et Botanique Africaines, 22 (1), 102 - 117.","Linnaeus, C. (1767) Systema Naturae, 1 (2). Editio duodeciima reformata. Impensis Direct. Laur. Salvii, Holmiae, 533 - 1327 pp.","Weymer, G. W. (1892) Exotische Lepidopteren VI. Aus dem Afrikanischen Faunagebiet. Stettiner Entomologische Zeitung, 53 (4 - 5), 79 - 125.","Yakovlev, R. V. (2006) New Cossidae (Lepidoptera) from Asia, Africa and Macronesia. Tinea, 19 (3), 188 - 213."]}

Vavizola hela sp. n. https://zoobank.org/ urn:lsid:zoobank.org:act: 2883141C-35E7-487C-8365-D3C74CB66789 (Figs 1–10, 21–22, 28, 34) Holotype: ♂, Tanzania, Arusha National Park, Miriakamba Hut, -3.2294225707906707, 36.79956440000001, 2500 m, 20.X.2004, slide 17.446, LBEOW1233-11 (MWM/ZSM). Paratypes (2♂, 3♀). Tanzania: ♂, like holotype, slide 1267 (CGM). Kenya: ♂, Taita- Taveta, Voi, 19.XII.1911, leg. Svatosh (ZISP); ♀, Taita- Taveta, SW of Voi, 8–12.XII.2009, leg. Snižek, slide 17.447, LBEOW975-11 (CGM); ♂, Lamu, E of Garsen, W of Witu, 28.IV.2011, leg. Snižek, slide 20.690 (CGM); ♀, Kitui, 202 km E Thika, Sosoma, 4.XII.2010, leg. Snižek, slide 0501 (CGM); ♀, Kitui, E of Mwingi, W of Enguni, 1.XII.2010, leg. Snižek (CGM). Description. Male (Figs 1, 5–6, 8–9). Flagellum covered with creamy and brown scales, rami brown. Head and thorax speckled creamy and brown; thorax dorsally has longitudinal dark stripes. Abdomen brown or reddish brown. Forewing. Forewing length: 19–23 mm; wingspan: 38–45 mm. Elongated, apex blunt, outer margin with indentation on veins and concavity between M 2 and CuA 1. Background color speckled creamy with brown scales. Pattern diagonal (Fig. 1), consist of more or less pronounced discal stroke, speckled medial field, postmedial fascia with dark edges vanishing towards apex, postmedial field and external fascia practically merged into speckled field with dark lines vanishing towards apex as well, and dark external field. Cilia creamy on vines and dark brown between them. Hindwing. Somewhat ovaloid with some indentation on veins. Background color brown or dark brown with dark external field. Cilia speckled creamy and brown, darker between veins. Genitalia (Figs 3, 21–22). Tegumen a narrow band bearing a pair of socia laterally. Socii papilla-shaped, covered with chaetae. Vinculum ventrally elongated, distally bears cubile. Cubile clearly divided medially into a pair of somewhat triangle processes with caudal dent. Cucullus tubercle-like with papilla-shaped medial extension. Sacculus about twice bigger than cucullus, tubercle-like with elongated finger-like apically pointed extension loosely covered with chaetae. Juxta a tiny medial extension of aedeagus. Aedeagus c-shaped with ventral apical spur. Vesica short, wrinkled, caudally narrows. Eight sternite a c-shaped band, posterior margin with medial concavity. Eight tergite somewhat oval widened posteriorly. Female (Figs 2, 7, 10). Reminds male in pattern but paler, larger in size, antenna pectination much shorter. Head and thorax speckled creamy with brown scales. Thorax medially paler with two longitudinal dark stripes. Abdomen brown or orangish with creamy speckles. Forewing. Forewing length: 33–35 mm; wingspan: 67–68 mm. Elongated, apex blunt, outer margin with indentation on veins. Background color speckled creamy with brown scales. Pattern diagonal (Fig. 2), consist of speckled medial field, wavy postmedial fascia with faded dark edges, pale postmedial field, wavy external fascia with faded dark edges, and dark external field. Cilia creamy on vines and dark brown between them. Hindwing. Somewhat ovaloid with some indentation on veins. Background color creamy with dark speckled external field. Cilia speckled creamy and brown, darker between veins. Genitalia (Figs 4, 28). Papillae anales oval, densely covered with chaetae. Posterior and anterior apophyses about the same length. Antevaginal plate somewhat pentagonal with round corners, bends outwards with help of male cubile; together with postvaginal plate forms cup-like antrum. Ostium wrinkled, amorphous. Ductus bursae short. Corpus bursae wrinkled. Variability. Male. One paratype male (Fig. 8) looks distinct compared to the others (Figs 5–6, 9). It was collected in the lowlands, in April. The other adults were collected from altitudes above 500 meters in October and December. It has no significant difference in genitalia and originates near the others, so we consider it within the same species. Overall, male may have more (Fig. 8) or less pronounced and contrasting pattern (Figs 5–6, 9). Dark stroke in forewing medial field may present (Fig. 8) or absent (Figs 5–6, 9). Hindwing may have dark blurred medial fascia (Fig. 8). Cubile may be more sclerotized basally (Fig. 21). Female. Females have stable wing patterns, only the abdomen may get more or less orangish. Antevaginal plate with more (Fig. 4) or less (Fig. 28) protruded medial extension. Etymology. The species is named in honor of Dr. Hela Gayatri. She has a motto: “To live in sync with nature with deep appreciation of even the smallest part of it.” In addition to being an ardent lover of nature, she is also a distinguished scientist and a successful inventor and entrepreneur. She has a master’s degree in organic chemistry, a doctorate in chemistry and has international research experience with the Medical Research Council (UK), École Normale Supérieure (France), Texas Medical Center (USA) and National Tsing Hua University (Taiwan). Dr. Hela Gayatri also has expertise in synthetic chemistry, nanotechnology and other leading technologies. She is a serial entrepreneur and graduated from Goldman Sachs 10K (Cohort 2) initiative at NSRCEL, IIM, Bangalore and is an alumni of Goldman Sachs 10K Women Entrepreneur program, reimagining business at ISB, India. Distribution. Southern Kenya and north-eastern Tanzania (for details visit https://bit.ly/ Vavizola _hela). Biology. Adults were collected in April, October, and December from lowlands up to 2,500 meters a.s.l. Preimaginal stages are unknown., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Nedoshivina, Svetlana V., Yakovlev, Roman V., Volkova, Julia S., Saldaitis, Aidas, Revay, Edita E. & Müller, Günter C., 2023, Vavizola hela - new species and genus of Afrotropic Lasiocampini (Lepidoptera, Lasiocampidae), pp. 55-66 in Ecologica Montenegrina 62 on pages 63-65, DOI: 10.37828/em.2023.62.8, http://zenodo.org/record/8044383

Vavizola gen. n. https://zoobank.org/ urn:lsid:zoobank.org:act: 06558427-344F-44B3-A355-3686BD8978B9 (Figs 1–10, 21–22, 28, 34) Diagnosis. The detailed description of morphology is provided for the new species below, since the genus is monotypic. Habitus of Vavizola gen. n. reminds us of some other members of “ Pachypasa sensu lato ” revised by Zolotuhin & Gurkovich (2009): 1) Seydelora Zolotuhin & Gurkovich, 2009; 2) Gufria Zolotuhin & Gurkovich, 2009; 3) Lasiocesa Koçak, 2013; 4) Braura Walker, 1865; and 5) Eutricha Hübner, 1814. Adults of all genera have a diagonal wing pattern, cubile in male genitalia and a corresponding antevaginal plate in female genitalia. 1) Seydelora includes only Seydelora semna (Hering, 1941) from DRC. It has very dark forewings with dark brown medial, postmedial and external fields and a complex speckled white or yellow and brown external fascia; hindwings have a well pronounced dark external field (Figs 13–14). Male adults of Vavizola gen. n. are overall lighter, their forewings are more elongated, medial field is more elongated towards the wing apex, postmedial fascia is developed, the medial white triangle on thorax is absent (compare Figs 5–6, 8–9 and 13); male genitalia of Vavizola gen. n. differ by shorter cucullus and sacculus, and smaller apodema of cubile (compare Figs 21–22 and 25). Female adults of Vavizola gen. n. are overall lighter, their forewings are more elongated, forewing pattern is shifted more towards the wing apex, postmedial and external lines are doubled, medial pale speckled thoracic spot is absent (compare Figs 7, 10 and 14); female genitalia of Vavizola gen. n. differ in the shape of sterigma and presence of cup-like antrum (compare Figs 28 and 29). 2) Zolotuhin & Gurkovich (2009) considered the genus Gufria to be monotypic with the only member Gufria limosa de Villiers, 1827 distributed from Southern Europe to North Africa. We suppose that European and African populations will show a genetic divergence, sufficient to be considered a separate species, similar to experiences with Lemonia philopalus (Donzel, 1842) (see Prozorov et al., 2022b). Here, for comparison, we take adults of G. limosa from Tunisia and Morocco and call them Gufria limosa powelli (Oberthür, 1916) – the earliest taxon from North Africa. Adults are colored in combinations of grey, creamy and brown; medial field on forewing stretches until the wing apex, postmedial field is paler than the others (Figs 17–18). Male adults of Vavizola gen. n. have more elongated forewings with medial field not reaching the wing apex, and postmedial lines (compare Figs 5–6, 8–9 and 17); male genitalia of Vavizola gen. n. differ with shorter cucullus and sacculus, shorter distal outgrowths and lack of lateral dents (compare Figs 21–22 and 23). Female adults of Vavizola gen. n. have more elongated forewings, their forewing pattern consists of more elements and both wings have dark external field (compare Figs 7, 10 and 18); antevaginal plate in female genitalia of Vavizola gen. n. is better developed and antrum is wider (compare Figs 28 and 31). 3) Lasiocesa includes 4 species. Here, for comparison, we take adults (Figs 15–16) and male genitalia (Fig. 26) of the type-species Lasiocesa fulgurata (Aurivillius, 1909) and female genitalia (Fig. 32) of Lasiocesa lanceolata (Hering, 1932) due to only one known bad quality slide of female genitalia of L. fulgurata, all from DRC. Adults are colored in combinations of brown and creamy, forewing has full set of fields and fasciae, while hindwing may be completely brown or creamy with brown external field. Wing pattern of both genera is very similar, however, Vavizola gen. n. is much paler and duller, have narrower postmedial field (compare Figs 5–10 and 15–16). Male genitalia of Vavizola gen. n. differ with shorter cucullus, larger sacculus, and lack medial ridges on processes of cubile (compare Figs 21–22 and 26). Female genitalia of Vavizola gen. n. differ with larger antevaginal plate and presence of cup-like antrum (compare Figs 28 and 32). 4) Braura includes 9 species. For comparison, we take the type-species Braura ligniclusa (Walker, 1865) from RSA. Adults have dark brown forewings with occasionally paler medial field, hind wings dark brown or creamy with darker external field. Male adults of Vavizola gen. n. are overall lighter, but head and thorax cranially are not contrasting (compare Figs 5–6, 8–9 and 11); male genitalia of Vavizola gen. n. differ with smaller cucullus and basally larger sacculus, smaller caudal processes of cubile (compare Figs 21–22 and 24). Female adults of Vavizola gen. n. are overall lighter, but head, thorax cranially, and forewing medial field are not contrasting (compare Figs 7, 10 and 12); female genitalia of Vavizola gen. n. differ in better developed antevaginal plate and presence of cup-like antrum (compare Figs 28 and 30). 5) Eutricha includes 5 species ranging in coloration from creamy to dark brown. Here, for comparison, we use Eutricha capensis (Linnaeus, 1767) from RSA, the type-species of the genus. Adults have well pronounced contrasting postmedial and external fasciae. Male adults of Vavizola gen. n. are overall lighter, their forewings are more elongated, medial field is more elongated towards the wing apex (compare Figs 5–6, 8–9 and 19); male genitalia of Vavizola gen. n. differ with smaller cucullus and sacculus, smaller apical dent of aedeagus (compare Figs 21–22 and 27). Female adults of Vavizola gen. n. are overall paler and duller with contrasting external field (compare Figs 7, 10 and 20); female genitalia of Vavizola gen. n. differ in shape of sterigma (compare Figs 28 and 33). DNA comparison (Fig. 34). Two specimens of Vavizola hela sp. n. were sequenced: the holotype male from Tanzania (Fig. 5) and the paratype female from Kenya (Fig. 10). The two have a 0.8% p -distance which is a little higher than we expected for specimens of a single species collected so closely together. It may be explained by the1200 meters difference in the altitude between collecting localities of the two. The new genus is compared with 18 sequences belonging to 12 biological index numbers (BINs) and 9 genera from the “ Pachypasa sensu lato ” group, missing Seydelora; Pachyna Weymer, 1892; Beriola Zolotuhin & Gurkovich, 2009; Euphorea Zolotuhin & Gurkovich, 2009; and Sophyrita Zolotuhin & Gurkovich, 2009 (see Table 1). We will only compare the new genus with the others without investigation of their internal concerns such as potential polyphyly of Pachytrina Zolotuhin & Gurkovich, 2009 or polytypy of Muzunguja which follow from the tree and p -distances. These differences require a detailed investigation. We can see that intergeneric p -distance lays between 4.7 and 12% (Fig. 34), where the lowest is between Pallastica Zolotuhin & Gurkovich, 2009 and Cleopatrina Zolotuhin & Gurkovich, 2009, and the highest is between Muzunguja and Lasiocesa. The nearest neighbor of Vavizola gen. n. (BOLD:AAV0301) found on BOLD is Eutricha morosa (Walker, 1865) from Malawi (BOLD:ABZ6351) at 5.92%. We selected two other Eutricha species which are not much farther: 6.4 and 7.4%. Other sequences, except Pachytrina sp. at 6.1% (Fig. 34, 10), are farther than any Eutricha. Etymology. Name of the new genus is devoted to Prof. Dr. Vadim Viktorovich Zolotuhin (1967–2021), Russian entomologist specialized on the Old World Lasiocampidae. It is formed by a combination of the first letters of his name by analogy with Tarsozeuzera vavizola Yakovlev, 2006 (Cossidae).

Streblote gerry sp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: EC58D7FE-3F94-465F-B66C-A114DAB8EFA9 (Figs 19–21, 27, 33, 38–40) Type material. Holotype ♂, Indonesia, Sumatra, Aceh Province, 1916, leg. G. Herman, slide 2022 0094 (NBCL). Paratypes (2♀ total). Indonesia, Sumatra : ♀, Medan Deli, leg. Fulmek (NBCL); ♀, North Sumatra Province, Parapat, 19.VIII.1979, leg. E. Diehl (ZSM). Description. Male (Fig. 20). Antenna orangish, flagellum covered with creamy speckled scales. Palpi orange. Eyes dark brown, naked. Head and thorax mesially creamy with dark dense speckles, tegulae reddish brown. Abdomen from reddish brown. Epiphysis on the fore leg absent. Forewing. Forewing length: 25 mm; wingspan: 51 mm. Triangular, apex acute, outer margin slightly waved. Background color reddish brown. Pattern consists of orangish basal spot, two pale waved medial lines, orangish eye-like spot in medial field with dark R-Cu vein and faded orangish fragmented external line. Cilia yellowish creamy. Hindwing. Trapezoid. Background color reddish brown with faded yellowish creamy medial line. Cilia creamy, gets darker on anal angle. Genitalia (Figs 27, 33). Similar to S. pallida (see above). Female (Figs 19, 21). Bigger, little paler and less contrasty than male. Antenna orangish, flagellum covered with creamy scales. Palpi orange. Eyes dark brown, naked. Head and thorax mesially creamy, tegulae orangish or reddish brown. Abdomen creamy or reddish brown. Forewing. Forewing length: 36–45 mm; wingspan: 70–90 mm. Oval-shaped, apex blunt, outer margin slightly waved. Background color reddish or orangish brown. Pattern consists of weakly pronounced orangish basal spot, two pale waved medial lines, weakly pronounced medial orangish eye-like spot and faded orangish fragmented external line. Cilia brownish. Hindwing. Egg-shaped. Background color reddish or orangish brown with more or less pronounced creamy medial line. Cilia brownish. Genitalia is not studied (both known females have broken abdomens, genitalia slides are not found). Variability. Medial line on hind wing of female may be narrow (Fig. 21) or wider (Fig. 19), abdomen reddish brown (Fig. 19) or creamy (Fig. 21). Diagnosis. The species is endemic to Sumatra. Male is darker than S. pallida from Java and Bali, and S. jacquie sp. n. from Flores and Sumba. No clear difference in male genitalia is found between S. pallida, S. jaquie sp. n., S. gerry sp. n., S. dorsalis, and S. castanea. Distribution (Fig. 38). Sumatra. Ecology. Adults were collected in August from the altitudes between 9 (Medan Deli) and 945 m (Parapat) within Sumatran lowland and montane rainforest ecoregions (Dinerstein et al., 2017). Etymology. The species is named after Gerald “Gerry” Malcolm Durrell, a well- known naturalist and writer who inspires lots of people through decades to devote their lives to studying biology. Taxonomic note. The species is not barcoded like S. pallida and S. jacquie sp. n., but darker coloration, isolated distribution on Sumatra within distinct ecoregions, and 2.45% distance between S. pallida and S. jacquie sp. n. let us suggest that the Sumatran population is also a separate species.

Streblote jacquie sp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: 45779F85-2AFD-4AFB-9354-D0D92 AD 13F20 (Figs 22–24, 30–31, 34, 38–40) Type materal. Holotype ♂, Indonesia, Flores, Prov. East Nusa Tenggara, Gunung Ranakah, 3 km S Mano, 18 km E Ruteng, primary forest, 1270 m, 17–21.IV.1996, leg. R. Brechlin, slide ZSM-60 (ZSM) . Paratypes (6♂, 1♀ total). Indonesia, Flores: ♂, Beanio, 400 m, VII.1953 (NBCL); ♂, Sukutukang, 350 m, 29.XII.1953 (NBCL); ♂, Waling, 750 m, 31.VII.1953 (NBCL); ♂, Flores, I.1912 (NBCL); ♂, East Nusa Tenggara Islands, Flores Island, Bajawa, Wolokoro Ecolodge, heavily disturbed monsoon forests and eucalyptus plantigs, 08°49’02” S, 120°56’03” E, 1009 m, 28–31.I.2020, leg. V. Spitsyn & E. Spitsyna (RMBH). Indonesia, Sumba: ♂, East Nusa Tenggara Islands, E Sumba Island, Luku Melolo, 10°S, 120°10’E, 500 m, V.2006, leg. Jakl (CGM); ♂, Sumba, (NHMV). Description. Male (Figs 22–23). Antennae orangish, basally speckled creamy and brown. Palpi orangish brown. Eyes dark brown, naked. Head and thorax mesially creamy with brown speckles, tegulae reddish or orangish brown. Abdomen from creamy to brown with more or less pronounced dorsal transversal brown stripes. Forewing. Forewing length: 26–30 mm; wingspan: 44–60 mm. Triangular, apex acute, outer margin slightly waved. Background color brown with creamy speckles. Pattern consists of orangish to reddish brown spot, two white to creamy waved medial lines, orangish to reddish brown eye-like spot in medial field with dark R-Cu vein, dark brown drop-like spot growing from it between M 3 and CuA 1 towards external field and faded fragmented orangish external line. Hindwing. Trapezoid. Background color brown with creamy medial line, external field with darker anal spot. Cilia creamy, gets darker on anal angle. Genitalia (Figs 30–31, 34). Similar to S. pallida (see above). Female (Fig. 24). Bigger, darker and less contrasty than male. Antenna brownish, flagellum covered with creamy scales. Palpi orange. Eyes dark brown, naked. Head and thorax mesially creamy, tegulae orangish brown. Abdomen creamy with reddish patches. Forewing. Forewing length: 44 mm; wingspan: 94 mm. Oval-shaped, apex blunt, outer margin slightly waved. Background color orangish brown. Pattern consists of weakly pronounced orangish basal spot, two pale waved medial lines, weakly pronounced medial orangish eye-like spot and faded orangish fragmented external line. Cilia creamy with brownish tips. Hindwing. Egg-shaped. Background color orangish brown with creamy medial line. Cilia creamy, gets darker on anal angle. Genitalia is not studied (female has broken abdomen, genitalia slide is not found). Variability. Dark elements of the wing pattern on male wings may get slightly paler than of the ones that figured (Figs 22–23). Diagnosis. The species is endemic to Flores and Sumba, male is paler than both: S. pallida from Java and Bali and S. gerry sp. n. from Sumatra. No clear difference in male genitalia is found between S. pallida, S. jaquie sp. n., S. gerry sp. n., S. dorsalis, and S. castanea. The species has up to 2.45% of pairwise distance from S. pallida, and 6.37–6.86% from S. castanea (Fig. 40). Distribution (Fig. 38). Flores and Sumba. Ecology. Adults were collected in December–January, April–May, and July–August from the altitudes between 5 (Luku Melolo, Sumba) to 1372 m (Ranaka, Flores) within the following ecoregions: Lesser Sundas and Sumba deciduous forests (Dinerstein et al., 2017). Etymology. The species is named in honor of Jacqueline “Jacquie” Sonia Durrell, the first wife and admirable companion of Gerald Durrell on numerous expeditions, a book writer, and a manager of the Jersey Zoo., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Spitsyn, Vitaly M., Spitsyna, Elizaveta A., Volkova, Julia S., Yakovlev, Roman V., Meier, Jürg, Saldaitis, Aidas, Revay, Edita E. & Müller, Günter C., 2022, Notes on Streblote (Lepidoptera, Lasiocampidae, Lasiocampinae) from the Malay Archipelago with two new species description, pp. 14-28 in Ecologica Montenegrina 58 on pages 24-25, DOI: 10.37828/em.2022.58.2, http://zenodo.org/record/8029468, {"references":["Dinerstein, E., Olson, D., Joshi, A., Vynne, C., Burgess, N. D., Wikramanayake, E., Hahn, N., Palminteri, S., Hedao, P., Noss, R., Hansen, M., Locke, H., Ellis, E. C., Jones, B., Barber, C. V., Hayes, R., Kormos, C., Martin, V., Crist, E., Sechrest, W., Price, L., Baillie, J. E. M., Weeden, D., Suckling, K., Davis, C., Sizer, N., Moore, R., Thau, D., Birch, T., Potapov, P., Turubanova, S., Tyukavina, A., De Souza, N., Pintea, L., Brito, J. C., Llewellyn, O. A., Miller, A. G., Patzelt, A., Ghazanfar, S. A., Timberlake, J., Kloser, H., Shennan- Farpon, Y., Kindt R., Barnekow Lilleso, J. - P., Van Breugel, P., Graudal, L., Voge, M., Al-Shammari, K. F. & Saleem, M. (2017) An Ecoregion-Based Approach to Protecting Half the Terrestrial Realm. BioScience, 1 (6), 1 - 12. https: // doi. org / 10.1093 / biosci / bix 014"]}

Streblote jacquie sp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: 45779F85-2AFD-4AFB-9354-D0D92 AD 13F20 (Figs 22–24, 30–31, 34, 38–40) Type materal. Holotype ♂, Indonesia, Flores, Prov. East Nusa Tenggara, Gunung Ranakah, 3 km S Mano, 18 km E Ruteng, primary forest, 1270 m, 17–21.IV.1996, leg. R. Brechlin, slide ZSM-60 (ZSM) . Paratypes (6♂, 1♀ total). Indonesia, Flores: ♂, Beanio, 400 m, VII.1953 (NBCL); ♂, Sukutukang, 350 m, 29.XII.1953 (NBCL); ♂, Waling, 750 m, 31.VII.1953 (NBCL); ♂, Flores, I.1912 (NBCL); ♂, East Nusa Tenggara Islands, Flores Island, Bajawa, Wolokoro Ecolodge, heavily disturbed monsoon forests and eucalyptus plantigs, 08°49’02” S, 120°56’03” E, 1009 m, 28–31.I.2020, leg. V. Spitsyn & E. Spitsyna (RMBH). Indonesia, Sumba: ♂, East Nusa Tenggara Islands, E Sumba Island, Luku Melolo, 10°S, 120°10’E, 500 m, V.2006, leg. Jakl (CGM); ♂, Sumba, (NHMV). Description. Male (Figs 22–23). Antennae orangish, basally speckled creamy and brown. Palpi orangish brown. Eyes dark brown, naked. Head and thorax mesially creamy with brown speckles, tegulae reddish or orangish brown. Abdomen from creamy to brown with more or less pronounced dorsal transversal brown stripes. Forewing. Forewing length: 26–30 mm; wingspan: 44–60 mm. Triangular, apex acute, outer margin slightly waved. Background color brown with creamy speckles. Pattern consists of orangish to reddish brown spot, two white to creamy waved medial lines, orangish to reddish brown eye-like spot in medial field with dark R-Cu vein, dark brown drop-like spot growing from it between M 3 and CuA 1 towards external field and faded fragmented orangish external line. Hindwing. Trapezoid. Background color brown with creamy medial line, external field with darker anal spot. Cilia creamy, gets darker on anal angle. Genitalia (Figs 30–31, 34). Similar to S. pallida (see above). Female (Fig. 24). Bigger, darker and less contrasty than male. Antenna brownish, flagellum covered with creamy scales. Palpi orange. Eyes dark brown, naked. Head and thorax mesially creamy, tegulae orangish brown. Abdomen creamy with reddish patches. Forewing. Forewing length: 44 mm; wingspan: 94 mm. Oval-shaped, apex blunt, outer margin slightly waved. Background color orangish brown. Pattern consists of weakly pronounced orangish basal spot, two pale waved medial lines, weakly pronounced medial orangish eye-like spot and faded orangish fragmented external line. Cilia creamy with brownish tips. Hindwing. Egg-shaped. Background color orangish brown with creamy medial line. Cilia creamy, gets darker on anal angle. Genitalia is not studied (female has broken abdomen, genitalia slide is not found). Variability. Dark elements of the wing pattern on male wings may get slightly paler than of the ones that figured (Figs 22–23). Diagnosis. The species is endemic to Flores and Sumba, male is paler than both: S. pallida from Java and Bali and S. gerry sp. n. from Sumatra. No clear difference in male genitalia is found between S. pallida, S. jaquie sp. n., S. gerry sp. n., S. dorsalis, and S. castanea. The species has up to 2.45% of pairwise distance from S. pallida, and 6.37–6.86% from S. castanea (Fig. 40). Distribution (Fig. 38). Flores and Sumba. Ecology. Adults were collected in December–January, April–May, and July–August from the altitudes between 5 (Luku Melolo, Sumba) to 1372 m (Ranaka, Flores) within the following ecoregions: Lesser Sundas and Sumba deciduous forests (Dinerstein et al., 2017). Etymology. The species is named in honor of Jacqueline “Jacquie” Sonia Durrell, the first wife and admirable companion of Gerald Durrell on numerous expeditions, a book writer, and a manager of the Jersey Zoo.

Streblote pallida (Rothschild, 1915), stat rev. as bona sp. (Figs 14–18, 28–29, 35–40) Taragama castanea pallida Rothschild, 1915, Novitates Zoologicae, 22, 222. Type locality: Bali. Holotype female (NHML). = Nadiasa callipaida Tams, 1935, Mémoires du Musée royal d’histoire naturelle de Belgique 4(12), 45–46. Type locality: Bali, Denpasar. Holotype female (RBINS). The original description is short and based on one female, we would like to redescribe the taxon here. Redescription. Male (Figs 14–15). Antenna creamy or orangish, flagellum covered with creamy speckled scales. Palpi orangish. Eyes dark brown, naked. Head and thorax mesially creamy with dark speckles, tegulae orangish or reddish brown. Abdomen from reddish brown basally to creamy apically with more or less pronounced reddish-brown stripes along it. Epiphysis on the fore leg absent. Forewing. Forewing length: 25–26 mm; wingspan: 41–56 mm. Triangular, apex acute, outer margin slightly waved. Background color reddish brown. Pattern consists of orangish basal spot, two pale waved medial lines, orangish eye-like spot in medial field with dark R-Cu vein, dark brown drop-like spot growing from it between M 3 and CuA 1 towards external field and faded orangish fragmented external line. Cilia creamy. Hindwing. Trapezoid. Background color reddish brown with more or less pronounced creamy medial band, external field with darker anal spot. Cilia creamy, gets darker on anal angle. Genitalia (Figs 28–29, 35–36). Tegumen a narrow band, triangleshaped mesially, bears pair of knob-like socii covered with chaetae. Cucullus elongated finger-like, c-shaped, slightly curved apically; sacculus short tubercle-shaped with pointed apex, body covered with chaetae. Vinculum distally expands and bears cubile, each arm bifurcates, medial outgrowth more sclerotized, slightly c-shaped with serrated outer edge. Juxta medially fused with aedaeagus. Aedeagus c-shaped, hardly sclerotized; caulis short; phallobase apically elongated, claw-like. Vesica compact elongated, basally slightly widens, then bifurcates, each outgrowth apically bears small claw-like cornutus. Eighth sternite trapezoid, caudal laterally gets membranous; eighth tergite somewhat pentagonal with somewhat romboid medial membranous field. Female (Figs 16–18). Bigger, little paler and less contrasty than male. Antenna creamy or orangish, flagellum covered with creamy scales. Palpi orangish. Eyes dark brown, naked. Head and thorax mesially creamy with dark speckles, tegulae orangish or reddish brown. Abdomen creamy, may be reddish basally. Epiphysis on the fore leg absent. Forewing. Forewing length: 40–45 mm; wingspan: 82–94 mm. Oval-shaped, apex blunt, outer margin slightly waved. Background color reddish or orangish brown. Pattern consists of orangish basal spot, two pale waved medial lines, medial orangish eye-like spot and faded orangish fragmented external line. Cilia creamy. Hindwing. Egg-shaped. Background color reddish or orangish brown with more or less pronounced creamy medial line which may become a large field (Fig. 17). Cilia creamy, gets darker near anal angle. Genitalia (Fig. 37). Papillae analis elongated, densely covered with chaetae. Posterior apophyses slightly shorter than anterior ones. Lamella antevaginalis a sclerotized shield-like formation with lateral trenches for cubile arms and medial indentation for apex of phallobase, lamella postvaginalis a narrow medially membranous plate. Ductus bursae short, wrinckled. Corpus bursae spherical, medium-sized, dorsally bears tiny horizontally elongated signum. Variability. Coloration of wings and abdomen of male may be more or less dark (Figs 14–15). Medial lines on fore wing of female may be dull and thin (Fig. 18) or brighter, wider and more curved (Fig. 17). Medial band on hind wing of male and female may be more (Figs 15, 17) or less pronounced (Figs 14, 18). In male genitalia apex of cucullus may be more (Fig. 28) or less curved (Fig. 29), apex of sacculus may be short (Fig. 29) or elongated (Fig. 28), cubile arms with more (Fig. 29) or less developed denticles (Fig. 28) along the outer edge, size and shape of the eight sternum and tergum slightly varies (Figs 35–36). Diagnosis. Reddish-brown species with contrasting light pattern that never occurs in S. dorsalis from Borneo or S. castanea from the Philippines. It occurs on Java and Bali only. Male is of intermediate coloration between S. gerry sp. n. from Sumatra and S. jacquie sp. n. from Flores and Sumba. No clear difference in male genitalia is found between S. pallida, S. jaquie sp. n., S. gerry sp. n., S. dorsalis, and S. castanea. The species has up to 2.45% difference in COI from S. jaquie sp. n., and 4.90–5.39% from S. castanea (Fig. 32). Distribution (Fig. 30). Java and Bali. Ecology. Adults were collected in April, July–August, and December from the altitudes between 6 (Besuki) to 2909 m (Mt Merapi) within the following ecoregions: Western Java lowland and montane rain forests, Eastern Java-Bali lowland and montane rain forests (Dinerstein et al., 2017). According to the collection data, the species is likely multivoltine. Taxonomic note. Zolotuhin (1998) changed the original combination of Taragama castanea pallida Rothschild, 1915 to Streblote dorsalis pallida (Rothschild, 1915) actualizing the traditional point of view that the lighter dorsalis population is spread over some of the Sunda Islands (Hampson, 1892: 405; Grünberg, 1911: 177; Grünberg, 1922: 393). Although, adults of S. dorsalis from Borneo (Figs 9–10) are much darker than S. pallida and they resemble rather the dark form of S. castanea from the Philippines (Figs 1, 4) as Holloway (1987) noted. We raise S. pallida to a specific rank as bona species considering that S. pallida differs externally from both S. castanea and S. dorsalis, never occurs sympatrically with the two and has an average pairwise distance of 5.15% from S. castanea. Material examined. Indonesia, Bali: Holotype ♀, 1912, leg. E. Stresemann (NHML); ♀, holotype of Nadiasa callipaida, Denpasar, 1932, leg. Prince Léopold (RBINS). Indonesia, Java: ♀ (MfNB); ♂, Mt Salak, 6.42 S, 106.44 E, 1000–1500 m, VII.1996, slide 2022 0096, DNA LBEOA423-11 (MWM / ZSM); ♂, Surabaya, 24.VII.1912, slide 2022 0097 (NBCL); ♀, Rajamandala, VII.1934, leg. [?] Toxopeus, slide 2022 0098 (NBCL); ♀, Ambarawa, leg. Ludeking (NBCL); ♂, Mt Merapi, 26.XII.1995 (NSMT); ♂, Besuki, 900 m, VII.1932, leg. S. Wilis (RBINS); ♀, Situbondo, 4.IV.1926 (RBINS).

Streblote gerry sp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: EC58D7FE-3F94-465F-B66C-A114DAB8EFA9 (Figs 19–21, 27, 33, 38–40) Type material. Holotype ♂, Indonesia, Sumatra, Aceh Province, 1916, leg. G. Herman, slide 2022 0094 (NBCL). Paratypes (2♀ total). Indonesia, Sumatra : ♀, Medan Deli, leg. Fulmek (NBCL); ♀, North Sumatra Province, Parapat, 19.VIII.1979, leg. E. Diehl (ZSM). Description. Male (Fig. 20). Antenna orangish, flagellum covered with creamy speckled scales. Palpi orange. Eyes dark brown, naked. Head and thorax mesially creamy with dark dense speckles, tegulae reddish brown. Abdomen from reddish brown. Epiphysis on the fore leg absent. Forewing. Forewing length: 25 mm; wingspan: 51 mm. Triangular, apex acute, outer margin slightly waved. Background color reddish brown. Pattern consists of orangish basal spot, two pale waved medial lines, orangish eye-like spot in medial field with dark R-Cu vein and faded orangish fragmented external line. Cilia yellowish creamy. Hindwing. Trapezoid. Background color reddish brown with faded yellowish creamy medial line. Cilia creamy, gets darker on anal angle. Genitalia (Figs 27, 33). Similar to S. pallida (see above). Female (Figs 19, 21). Bigger, little paler and less contrasty than male. Antenna orangish, flagellum covered with creamy scales. Palpi orange. Eyes dark brown, naked. Head and thorax mesially creamy, tegulae orangish or reddish brown. Abdomen creamy or reddish brown. Forewing. Forewing length: 36–45 mm; wingspan: 70–90 mm. Oval-shaped, apex blunt, outer margin slightly waved. Background color reddish or orangish brown. Pattern consists of weakly pronounced orangish basal spot, two pale waved medial lines, weakly pronounced medial orangish eye-like spot and faded orangish fragmented external line. Cilia brownish. Hindwing. Egg-shaped. Background color reddish or orangish brown with more or less pronounced creamy medial line. Cilia brownish. Genitalia is not studied (both known females have broken abdomens, genitalia slides are not found). Variability. Medial line on hind wing of female may be narrow (Fig. 21) or wider (Fig. 19), abdomen reddish brown (Fig. 19) or creamy (Fig. 21). Diagnosis. The species is endemic to Sumatra. Male is darker than S. pallida from Java and Bali, and S. jacquie sp. n. from Flores and Sumba. No clear difference in male genitalia is found between S. pallida, S. jaquie sp. n., S. gerry sp. n., S. dorsalis, and S. castanea. Distribution (Fig. 38). Sumatra. Ecology. Adults were collected in August from the altitudes between 9 (Medan Deli) and 945 m (Parapat) within Sumatran lowland and montane rainforest ecoregions (Dinerstein et al., 2017). Etymology. The species is named after Gerald “Gerry” Malcolm Durrell, a well- known naturalist and writer who inspires lots of people through decades to devote their lives to studying biology. Taxonomic note. The species is not barcoded like S. pallida and S. jacquie sp. n., but darker coloration, isolated distribution on Sumatra within distinct ecoregions, and 2.45% distance between S. pallida and S. jacquie sp. n. let us suggest that the Sumatran population is also a separate species., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Spitsyn, Vitaly M., Spitsyna, Elizaveta A., Volkova, Julia S., Yakovlev, Roman V., Meier, Jürg, Saldaitis, Aidas, Revay, Edita E. & Müller, Günter C., 2022, Notes on Streblote (Lepidoptera, Lasiocampidae, Lasiocampinae) from the Malay Archipelago with two new species description, pp. 14-28 in Ecologica Montenegrina 58 on pages 22-24, DOI: 10.37828/em.2022.58.2, http://zenodo.org/record/8029468, {"references":["Dinerstein, E., Olson, D., Joshi, A., Vynne, C., Burgess, N. D., Wikramanayake, E., Hahn, N., Palminteri, S., Hedao, P., Noss, R., Hansen, M., Locke, H., Ellis, E. C., Jones, B., Barber, C. V., Hayes, R., Kormos, C., Martin, V., Crist, E., Sechrest, W., Price, L., Baillie, J. E. M., Weeden, D., Suckling, K., Davis, C., Sizer, N., Moore, R., Thau, D., Birch, T., Potapov, P., Turubanova, S., Tyukavina, A., De Souza, N., Pintea, L., Brito, J. C., Llewellyn, O. A., Miller, A. G., Patzelt, A., Ghazanfar, S. A., Timberlake, J., Kloser, H., Shennan- Farpon, Y., Kindt R., Barnekow Lilleso, J. - P., Van Breugel, P., Graudal, L., Voge, M., Al-Shammari, K. F. & Saleem, M. (2017) An Ecoregion-Based Approach to Protecting Half the Terrestrial Realm. BioScience, 1 (6), 1 - 12. https: // doi. org / 10.1093 / biosci / bix 014"]}

Streblote dorsalis (Walker, 1866) (Figs 8–10, 26, 38–40) Megasoma dorsalis Walker, 1866, List of the specimens of lepidopterous insects in the collection of the British Museum, 35, 1947. Type locality: Borneo. Holotype female (NHML), not male as stated by Walker. = Streblote helpsi Holloway, 1987, Moths of Borneo, 3, 25. Type locality: [Borneo] Brunei, Sungai Selanjak. Holotype male (NHML). Taxonomic note. 1. The “male” mentioned in the original description is an error. Walker described a female which is evident from the coloration, the size of the body, and the wings of the specimen. 2. The taxon is known to us from 4 adults originating from Borneo: holotype female (Fig. 8), holotype male of S. helpsi (Fig. 9), and a pair from SNHM (male on Fig. 10). Here we suppose that specimens from Belitung (a pair from SMNH, Figs 11–12, and one female from NBCL) and Sulawesi (two females from NBCL, Fig. 13; earlier mentioned by Zolotuhin & Holloway, 2006) may represent two new species externally resembling and genetically close to S. dorsalis. Barcoding and detailed morphologic study are necessary. 3. The species resembles very much S. castanea from the Philippines, a genetic study is necessary to check their relationship due to the lack of significant morphologic differences., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Spitsyn, Vitaly M., Spitsyna, Elizaveta A., Volkova, Julia S., Yakovlev, Roman V., Meier, Jürg, Saldaitis, Aidas, Revay, Edita E. & Müller, Günter C., 2022, Notes on Streblote (Lepidoptera, Lasiocampidae, Lasiocampinae) from the Malay Archipelago with two new species description, pp. 14-28 in Ecologica Montenegrina 58 on pages 17-19, DOI: 10.37828/em.2022.58.2, http://zenodo.org/record/8029468, {"references":["Walker, F. (1866) List of the specimens of lepidopterous insects in the collection of the British Museum. Part 35. Supplement. Part 5. Printed by order of the Trustees, London, 1535 - 2040.","Holloway, J. D. (1987) The Moths of Borneo. Vol. 3. Superfamily Bombycoidea: families Lasiocampidae, Eupterotidae, Bombycidae, Brahmaeidae, Saturniidae, Sphingidae. Southdene Sdn. Bhd., Kuala Lumpur, 199 pp.","Zolotuhin, V. V. & Holloway, J. D. (2006) The Lasiocampidae of Sulawesi. Tinea, 19 (3), 244 - 259."]}

Streblote pallida (Rothschild, 1915), stat rev. as bona sp. (Figs 14–18, 28–29, 35–40) Taragama castanea pallida Rothschild, 1915, Novitates Zoologicae, 22, 222. Type locality: Bali. Holotype female (NHML). = Nadiasa callipaida Tams, 1935, Mémoires du Musée royal d’histoire naturelle de Belgique 4(12), 45–46. Type locality: Bali, Denpasar. Holotype female (RBINS). The original description is short and based on one female, we would like to redescribe the taxon here. Redescription. Male (Figs 14–15). Antenna creamy or orangish, flagellum covered with creamy speckled scales. Palpi orangish. Eyes dark brown, naked. Head and thorax mesially creamy with dark speckles, tegulae orangish or reddish brown. Abdomen from reddish brown basally to creamy apically with more or less pronounced reddish-brown stripes along it. Epiphysis on the fore leg absent. Forewing. Forewing length: 25–26 mm; wingspan: 41–56 mm. Triangular, apex acute, outer margin slightly waved. Background color reddish brown. Pattern consists of orangish basal spot, two pale waved medial lines, orangish eye-like spot in medial field with dark R-Cu vein, dark brown drop-like spot growing from it between M 3 and CuA 1 towards external field and faded orangish fragmented external line. Cilia creamy. Hindwing. Trapezoid. Background color reddish brown with more or less pronounced creamy medial band, external field with darker anal spot. Cilia creamy, gets darker on anal angle. Genitalia (Figs 28–29, 35–36). Tegumen a narrow band, triangleshaped mesially, bears pair of knob-like socii covered with chaetae. Cucullus elongated finger-like, c-shaped, slightly curved apically; sacculus short tubercle-shaped with pointed apex, body covered with chaetae. Vinculum distally expands and bears cubile, each arm bifurcates, medial outgrowth more sclerotized, slightly c-shaped with serrated outer edge. Juxta medially fused with aedaeagus. Aedeagus c-shaped, hardly sclerotized; caulis short; phallobase apically elongated, claw-like. Vesica compact elongated, basally slightly widens, then bifurcates, each outgrowth apically bears small claw-like cornutus. Eighth sternite trapezoid, caudal laterally gets membranous; eighth tergite somewhat pentagonal with somewhat romboid medial membranous field. Female (Figs 16–18). Bigger, little paler and less contrasty than male. Antenna creamy or orangish, flagellum covered with creamy scales. Palpi orangish. Eyes dark brown, naked. Head and thorax mesially creamy with dark speckles, tegulae orangish or reddish brown. Abdomen creamy, may be reddish basally. Epiphysis on the fore leg absent. Forewing. Forewing length: 40–45 mm; wingspan: 82–94 mm. Oval-shaped, apex blunt, outer margin slightly waved. Background color reddish or orangish brown. Pattern consists of orangish basal spot, two pale waved medial lines, medial orangish eye-like spot and faded orangish fragmented external line. Cilia creamy. Hindwing. Egg-shaped. Background color reddish or orangish brown with more or less pronounced creamy medial line which may become a large field (Fig. 17). Cilia creamy, gets darker near anal angle. Genitalia (Fig. 37). Papillae analis elongated, densely covered with chaetae. Posterior apophyses slightly shorter than anterior ones. Lamella antevaginalis a sclerotized shield-like formation with lateral trenches for cubile arms and medial indentation for apex of phallobase, lamella postvaginalis a narrow medially membranous plate. Ductus bursae short, wrinckled. Corpus bursae spherical, medium-sized, dorsally bears tiny horizontally elongated signum. Variability. Coloration of wings and abdomen of male may be more or less dark (Figs 14–15). Medial lines on fore wing of female may be dull and thin (Fig. 18) or brighter, wider and more curved (Fig. 17). Medial band on hind wing of male and female may be more (Figs 15, 17) or less pronounced (Figs 14, 18). In male genitalia apex of cucullus may be more (Fig. 28) or less curved (Fig. 29), apex of sacculus may be short (Fig. 29) or elongated (Fig. 28), cubile arms with more (Fig. 29) or less developed denticles (Fig. 28) along the outer edge, size and shape of the eight sternum and tergum slightly varies (Figs 35–36). Diagnosis. Reddish-brown species with contrasting light pattern that never occurs in S. dorsalis from Borneo or S. castanea from the Philippines. It occurs on Java and Bali only. Male is of intermediate coloration between S. gerry sp. n. from Sumatra and S. jacquie sp. n. from Flores and Sumba. No clear difference in male genitalia is found between S. pallida, S. jaquie sp. n., S. gerry sp. n., S. dorsalis, and S. castanea. The species has up to 2.45% difference in COI from S. jaquie sp. n., and 4.90–5.39% from S. castanea (Fig. 32). Distribution (Fig. 30). Java and Bali. Ecology. Adults were collected in April, July–August, and December from the altitudes between 6 (Besuki) to 2909 m (Mt Merapi) within the following ecoregions: Western Java lowland and montane rain forests, Eastern Java-Bali lowland and montane rain forests (Dinerstein et al., 2017). According to the collection data, the species is likely multivoltine. Taxonomic note. Zolotuhin (1998) changed the original combination of Taragama castanea pallida Rothschild, 1915 to Streblote dorsalis pallida (Rothschild, 1915) actualizing the traditional point of view that the lighter dorsalis population is spread over some of the Sunda Islands (Hampson, 1892: 405; Grünberg, 1911: 177; Grünberg, 1922: 393). Although, adults of S. dorsalis from Borneo (Figs 9–10) are much darker than S. pallida and they resemble rather the dark form of S. castanea from the Philippines (Figs 1, 4) as Holloway (1987) noted. We raise S. pallida to a specific rank as bona species considering that S. pallida differs externally from both S. castanea and S. dorsalis, never occurs sympatrically with the two and has an average pairwise distance of 5.15% from S. castanea. Material examined. Indonesia, Bali: Holotype ♀, 1912, leg. E. Stresemann (NHML); ♀, holotype of Nadiasa callipaida, Denpasar, 1932, leg. Prince Léopold (RBINS). Indonesia, Java: ♀ (MfNB); ♂, Mt Salak, 6.42 S, 106.44 E, 1000–1500 m, VII.1996, slide 2022 0096, DNA LBEOA423-11 (MWM / ZSM); ♂, Surabaya, 24.VII.1912, slide 2022 0097 (NBCL); ♀, Rajamandala, VII.1934, leg. [?] Toxopeus, slide 2022 0098 (NBCL); ♀, Ambarawa, leg. Ludeking (NBCL); ♂, Mt Merapi, 26.XII.1995 (NSMT); ♂, Besuki, 900 m, VII.1932, leg. S. Wilis (RBINS); ♀, Situbondo, 4.IV.1926 (RBINS)., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Spitsyn, Vitaly M., Spitsyna, Elizaveta A., Volkova, Julia S., Yakovlev, Roman V., Meier, Jürg, Saldaitis, Aidas, Revay, Edita E. & Müller, Günter C., 2022, Notes on Streblote (Lepidoptera, Lasiocampidae, Lasiocampinae) from the Malay Archipelago with two new species description, pp. 14-28 in Ecologica Montenegrina 58 on pages 19-22, DOI: 10.37828/em.2022.58.2, http://zenodo.org/record/8029468, {"references":["Rothschild, W. (1915) On Lepidoptera from the Islands of Ceram (Seran), Buru, Bali, and Misol. Novitates Zoologicae, 22, 209 - 227.","Tams, W. H. T. (1935) Resultats scientifiques du voyage aux Indes Orientales Neerlandaises de LL. AA. RR. le Prince et la Princesse Leopold de Belgique. Memoires du Musee royal d'histoire naturelle de Belgique, 4 (12), 33 - 64.","Holloway, J. D. (1987) The Moths of Borneo. Vol. 3. Superfamily Bombycoidea: families Lasiocampidae, Eupterotidae, Bombycidae, Brahmaeidae, Saturniidae, Sphingidae. Southdene Sdn. Bhd., Kuala Lumpur, 199 pp.","Dinerstein, E., Olson, D., Joshi, A., Vynne, C., Burgess, N. D., Wikramanayake, E., Hahn, N., Palminteri, S., Hedao, P., Noss, R., Hansen, M., Locke, H., Ellis, E. C., Jones, B., Barber, C. V., Hayes, R., Kormos, C., Martin, V., Crist, E., Sechrest, W., Price, L., Baillie, J. E. M., Weeden, D., Suckling, K., Davis, C., Sizer, N., Moore, R., Thau, D., Birch, T., Potapov, P., Turubanova, S., Tyukavina, A., De Souza, N., Pintea, L., Brito, J. C., Llewellyn, O. A., Miller, A. G., Patzelt, A., Ghazanfar, S. A., Timberlake, J., Kloser, H., Shennan- Farpon, Y., Kindt R., Barnekow Lilleso, J. - P., Van Breugel, P., Graudal, L., Voge, M., Al-Shammari, K. F. & Saleem, M. (2017) An Ecoregion-Based Approach to Protecting Half the Terrestrial Realm. BioScience, 1 (6), 1 - 12. https: // doi. org / 10.1093 / biosci / bix 014","Zolotuhin, V. V. (1998) Further synonymic notes in the Lasiocampidae with the description of a new Euthrix - species (Lepidoptera: Lasiocampidae). Entomofauna, 19 (4), 53 - 76.","Hampson, G. F. (1892) The fauna of British India, including Ceylon and Burma. Taylor and Francis, London, 527 pp.","Grunberg, K. (1911) Family: Lasiocampidae. In: Seitz, A. (Ed.), Macrolepidoptera of the World. Vol. 2. The Palaearctic Bombyces & Sphinges. Verlag des Seitz'schen Werkes (Alfred Kernen), Stuttgart, pp. 147 - 180.","Grunberg, K. (1922) Family: Lasiocampidae. In: Seitz, A. (Ed.), Macrolepidoptera of the World. Vol. 10. The Indo-Australian Bombyces and Sphinges. Alfred Kernen, Verlag, Stuttgart, pp. 391 - 415."]}

Lemonia strigata Antoshin & Zolotuhin, 2011 (Figs 32–51, 55–57, 74–87, 99–115) Diagnosis. Lemonia strigata is a medium-sized, yellow-colored moth with a dark postmedial line and a single dark spot on a forewing, and a black dorsal abdomen, but these characters may vary even within the same population. The species is found throughout the Balkans and the Cyclades. Variability. The species’ coloration varies from pale yellow to vivid yolk yellow (Figs 36 and 33, 41 and 41), the postmedial line may fade until barely noticeable and even absent (Figs 32–51); known females pale yellow to yellow. The strength of the line does not seem to be related to the distribution or anything else, specimens from close or the same location may have or have no stripe (Figs 34 and 36, 39 and 40, 41–48, 49 and 50). Discal spot varies in males from small round dot to thicker lunule (Figs 32 and 49) and much more in females, it widens to big triangular spot (Figs 35 and 37). Cilia is usually of the same color with the wing, though may include dark scales (Fig. 36). Abdomen coloration like L. taraxaci – dorsally black, ventrally yellow. It may be striped in adults with a postmedial line on wings (Figs 36 and 49) and without it (Figs 40 and 50), so stripes on the abdomen do not seem to be any kind of a reliable character and are more likely related to the way the abdomen was dried, same happens with L. taraxaci (Fig. 30). Male genitalia of adults from close and even the same locations vary widely in the shape of uncus (Figs 75 and 76, 83 and 84), gnathos and valva. Uncus may be more or less narrow (Figs 84 and 76), straight or widened medially (Figs 82 and 75), with well or weakly pronounced isthmus (Figs 74 and 86, shown with arrows), with a well-split pair of apices or not (Figs 82 and 85), apices may be rounded or pointed (Figs 78 and 79). The distal radius of gnathos varies from narrow to wider (Figs 55 and 56). The external margin of valvae may be prominent or concave. Juxta and eighth sternum shapes were not studied. Spurs on tarsi vary as well in number and size without any system (Figs 99–113). Distribution (Fig. 114). The species is spread in the Balkans and the Cyclades. Taxonomic note. According to ICZN, Article 45.6.2., the taxon name Lemonia taraxaci ab. strigata Rebel, 1910 and its following usage by Rebel and Zerny (1931), Daniel (1964), and Rougeot (1971) was considered invalid by Antoshin and Zolotuhin (2011). They assumed that the name strigata “probably” should be attributed to Rougeot and Viette (1978) who used it for the first time as a trinomial Lemonia taraxaci strigata. Although Rennwald (Rennwald & Rodeland, 2022) suggested that Rougeot and Viette regarded it as an infrasubspecific taxon because they did not mention strigata as well as some other infrasubspecific taxa in the “Species list (with family name) and their main subspecies.” We agree with Rennwald and change the authorship here to Antoshin & Zolotuhin, 2011 as the first reviewers of the taxon., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Volkova, Julia S., Yakovlev, Roman V., Nedoshivina, Svetlana V., Pinzari, Manuela, Pinzari, Mario, Scalercio, Stefano, Bianco, Giovanni, Saldaitis, Aidas, Hausmann, Axel, Revay, Edita E. & Müller, Günter C., 2022, Revision of the Lemonia taraxaci complex, with a description of a new species from Italy and clarification of the status of Lemonia strigata (Lepidoptera Brahmaeidae: Lemoniinae), pp. 337-360 in Zootaxa 5195 (4) on page 346, DOI: 10.11646/zootaxa.5195.4.2, http://zenodo.org/record/7192987, {"references":["Antoshin, D. A. & Zolotuhin, V. V. (2011) Lemonia strigata Rougeot et Viette, 1978, stat. n., and L. ballioni (Christoph, 1888) (Lepidoptera: Lemoniidae) in a fauna of Europe with taxonomic notes on related species and description of a new subspecies. Eversmannia, 25 - 26, 9 - 24.","Rebel, H. (1910) Fr. Berge's Schmetterlingsbuch nach dem gegenwartigen Stande der Lepidopterologie neu bearbeitet und herausgegeben von Professor Dr. H. Rebel in Wien. E. Schweizerbart'sche Verlagsbuchhandlung, Stuttgart, 509 pp.","Rebel, H. & Zerny, H. (1931) Wissenschaftliche ergebnisse der im auftrage und mit kosten der akademie der wissenschaften in Wien im jahre 1918 entsendeten expedition nach Nordalbanien. Denkschriften osterreichische Akademie der Wissenschaften, mathematisch-naturwissenschaftlichen Klasse, 103, 1 - 127.","Daniel, F. (1964) Die Lepidopterenfauna jugoslavisch Mazedoniens II. Posebno izdanie. Nr. 2. Bombyces et Sphinges. Prirodnonaucen Muzej Skopje, Skopje, 75 pp.","Rougeot, P. - C. (1971) Les Bombycoides (Lepidoptera-Bombycoidea) de l'Europe et du Bassin Mediterraneen 5. Tome I. Lemoniidae, Bombycidae, Brahmaeidae, Attacidae, Endromididae. Masson et Cie Editeurs, Paris, 159 pр.","Rougeot, P. - C. & Viette, P. (1978) Guide des Papillons Nocturnes d'Europe et d'Afrique du Nord. Heteroceres (Partim). Delachaux et Niestle, Neuchatel, Paris, 229 pр.","Rennwald, E. & Rodeland, J. (2022) Lemonia strigata. Lepiforum e. V. Bestimmung von Schmetterlingen und ihren Praimaginalstadien. Available from: https: // lepiforum. org / wiki / page / Lemonia _ Strigata (accessed 17 January 2022)"]}

Lemonia taraxaci (Denis & Schiffermüller, 1775) (Figs 1–17, 53, 58–63, 88–93, 114–115) Bombyx taraxaci Denis & Schiffermuller, 1775, Ankündung eines systematischen Werkes von den Schmetterlingen der Wienergegend, 57. Type locality: Austria, Vienna area. Types do not exist. = Phalaena Bombyx taraxaconis Gmelin, 1790, Caroli a Linné, systema naturae, 1(5), 2415. Type locality: Austria. Types were not found. Unnecessary replacement for Bombyx taraxaci Denis & Schiffermüller, 1775. = Lemonia taraxaci terranea Rothschild, 1909, The Annals and magazine of natural history; zoology, botany, and geology, Series 8, 3(13), 7. Type locality: France, Le Lautaret, 45.03541° N, 6.40171° E. Lectotype ♂ (NHML). = Lemonia taraxaci ab. depuncta Stephens, 1924, Deutsche entomologische Zeitschrift “Iris,” 38: 204. Type locality: Poland, Karłów, 50.4742° N, 16.3379° E and Poland, Fort Karola, 50.4642° N, 16.3472° E. Syntypes ♂ and ♀ were not found. Invalid infrasubspecific name. Diagnosis. Lemonia taraxaci is a Central European species, it is restricted to the Alps and the surrounding lowlands. It has a 2.18% gap analysis distance from L. sibirica and 2.98% from L. italiana sp. n. (Fig. 115). Lemonia taraxaci is externally and morphologically variable, without reliable characters found to distinguish it from the other closely related species. Variability. The coloration of the species varies from pale yellow to vivid yolk yellow and from brownish yellow to brown (see Figs 1–17). The brown tint suggested to be related to inhabiting height – as higher specimen flies as darker it is (Antoshin & Zolotuhin, 2011), compare Figs 10 and 11 – 199 and 2275 m accordingly.Although, specimens from the same location may be of a different color (Figs 8 and 9). In addition, specimens with a brown tint are known not only from a mountainous areas but from lowlands too: Osp, Slovenia (35 m; Fig. 12) and Prague, Czechia (250 m; Fig. 14). Few specimens known with darkened veins (Figs 5–6). Discal spot a slightly variable in size dot (Figs 2 and 10) or a lunule- or a comma-shaped spot (Fig. 13). Uncus in male genitalia (Fig. 53) varies in a wide range with no system (Figs 58–63), even specimens from the same location are different (Figs 59–60). Spurs on tarsi vary in number and size without any system (Figs 88–93). Distribution (Fig. 114). The range, especially in the lowlands around the Alps, is not clear. The western, northern and eastern distribution boundaries are likely to shrink because of active land use (The Council of the European Union, 2013). In the northeast and east it is probably limited by the Ore Mountains, the Sudetes and then the Carpathian Mountains. The species range does not exceed the Alps in the southwest and is limited by the Po Valley in the south. In the southeast, the border between L. taraxaci and L. strigata may be somewhere across coastal Croatia if it exists at all. Specimens externally looking like L. taraxaci are known from the Balkans but here we regard them under L. strigata according to fresh DNA data (see “Taxonomic note. 1.” for L. strigata strigata). Wang (1998) recorded L. taraxaci from China, but later Cui et al. (2017) showed it is a misidentified Bombycidae species. Taxonomic notes. 1. The species was described from the “Wienergegend” – Vienna area – a lowland below 300 m. Here we consider mountain and lowland populations within the same species. Further studies are necessary, and DNA analysis may show in fact some differences. 2. Antoshin and Zolotuhin (2011) listed Lemonia taraxaci var. montana Buresch, 1915 as a synonym of L. taraxaci, assuming it is just “an ecologic form with dark and somewhat hyaloid scales.” A syntype female from the NMNHS collection was known to the authors and to us by a color photo (Fig. 38). Here we regard it under L. strigata strigata (see “Taxonomic notes. 2.”). They also listed Lemonia taraxaci ab. antigone Stauder, 1913 (type locality: Adriatic Sea coast) among invalid infrasubspecific names for L. taraxaci, but considering the type locality we list it as a synonym of L. strigata strigata instead. Material examined: France: ♂, Provence-Alpes-Cote d’Azur, N Col de la Boucharde / Col de la Cayolle N, 44.2833° N, 6.7433° E, 1930 m, 26.VII.2009, leg. P. Huemer, TLMF Lep 00400 (TLM); ♂, Les Gleizolles, 44.4759° N, 6.76167° E, 25.VIII.1962, leg. W. Strehlau (CGM); 2♂, High Alps, Queyras Valley, 44.7333° N, 6.8166° E, 1400–2000 m, 12.VIII.1964, 17.VIII.1964, slides 14.529, 14.539 (MWM / ZSM); ♀, High Alps, Les Vigneaux, 44.82342° N, 6.54189° E, 28.VIII.1965 (CGM); ♀, High Alps, Briançon, Prelles, 44.85842° N, 6.5812° E, 13.VIII.1969 (CGM); ♂, High Alps, Chantemerle, 44.98801° N, 6.54999° E, 1900 m, 2–14.VIII.1978, leg. P. Walter (ZSM); ♂, High Alps, Col du Galibier, 45.06409° N, 6.40773° E, 2600 m, 3.VIII.1962, leg. Lukasch (ZSM); ♂, High Alps, Argentière, 45.98359° N, 6.92688° E, 1400 m, VIII.1975, leg. W. Pevlee (CGM). Switzerland: 2♂, Valais, Zeneggen, 46.27357° N, 7.86696° E, 1450 m, 10.VIII.1968 (ZSM); ♂, Bern, Kandersteg, 46.49473° N, 7.67443° E, 1500 m (CGM); ♂, St Moritz, 46.49079° N, 9.8355° E, 29.VII.1955 (CGM); ♂, Andermatt, 1700 m, 46.63391° N, 8.59356° E, 26.VII.1979, leg. H. Hacker, slide 14.528 (MWM / ZSM); ♂, Valais, Col du Simplon, 46.25059° N, 8.0322° E, 12–26.VII.1952 (MNHN); 3♂, Tremorgio Lake, 46.48086° N, 8.7197° E, 24.VII.1952, 27.VII.1952, leg. L. Settele (SMNH). Germany: ♂, ♀, Hossingen, 48.1888° N, 8.9223° E, 8.VIII.1985, 10.VIII.1985, leg. Lingenhöle (CGM); ♀, S Bavaria, N Munich, Fröttmaninger Heide, Am Kiefernwald, 48.2077° N, 11.6122° E 5–20.X.1930, leg. Kolb (CGM). Italy: ♂, Piedmont, Cottian Alps, Colle delle Finestre, 45.077° N, 7.051° E, 2155 m, 26.VIII.2019, leg. Ch. Wieser, KLM Lep 14638 (KLM); ♂, Piedmont, Cottian Alps, Testa dell’Assietta, 45.064° N, 6.951° E, 2530 m, 25.VIII.2019, leg. Ch. Wieser, KLM Lep 14639 (KLM); ♂, South Tyrol, Terlan, 46.52951° N, 11.24852° E, leg. F. Dannehl (ZSM); ♂, Valle d’Aosta, Val di Rhêmes, S Talende, Rifugio Benevolo, 45.51564° N, 7.08442° E, 2300–2400 m, 25.VII.1989, leg. E. Brockmann (ZSM); 5♂, 5♀, Autonomous Province of Trento, Vela, 46.083° N, 11.1008° E, 19.IX.1999, leg. M. Gick, slide Lemon-10 (CGM); ♂, Gardasee, Monte Baldo, 45.72638° N, 10.84388° E, 1100 m, VII.2002, leg. Weiss (CGM); ♂, Piedmont, Cottian Alps, Colle delle Finestre, 45.077° N, 7.051° E, 2155 m, 26.VIII.2019, leg. Ch. Wieser, KLM Lep 14638 (KLM); ♂, Bassano del Grappa, 500 m, 9.X.1972, leg. K. Heuberger-Regensburg (CGM). Austria: ♀, Baden bei Wien, 48.00214° N, 16.23091° E, VIII.1931 (ZSM); ♀, Vienna, Lainzer Tiergarten, 48.16969° N, 16.22052° E, 9.X.1922 (ZSM); ♂, Burgenland, Kohfidisch, 47.17423° N, 16.35754° E, 260 m, 5–12.VIII.1964 (ZSM); ♂, ♀, Burgenland, Aspang – Edlitz, 47.5866° N, 16.09962° E, 20.X.1981, leg. Pinker (CGM). Czechia: ♂, Prague, 50.07553° N, 14.4378° E (CGM). Hungary: ♂, Nógrád, Egyházasgerge, 48.18002° N, 19.64529° E, 2.IX.1996, leg. O. Kostjuk, slide 14.543 (MWM / ZSM; CGM); ♂, Bükk Mountains, 48.08333° N, 20.5° E, 8.IX.1963, leg. J. Jablonkay, slide 14.405 (MWM / ZSM); ♂, Jósvafő, Tohonyavölgy, 48.48262° N, 20.55044° E, 6.IX.1978, leg. P. Gyulai (CGM). Slovenia: ♂, Kamniška Bistrica, 46.32465° N, 14.59978° E, 12.VII.1978 (ZSM); ♂, Osp, 45.57159° N, 13.85846° E, 6.X.1972, leg. P. Tonkli (CGM). Croatia: ♂, Rovinj, 45.08116° N, 13.6387° E, 0–50 m, 9.X.1967, leg. Dantel, slide 14.441 (MWM / ZSM); ♂, Medveja, 45.26906° N, 14.26834° E, 10–16.IX.1955 (ZSM)., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Volkova, Julia S., Yakovlev, Roman V., Nedoshivina, Svetlana V., Pinzari, Manuela, Pinzari, Mario, Scalercio, Stefano, Bianco, Giovanni, Saldaitis, Aidas, Hausmann, Axel, Revay, Edita E. & Müller, Günter C., 2022, Revision of the Lemonia taraxaci complex, with a description of a new species from Italy and clarification of the status of Lemonia strigata (Lepidoptera Brahmaeidae: Lemoniinae), pp. 337-360 in Zootaxa 5195 (4) on pages 339-342, DOI: 10.11646/zootaxa.5195.4.2, http://zenodo.org/record/7192987, {"references":["Gmelin, J. F. (1790) s. n. Caroli a Linne, systema naturae, 1 (5), 2225 - 3020.","Rothschild, W. (1909) Description of a new Lemonia. The Annals and magazine of natural history, including zoology, botany, and geology, Series 8, 3 (13), 7.","Antoshin, D. A. & Zolotuhin, V. V. (2011) Lemonia strigata Rougeot et Viette, 1978, stat. n., and L. ballioni (Christoph, 1888) (Lepidoptera: Lemoniidae) in a fauna of Europe with taxonomic notes on related species and description of a new subspecies. Eversmannia, 25 - 26, 9 - 24.","The Council of the European Union (2013) Directive 2013 / 17 / EU of 13 May 2013 adapting certain directives in the field of environment, by reason of the accession of the Republic of Croatia. Official Journal of the European Union, L 158 / 193. Available from: http: // data. europa. eu / eli / dir / 2013 / 17 / oj (accessed 17 January 2022)","Wang, L. - Y. (1998) A new record in China - Lemoniidae. Entomological knowledge, 35 (2), 105 - 106.","Cui, L., Cheng, R. & Jiang, N. (2017) Lemoniidae are not distributed in China: the moth identified as Lemonia taraxaci (Lepidoptera: Leomoniidae) in China is actually a bombycid species (Lepidoptera: Bombycidae). Acta Entomologica Sinica, 60 (6), 731 - 734. [in Chinese] https: // doi. org / 10.16380 / j / kcxb. 2017.06.013","Stauder, H. (1913) Weitere Beitrage zur Kenntnis der Makrolepidopterenfauna der adriatischen Kustengebiete. Bollettino della Societa Adriatica di Scienze Naturali in Trieste, 27 (1), 105 - 166."]}

Lemonia strigata deucalion Antoshin & Zolotuhin, 2011 (Figs 49–51, 57, 85–87, 112–115) Lemonia strigata deucalion Antoshin & Zolotuhin, 2011, Eversmannia, 25–26, 17. Type locality: Greece, the Cyclades, Andros Island, Remata, 37.8703° N, 24.8363° E. Male holotype (MWM/ZSM). Diagnosis. L. syrigata deucalion is an island subspecies from the Cyclades. Externally and morphologically variable, no reliable characters were found to distinguish it from the Balkan subspecies. Variability. Like in L. strigata above. Distribution (Fig. 106). The Cyclades. Taxonomic note. Described as much paler than L. strigata strigata (Antoshin & Zolotuhin, 2011), although seems to be within a color variation of the species (Figs 49–51), some adults have paler thorax and abdomen (Fig. 49). The Cycladic adults have to be barcoded to confirm the validity of the subspecies. Material examined: Greece, the Cyclades: holotype ♂, Andros Island, Remata, 37.8703° N, 24.8363° E, 21.Х.1980, leg. H. Malicky (MWM / ZSM); paratypes 3♂, Andros Island, Remata, 37.8703° N, 24.8363° E, 21.Х.1980, leg. H. Malicky, slide 14.547 (MWM / ZSM; CGM); paratypes 3♂, ♀, Naxos Island, Apollonas, 37.1822° N, 25.5510° E, 26.Х.1980, leg. H. Malicky, slides 14.444, 14.445, 16.967 (MWM / ZSM; CGM)., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Volkova, Julia S., Yakovlev, Roman V., Nedoshivina, Svetlana V., Pinzari, Manuela, Pinzari, Mario, Scalercio, Stefano, Bianco, Giovanni, Saldaitis, Aidas, Hausmann, Axel, Revay, Edita E. & Müller, Günter C., 2022, Revision of the Lemonia taraxaci complex, with a description of a new species from Italy and clarification of the status of Lemonia strigata (Lepidoptera Brahmaeidae: Lemoniinae), pp. 337-360 in Zootaxa 5195 (4) on pages 353-355, DOI: 10.11646/zootaxa.5195.4.2, http://zenodo.org/record/7192987, {"references":["Antoshin, D. A. & Zolotuhin, V. V. (2011) Lemonia strigata Rougeot et Viette, 1978, stat. n., and L. ballioni (Christoph, 1888) (Lepidoptera: Lemoniidae) in a fauna of Europe with taxonomic notes on related species and description of a new subspecies. Eversmannia, 25 - 26, 9 - 24."]}

Lemonia italiana sp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: 3B639832-7D67-4D8D-81F8-89F82148EB9A (Figs 24–31, 54, 67–73, 97–98, 114–118) = Lemonia taraxaci f. abluta Dannehl. Type locality: Italy, Apennines centrale, Montagna Grande, 1200–1500 m. Paratype ♂ (ZSM), nomen nudum. Type material: HOLOTYPE ♂, Italy, Calabria centr., Sila grd., Casali del Manco, San Nicola Silano (CS), 39.29586° N, 16.52569° E, 1550 m, 2.IX.2012, leg. A. Hausmann, slide Lemon-7 (ZSM). PARATYPES (133♂, 5♀ total): Italy, Emilia-Romagna: 3♂, Casina, 13.IX.1958, leg. A. Beyerl (CGM); ♂, Zattaglia, M. Mauro, 350 m, 8.X.2010, leg. G. Govi (CAF). Tuscany: 2♂, La Cisa, 44.4716° N, 9.9283° E, 1000 m, IX.1959, leg. L. Weinmann (SMNS); 3♂, 2♀, Siena, Geggiano, Pianella, 43.3639° N, 11.3856° E, 350 m, 21–28.IX.2021, leg. N. Keil, BC ZSM Lep 113545 (CNK; CBM). Marches: 3♂, Monte Catria, above Fossato, 43.4704° N, 12.6661° E, 1100 m, 23.IX.2017, leg. G. Govi, BC ZSM Lep 114582, 114583, 114584 (ZSM); 2♂, Monti Sibillini, Pintura di Bolognola, 1400 m, 1.09.2011, leg. A. Floriani (CAF) Umbria: 2♂, Montagna Grande, 42.8469° N, 12.87161° E, 1000 m, 12.IX (CGM). Lazio: ♂, Roma, Monti Sabatini, Casaccia, Santa Maria di Galeria, 30.IX.1970, leg. P. Maltzeff, slide Lemon-17 (CGM); ♂, Roma, Olgiata, 7.IX.1967, slide 14.549 (MWM / ZSM); 17♂, 2♀, Rieti, Vallemare, Colle Marcone, 1121 m, 5.IX.1987, 13.IX.1987, 17.IX.1988, 20.IX.1991, 11.IX.2000, 8.IX.2002, 23.IX.2006, 14.IX.2008, leg. M. Pinzari (CMP, CGM); ♀, Rieti, Vallemare, Costa della Chiusa, 1093 m, 16.IX.1989, leg. M. Pinzari (CMP); 14♂, Rieti, Posta, Villa Camponeschi, Colle Petruccio, 1000 m, 4–6.IX.1996, 8.IX.2001, leg. A. Zilli (CMP, CGM); ♂, Rieti, Santa Anatolia, 750 m, 9.IX.1994, leg. P. Provera (CMP); 20♂, Roma, Olgiata, 30.IX.1961, 2.IX.1965, 3.IX.1965, 4.IX.1965, 3.IX.1966, 4.X.1966, 7.X.1966, 9.X.1966, 7.X.1967, 9.X.1972, leg. P. Provera (CMP); 3♂, Roma, Casaccia, Santa Maria di Galeria, 190 m, 5.X.1970, 7.X.1971, 22.X.1971, leg. P. Maltzeff (CMP, CGM). Abruzzo: 2♂, L’Aquila, Rocca di Botte, 800 m, 30.IX.1974, leg. P. Provera (CMP, CGM); ♂, L’Aquila, Sperone (Gioia dei Marsi), 1000 m, 30.IX.1995, leg. P. Provera (CMP); ♂, Pescina, 900 m, 7.IX.1994, leg. P. Provera (CJM); ♂, V. F. Capo, La Maina mt., 1100 m, 5.X.1980, leg. P. Provera (CGM). Apulia: 3♂, Ostuni, 40.72952° N, 17.57799° E, 5 m, 1–10.X.1969, leg. E. Beyerl (CGM). Basilicata: 9♂, Forststraβe Mad. di Sirino, 40.1430° N, 15.8148° E, 1570 m, 5.IX.2011, leg. A. Hausmann (ZSM); ♂, Forststraβe Mad. di Sirino, 40.2417° N, 16.3633° E, 1570 m, 5.IX.2011, leg. A. Hausmann, BC ZSM Lep 60899 (ZSM); ♂, Md. di Sirino, 1060 m, 15.IX.1991, leg. A. Hausmann (ZSM); ♂, Piano di Ruggio, 1545 m, 16.IX.2004, leg. Scalercio & Greco (ZSM); ♂, Costa tirr., Cristo di Maratea, 620 m, 28.X.1996, leg. A. Hausmann (ZSM); 2♂, Valle Noce, Trecchina, 320 m, 29.X.1996, leg. A. Hausmann (ZSM). Calabria: 3♂, Pollino, Mercene, 300 m, 6.X.1980 (ZSM); ♂, Mte. Pollino, Col. d. Dragone, 1620 m, 12.IX.1995, leg. A. Hausmann (ZSM); ♂, Casali del Manco, San Nicola Silano (CS), 1450 m, 4.IX.2000, leg. S. Scalercio (ZSM); ♂, La Sila, Lago di Arvo, 1350 m, 11.IX.1971, leg. Wiegel (CGM); 8♂, Sila grd., Casali del Manco, San Nicola Silano (CS), 39.29719° N, 16.5261° E, 1550 m, 31.VIII.2012, 2.IX.1999, leg. A. Hausmann, BC ZSM Lep 30795, slides Lemon-6, Lemon-8, Lemon-9 (ZSM); ♂, Sila Grande, M. Curcio, 1690 m, 9.X.2002, leg. Scalercio & Infusino (ZSM); 2♂, Sila, Mte Curcio S, 39.3120° N, 16.4243° E, 1730 m, wetland, 22.VIII.2000, leg. A. Hausmann (ZSM); 2♂, Donnici, Fosso Cucolo, 550 m, 18.X.1996, leg. S. Scalercio, slide Lemon-5 (ZSM); ♂, P. del minatore, 39.7837° N, 16.0753° E, 1420m, 29.IX.2016, leg. Scalercio & Infusino (CREA-FL); ♂, Bocca di Novacco, Saracena, 39.8140° N, 16.0451° E, 1340m, 23.IX.2015, leg. Scalercio & Infusino (CREA-FL); ♂, Quaresima, Aprigliano, 39.2353° N, 16.5087° E, 1310m, 7.IX.2015, leg. Scalercio & Infusino (CREA-FL); 2♂, Colle Macchie, Pedace, 39.2591° N, 16.5271° E, 1440m, 7.IX.2015, leg. Scalercio & Infusino (CREA-FL); ♂, Colle Macchie, Pedace, 39.2597° N, 16.5308° E, 1450m, 7.IX.2015, leg. Scalercio & Infusino (CREA-FL); ♂, Colle Macchie, Pedace, 39.2589° N, 16.5272° E, 1440m, 7.IX.2015, leg. Scalercio & Infusino (CREA-FL); ♂, C. da Licari, Marcellinara, 38.9188° N, 16.4977° E, 215m, 10.X.2018, leg. S. Scalercio (CREA-FL); ♂, Vallone Tasso, Spezzano Sila, 39.335985° N, 16.415114° E, 1409m, 10.IX.2018, leg. S. Scalercio (CREA-FL); ♂, Villaggio Buturo, Zagarise, 39.0766° N, 16.2713°E, 1540m, 14.IX.2020, leg. S. Scalercio & C. Di Marco (CREA-FL); 2♂, Fiume Crati, Tarsia, presso cimitero di Tarsia, 39.6086° N, 16.2713° E, 55m, 15.X.2021, leg. S. Scalercio (CREA-FL); ♂, Gambarie D’Aspromonte, 1300 m, 15.IX.1970, leg. F. Hartig (CGM). Sicilia: ♂, ♀, Mistretta, IX.1938 (CGM); ♂, Mistretta, 14.IX.1938 (CGM); ♂, ♀, Madonie, 1200 m, 9.IX (CGM); 2♂, Madonie, Mandria del Conte, 1300 m, 18.IX.1993, leg. N. Grillo (CMP, CGM); 2♂, Bosco di Malabotta, 1320m, 2.X.07, leg. Infusino (CREA-FL). Diagnosis. Lemonia italiana is an Italian and Sicilian species. It has a 2.98% gap analysis distance from L. taraxaci and 3.30% from L. sibirica (Fig. 115). Externally and morphologically variable, no reliable characters were found to distinguish it from closely related species. Description. Male habitus (Figs 24–31). Antenna orange, flagellum apically covered with black scales. Head and thorax orange. Forewing length: 20–24 mm; wingspan: 43–46 mm. Wing somewhat triangular, external margin rounded and smooth, apex obtuse. Coloration ranges from pale to yolk yellow and may saturate towards the external margin. Cilia is wing color. Discal mark a small dark brown dot or lunule-shaped spot on the outer margin of the cell. Hindwing follows the same coloration as forewing. Cilia is of the same color as the wing. Abdomen black dorsally, the yellow interspace between abdominal segments may appear (Fig. 30), laterally orange, and ventrally yellow. Femur yellow, tibia of fore and middle legs speckled yellow and black, tibia of hind leg yellow, tarsi black. The tibial spur formula is 0-2-2, epiphysis absent (Figs 97–98). Male genitalia (Fig. 54). Tegumen somewhat triangular, widening basally. Socii membranous, covered with short chaetae. Uncus elongated, varies in width and length but always bifurcated apically and with isthmus near its base, covered with chaetae (Figs 67–73). Gnathos short, rounded, spatula-like with an uneven surface, a narrow subanal plate going from it towards the anal opening. Vinculum narrow, band-like. Valvae elongated, rounded, covered with chaetae, the ventral lateral margin may be convex or concave; sacculus weakly pronounced. Juxta boat-like pointed apically, widened basally, surrounds aedeagus. Aedeagus elongated, narrow, and c-shaped. Vesica small, elongated, and bag-shaped. Eighth sternum small, somewhat triangular, apically rounded, and varies in shape. Eighth tergum trapezoid not modified. Female habitus (Fig. 31). Forewing length: 24 mm; wingspan 48 mm. Fore and hind wing coloration pale yellow. Female genitalia not studied. Etymology. We dedicate the species not to the Italian territory, which also includes Sicily, but to the Italian language and culture that we all admire. Distribution (Fig. 114). The Italian Peninsula southwards of the Po Valley to Sicily, the northeast border is somewhere between the Alps and the Apennines. Earlier recorded as L. taraxaci by Grünberg, 1913; Mariani, 1941; Rougeot, 1971; Teobaldelli, 1976; Prola et al., 1978; de Freina & Witt, 1987; Bertaccini et al., 1994; Sciarretta & Parenzan, 1998; Sciarretta & Zahm, 2002; Parenzan & Porcelli, 2006; Sciarretta et al., 2008; Pinzari et al., 2010; Antoshin & Zolotuhin, 2011; Zerunian & Zilli, 2014, Infusino & Scalercio, 2018; Scalercio & Greco, 2018; Scalercio, 2020; Scalercio et al., 2022. Biology (Figs 116–118). Ecologically the species is related to the following regions (Dinerstein et al., 2017): Italian sclerophyllous and semi-deciduous forests, Apennine deciduous montane forests, Tyrrhenian-Adriatic sclerophyllous and mixed forests, and South Apennine mixed montane forests. It inhabits heights from 55 (Fiume Crati, Tarsia, 39.6086° N, 16.2713° E) up to 2200 m (Monte Pollino, 39.907° N, 16.18886° E) above sea level. Adults were collected from August to October. Taxonomic note. Antoshin and Zolotuhin (2011: 15) mentioned a series of paratypes of Lemonia taraxaci f. abluta Dannehl deposited in ZSM. Adults were collected in Italy, Umbria, Montagna Grande, 42.8469° N, 12.87161° E – a location within the new species distribution area. Neither we nor Antoshin and Zolotuhin found the name in the available literature, so we treat the name abluta as nomen nudum.

Lemonia strigata strigata Antoshin & Zolotuhin, 2011 (Figs 32–48, 55–56, 74–84, 99–111, 114–115) Lemonia strigata strigata Antoshin & Zolotuhin, 2011, Eversmannia, 25–26, 15. = Lemonia taraxaci ab. strigata Rebel, 1910, Fr.Berge’s Schmetterlingsbuch nach dem gegenwärtigen Stande der Lepidopterologie neu bearbeitet und herausgegeben von Professor Dr. H. Rebel in Wien, 9, 131. Type locality: Croatia, Zadar. Female type was not found. Invalid infrasubspecific name. ? Lemonia taraxaci var. montana Buresch, 1915, Travaux de la Socieìteì Bulgare des Sciences Naturelles, 7, 100. Type locality: Bulgaria, Rhodope Mts, Musala. Female syntype known by color photo (NMNHS). =? Lemonia taraxaci ab. antigone Stauder, 1913, Bollettino della Societa Adriatica di Scienze Naturali in Trieste, 27: 159. Type locality: Adriatic Sea coast. Types were not found. Invalid infrasubspecific name. Diagnosis. L. strigata strigata is a Balkan subspecies, it has a 2.99% gap analysis distance from L. taraxaci, 2.82% from L. sibirica and 2.66% L. italiana sp. n. (Fig. 107). Externally and morphologically variable, no reliable characters were found to distinguish it from the Cycladic subspecies (see below) but it differs by a presence of a dark medial line from L. taraxaci, L. sibirica, and L. italiana sp. n. Variability. Like in L. strigata above. Distribution (Fig. 106). The Balkans. Taxonomic notes. 1. Two barcoded males from Greece with a vague dark postmedial line (GWORQ826-10 and GWORQ827-10; Fig. 39) and the barcoded female from Bulgaria without the line but with a large triangular medial spot (LBEOW 786-10; Fig. 35) have only 0.76% genetic distance between. This proves that the postmedial line is not a stable diagnostic character for L. strigata, the same we see in Lemonia strigata deucalion Antoshin & Zolotuhin, 2011, from the Cycladic islands, some of the adults in the type series are clearly without a stripe (Figs 50–51). We know also a series of adults that were bred in the same year ex ovo probably from the same batch of eggs from Lithochoro, Greece (Figs 41–48), they have more or less pronounced postmedial line. Thus, we suggest that taraxaci -like adults without a stripe from the Balkans are just a variant of L. strigata and list them in examined material here, under L. strigata strigata. 2. The taxon L. taraxaci var. montana is known to us just like to Antoshin and Zolotuhin (2011) by a photo of a female syntype from NMNHS (Fig. 38) – it is a pale taraxaci -like worn specimen. According to a close genetic relationship between the typical L. strigata and taraxaci -like adults, we consider L. taraxaci var. montana to be a senior synonym of L. strigata, although leave the formal act of synonymy for the future when more Balkan adults will be barcoded. Material examined: Croatia: ♂, Zadar, 0 m, 18.X.1988, leg. H. Modl (CGM); ♂, Mosor, 22.X.1974, leg. D. Müting (CGM). North Macedonia: ♂, Drenovo, Kavadar, leg. J. Thurner, 1– 3.10.1959, 1–10.X.1959, slide 14.443 (MWM / ZSM); ♂, Strumica, 5.X.1973, slide 14.446 (MWM / ZSM); 4♂, Prilep, 2–7.XI.1971, 2.XI.1972, 28.VIII.1973, 21.X.1973, slides 14.447, 14.449 (MWM / ZSM; CGM); ♂, Ohrid environs, 12–15.IX.1937, 24.IX– 3.X.1937, leg. Thurner (CGM). Bulgaria: ♀, syntype of montana Buresch, Musala, 2.VIII.1910, S. M. Ferdinand I, le Roi des Bulgares (NMNHS); ♂, Kresna Gorge, 8.X.1981, leg. J. Ganev, slide 14.520 (MWM / ZSM); ♂, Rupite, Kozhuh Heights, 21.X.1990 (CGM); ♂, ♀, Struma valley, 3 km SW of Kresna, 20.X.2014, leg. Babics & Benedek (CGM). Greece: ♂, ♀, Thermopilae, 60–100 m, 1.X.1971, 15.X.1977, leg. Lukasch (MWM / ZSM); ♂, Peloponnes, Lagkadia, 1200 m, 2.X.1977, leg. Lukasch (MWM / ZSM); ♂, Epirus, Thesprotia, Fascomillia, 20 m, 18.XI.1992, 14.X.1995, 15.XI.1999, leg. Schaider, slide 14.442 (MWM / ZSM; CGM); ♂, Igoumenitsa, Phascomillia, 9.XI.1992, leg. Schaider, slide 14.540 (MWM / ZSM); ♂, Tripoli, Stenon, 800 m, 12.VIII.1985, 21.VIII.1985, slide 14.541 (MWM / ZSM); 2♂, ♀, Peloponnes, 15 km S Tripoli, 700 m, 6.X.1982, leg. H. Hacker, slides 14.448, 14.527, 14.542 (MWM / ZSM); ♂, S Hellas, NE Peloponnes, Prov. Korinth, 8 km to coast region, 10 km SW Sofiko, 12 km NE Athikia, 37°46’47” N, 23°02’04” E, 22–23.X.2008, leg. Steidel, Mehlhom (CGM); ♂, Pieria Mts., Skotina, 40.0231° N, 22.5520° E, 700 m, 21.X.2014, leg. Babics, Benedek (CGM); 4♂, 4♀, Lithochoro, ex ovo, 10.X.1996, 23.X.1996, 4.XI.1996, leg. F. Hohensteiner (SMNS)., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Volkova, Julia S., Yakovlev, Roman V., Nedoshivina, Svetlana V., Pinzari, Manuela, Pinzari, Mario, Scalercio, Stefano, Bianco, Giovanni, Saldaitis, Aidas, Hausmann, Axel, Revay, Edita E. & Müller, Günter C., 2022, Revision of the Lemonia taraxaci complex, with a description of a new species from Italy and clarification of the status of Lemonia strigata (Lepidoptera Brahmaeidae: Lemoniinae), pp. 337-360 in Zootaxa 5195 (4) on pages 346-348, DOI: 10.11646/zootaxa.5195.4.2, http://zenodo.org/record/7192987, {"references":["Antoshin, D. A. & Zolotuhin, V. V. (2011) Lemonia strigata Rougeot et Viette, 1978, stat. n., and L. ballioni (Christoph, 1888) (Lepidoptera: Lemoniidae) in a fauna of Europe with taxonomic notes on related species and description of a new subspecies. Eversmannia, 25 - 26, 9 - 24.","Rebel, H. (1910) Fr. Berge's Schmetterlingsbuch nach dem gegenwartigen Stande der Lepidopterologie neu bearbeitet und herausgegeben von Professor Dr. H. Rebel in Wien. E. Schweizerbart'sche Verlagsbuchhandlung, Stuttgart, 509 pp.","Stauder, H. (1913) Weitere Beitrage zur Kenntnis der Makrolepidopterenfauna der adriatischen Kustengebiete. Bollettino della Societa Adriatica di Scienze Naturali in Trieste, 27 (1), 105 - 166."]}

Lemonia italiana sp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: 3B639832-7D67-4D8D-81F8-89F82148EB9A (Figs 24–31, 54, 67–73, 97–98, 114–118) = Lemonia taraxaci f. abluta Dannehl. Type locality: Italy, Apennines centrale, Montagna Grande, 1200–1500 m. Paratype ♂ (ZSM), nomen nudum. Type material: HOLOTYPE ♂, Italy, Calabria centr., Sila grd., Casali del Manco, San Nicola Silano (CS), 39.29586° N, 16.52569° E, 1550 m, 2.IX.2012, leg. A. Hausmann, slide Lemon-7 (ZSM). PARATYPES (133♂, 5♀ total): Italy, Emilia-Romagna: 3♂, Casina, 13.IX.1958, leg. A. Beyerl (CGM); ♂, Zattaglia, M. Mauro, 350 m, 8.X.2010, leg. G. Govi (CAF). Tuscany: 2♂, La Cisa, 44.4716° N, 9.9283° E, 1000 m, IX.1959, leg. L. Weinmann (SMNS); 3♂, 2♀, Siena, Geggiano, Pianella, 43.3639° N, 11.3856° E, 350 m, 21–28.IX.2021, leg. N. Keil, BC ZSM Lep 113545 (CNK; CBM). Marches: 3♂, Monte Catria, above Fossato, 43.4704° N, 12.6661° E, 1100 m, 23.IX.2017, leg. G. Govi, BC ZSM Lep 114582, 114583, 114584 (ZSM); 2♂, Monti Sibillini, Pintura di Bolognola, 1400 m, 1.09.2011, leg. A. Floriani (CAF) Umbria: 2♂, Montagna Grande, 42.8469° N, 12.87161° E, 1000 m, 12.IX (CGM). Lazio: ♂, Roma, Monti Sabatini, Casaccia, Santa Maria di Galeria, 30.IX.1970, leg. P. Maltzeff, slide Lemon-17 (CGM); ♂, Roma, Olgiata, 7.IX.1967, slide 14.549 (MWM / ZSM); 17♂, 2♀, Rieti, Vallemare, Colle Marcone, 1121 m, 5.IX.1987, 13.IX.1987, 17.IX.1988, 20.IX.1991, 11.IX.2000, 8.IX.2002, 23.IX.2006, 14.IX.2008, leg. M. Pinzari (CMP, CGM); ♀, Rieti, Vallemare, Costa della Chiusa, 1093 m, 16.IX.1989, leg. M. Pinzari (CMP); 14♂, Rieti, Posta, Villa Camponeschi, Colle Petruccio, 1000 m, 4–6.IX.1996, 8.IX.2001, leg. A. Zilli (CMP, CGM); ♂, Rieti, Santa Anatolia, 750 m, 9.IX.1994, leg. P. Provera (CMP); 20♂, Roma, Olgiata, 30.IX.1961, 2.IX.1965, 3.IX.1965, 4.IX.1965, 3.IX.1966, 4.X.1966, 7.X.1966, 9.X.1966, 7.X.1967, 9.X.1972, leg. P. Provera (CMP); 3♂, Roma, Casaccia, Santa Maria di Galeria, 190 m, 5.X.1970, 7.X.1971, 22.X.1971, leg. P. Maltzeff (CMP, CGM). Abruzzo: 2♂, L’Aquila, Rocca di Botte, 800 m, 30.IX.1974, leg. P. Provera (CMP, CGM); ♂, L’Aquila, Sperone (Gioia dei Marsi), 1000 m, 30.IX.1995, leg. P. Provera (CMP); ♂, Pescina, 900 m, 7.IX.1994, leg. P. Provera (CJM); ♂, V. F. Capo, La Maina mt., 1100 m, 5.X.1980, leg. P. Provera (CGM). Apulia: 3♂, Ostuni, 40.72952° N, 17.57799° E, 5 m, 1–10.X.1969, leg. E. Beyerl (CGM). Basilicata: 9♂, Forststraβe Mad. di Sirino, 40.1430° N, 15.8148° E, 1570 m, 5.IX.2011, leg. A. Hausmann (ZSM); ♂, Forststraβe Mad. di Sirino, 40.2417° N, 16.3633° E, 1570 m, 5.IX.2011, leg. A. Hausmann, BC ZSM Lep 60899 (ZSM); ♂, Md. di Sirino, 1060 m, 15.IX.1991, leg. A. Hausmann (ZSM); ♂, Piano di Ruggio, 1545 m, 16.IX.2004, leg. Scalercio & Greco (ZSM); ♂, Costa tirr., Cristo di Maratea, 620 m, 28.X.1996, leg. A. Hausmann (ZSM); 2♂, Valle Noce, Trecchina, 320 m, 29.X.1996, leg. A. Hausmann (ZSM). Calabria: 3♂, Pollino, Mercene, 300 m, 6.X.1980 (ZSM); ♂, Mte. Pollino, Col. d. Dragone, 1620 m, 12.IX.1995, leg. A. Hausmann (ZSM); ♂, Casali del Manco, San Nicola Silano (CS), 1450 m, 4.IX.2000, leg. S. Scalercio (ZSM); ♂, La Sila, Lago di Arvo, 1350 m, 11.IX.1971, leg. Wiegel (CGM); 8♂, Sila grd., Casali del Manco, San Nicola Silano (CS), 39.29719° N, 16.5261° E, 1550 m, 31.VIII.2012, 2.IX.1999, leg. A. Hausmann, BC ZSM Lep 30795, slides Lemon-6, Lemon-8, Lemon-9 (ZSM); ♂, Sila Grande, M. Curcio, 1690 m, 9.X.2002, leg. Scalercio & Infusino (ZSM); 2♂, Sila, Mte Curcio S, 39.3120° N, 16.4243° E, 1730 m, wetland, 22.VIII.2000, leg. A. Hausmann (ZSM); 2♂, Donnici, Fosso Cucolo, 550 m, 18.X.1996, leg. S. Scalercio, slide Lemon-5 (ZSM); ♂, P. del minatore, 39.7837° N, 16.0753° E, 1420m, 29.IX.2016, leg. Scalercio & Infusino (CREA-FL); ♂, Bocca di Novacco, Saracena, 39.8140° N, 16.0451° E, 1340m, 23.IX.2015, leg. Scalercio & Infusino (CREA-FL); ♂, Quaresima, Aprigliano, 39.2353° N, 16.5087° E, 1310m, 7.IX.2015, leg. Scalercio & Infusino (CREA-FL); 2♂, Colle Macchie, Pedace, 39.2591° N, 16.5271° E, 1440m, 7.IX.2015, leg. Scalercio & Infusino (CREA-FL); ♂, Colle Macchie, Pedace, 39.2597° N, 16.5308° E, 1450m, 7.IX.2015, leg. Scalercio & Infusino (CREA-FL); ♂, Colle Macchie, Pedace, 39.2589° N, 16.5272° E, 1440m, 7.IX.2015, leg. Scalercio & Infusino (CREA-FL); ♂, C. da Licari, Marcellinara, 38.9188° N, 16.4977° E, 215m, 10.X.2018, leg. S. Scalercio (CREA-FL); ♂, Vallone Tasso, Spezzano Sila, 39.335985° N, 16.415114° E, 1409m, 10.IX.2018, leg. S. Scalercio (CREA-FL); ♂, Villaggio Buturo, Zagarise, 39.0766° N, 16.2713°E, 1540m, 14.IX.2020, leg. S. Scalercio & C. Di Marco (CREA-FL); 2♂, Fiume Crati, Tarsia, presso cimitero di Tarsia, 39.6086° N, 16.2713° E, 55m, 15.X.2021, leg. S. Scalercio (CREA-FL); ♂, Gambarie D’Aspromonte, 1300 m, 15.IX.1970, leg. F. Hartig (CGM). Sicilia: ♂, ♀, Mistretta, IX.1938 (CGM); ♂, Mistretta, 14.IX.1938 (CGM); ♂, ♀, Madonie, 1200 m, 9.IX (CGM); 2♂, Madonie, Mandria del Conte, 1300 m, 18.IX.1993, leg. N. Grillo (CMP, CGM); 2♂, Bosco di Malabotta, 1320m, 2.X.07, leg. Infusino (CREA-FL). Diagnosis. Lemonia italiana is an Italian and Sicilian species. It has a 2.98% gap analysis distance from L. taraxaci and 3.30% from L. sibirica (Fig. 115). Externally and morphologically variable, no reliable characters were found to distinguish it from closely related species. Description. Male habitus (Figs 24–31). Antenna orange, flagellum apically covered with black scales. Head and thorax orange. Forewing length: 20–24 mm; wingspan: 43–46 mm. Wing somewhat triangular, external margin rounded and smooth, apex obtuse. Coloration ranges from pale to yolk yellow and may saturate towards the external margin. Cilia is wing color. Discal mark a small dark brown dot or lunule-shaped spot on the outer margin of the cell. Hindwing follows the same coloration as forewing. Cilia is of the same color as the wing. Abdomen black dorsally, the yellow interspace between abdominal segments may appear (Fig. 30), laterally orange, and ventrally yellow. Femur yellow, tibia of fore and middle legs speckled yellow and black, tibia of hind leg yellow, tarsi black. The tibial spur formula is 0-2-2, epiphysis absent (Figs 97–98). Male genitalia (Fig. 54). Tegumen somewhat triangular, widening basally. Socii membranous, covered with short chaetae. Uncus elongated, varies in width and length but always bifurcated apically and with isthmus near its base, covered with chaetae (Figs 67–73). Gnathos short, rounded, spatula-like with an uneven surface, a narrow subanal plate going from it towards the anal opening. Vinculum narrow, band-like. Valvae elongated, rounded, covered with chaetae, the ventral lateral margin may be convex or concave; sacculus weakly pronounced. Juxta boat-like pointed apically, widened basally, surrounds aedeagus. Aedeagus elongated, narrow, and c-shaped. Vesica small, elongated, and bag-shaped. Eighth sternum small, somewhat triangular, apically rounded, and varies in shape. Eighth tergum trapezoid not modified. Female habitus (Fig. 31). Forewing length: 24 mm; wingspan 48 mm. Fore and hind wing coloration pale yellow. Female genitalia not studied. Etymology. We dedicate the species not to the Italian territory, which also includes Sicily, but to the Italian language and culture that we all admire. Distribution (Fig. 114). The Italian Peninsula southwards of the Po Valley to Sicily, the northeast border is somewhere between the Alps and the Apennines. Earlier recorded as L. taraxaci by Grünberg, 1913; Mariani, 1941; Rougeot, 1971; Teobaldelli, 1976; Prola et al., 1978; de Freina & Witt, 1987; Bertaccini et al., 1994; Sciarretta & Parenzan, 1998; Sciarretta & Zahm, 2002; Parenzan & Porcelli, 2006; Sciarretta et al., 2008; Pinzari et al., 2010; Antoshin & Zolotuhin, 2011; Zerunian & Zilli, 2014, Infusino & Scalercio, 2018; Scalercio & Greco, 2018; Scalercio, 2020; Scalercio et al., 2022. Biology (Figs 116–118). Ecologically the species is related to the following regions (Dinerstein et al., 2017): Italian sclerophyllous and semi-deciduous forests, Apennine deciduous montane forests, Tyrrhenian-Adriatic sclerophyllous and mixed forests, and South Apennine mixed montane forests. It inhabits heights from 55 (Fiume Crati, Tarsia, 39.6086° N, 16.2713° E) up to 2200 m (Monte Pollino, 39.907° N, 16.18886° E) above sea level. Adults were collected from August to October. Taxonomic note. Antoshin and Zolotuhin (2011: 15) mentioned a series of paratypes of Lemonia taraxaci f. abluta Dannehl deposited in ZSM. Adults were collected in Italy, Umbria, Montagna Grande, 42.8469° N, 12.87161° E – a location within the new species distribution area. Neither we nor Antoshin and Zolotuhin found the name in the available literature, so we treat the name abluta as nomen nudum., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Volkova, Julia S., Yakovlev, Roman V., Nedoshivina, Svetlana V., Pinzari, Manuela, Pinzari, Mario, Scalercio, Stefano, Bianco, Giovanni, Saldaitis, Aidas, Hausmann, Axel, Revay, Edita E. & Müller, Günter C., 2022, Revision of the Lemonia taraxaci complex, with a description of a new species from Italy and clarification of the status of Lemonia strigata (Lepidoptera Brahmaeidae: Lemoniinae), pp. 337-360 in Zootaxa 5195 (4) on pages 343-345, DOI: 10.11646/zootaxa.5195.4.2, http://zenodo.org/record/7192987, {"references":["Grunberg, K. (1913) 8. Family: Lemoniidae. In: Seitz, A. (Ed.), The Macrolepidoptera of the World. Vol. 2. Alfred Kernen, Stuttgart, pp. 181 - 183.","Mariani, M. (1941) Fauna Lepidopterorum Italiae. Parte I. Catalogo ragionato dei Lepidotteri d'Italia. Giornale di Scienze Naturali ed Economiche, XLII, 1 - 236.","Rougeot, P. - C. (1971) Les Bombycoides (Lepidoptera-Bombycoidea) de l'Europe et du Bassin Mediterraneen 5. Tome I. Lemoniidae, Bombycidae, Brahmaeidae, Attacidae, Endromididae. Masson et Cie Editeurs, Paris, 159 pр.","Teobaldelli, A. (1976) I Macrolepidotteri del Maceratese e dei Monti Sibillini (Appennino Umbro-Marchigiano). Note ed appunti sperimentali di entomologia agraria, XVI, 81 - 346.","Prola, C., Provera, P., Racheli, T. & Sbordoni, V. (1978) I macrolepidotteri dell'Appennino Centrale. Parte I. Diurna, Bombyces e Sphinges. Fragmenta Entomologica, 14, 1 - 217.","de Freina, J. & Witt, T. (1987) Die Bombyces und Sphinges der Westpalaearctis. Vol. I. Edition Forschung & Wissenschaft Verlag GmbH, Munchen, 708 pp.","Bertaccini, E., Fiumi, G. & Provera, P. (1994) Bombici e Sfingi d'Italia (Lepidoptera Heterocera). Vol. 1. Natura-Giuliano Russo Editore (BO), Monterenzio, 248 pp.","Sciarretta, A. & Parenzan, P. (1998) Contributo alla conoscenza della Macrolepidotterofauna del Molise - Bombyces et Sphinges (Heterocera). Entomologica, 32, 81 - 107.","Sciarretta, A. & Zahm, N. (2002) Macrolepidotteri dell' \" Abetina di Rosello \" (Abruzzo) con note faunistiche, biogeografiche ed ecologiche. Phytophaga, XII, 25 - 42.","Parenzan, P. & Porcelli, F. (2006) I macrolepidotteri italiani. Phytophaga, XV, 1 - 1051.","Sciarretta, A., Petti, M., Alessandroni, A. & Loy, A. (2008) Diversita e ricchezza faunistica delle comunita di Macrolepidotteri nell'Oasi Naturale WWF di Guardiaregia-Campochiaro (Monti del Matese, Molise). Bollettino di Zoologia Agraria e di Bachicoltura, Series II, 40 (1), 51 - 73.","Pinzari, M., Pinzari, M. & Zilli A. (2010) Deep lepidopterological exploration of Mt Cagno and surroundings (Central Italy), a restricted mountain massif and hotspot for butterfly and moth diversity (Lepidoptera). Bollettino dell'Associazione Romana di Entomologia, 65 (1 - 4), 3 - 383.","Antoshin, D. A. & Zolotuhin, V. V. (2011) Lemonia strigata Rougeot et Viette, 1978, stat. n., and L. ballioni (Christoph, 1888) (Lepidoptera: Lemoniidae) in a fauna of Europe with taxonomic notes on related species and description of a new subspecies. Eversmannia, 25 - 26, 9 - 24.","Zerunian, Z. & Zilli, A. (2014) The Macrolepidoptera of Mt Subasio (Umbria, Central Italy). In: Zilli, A. (Ed.), Lepidoptera research in areas with high biodiversity potential in Italy, Volume 1. Natura Edizioni Scientifiche, Bologna, pp. 1 - 104.","Infusino, M. & Scalercio, S. (2018) The importance of beech forests as reservoirs of moth diversity in Mediterranean Basin (Lepidoptera). Fragmenta entomologica, 50 (2), 161 - 169.","Scalercio, S. & Greco, S. (2018) Heterocera fauna of the Calabrian black pine forest, Sila Massif (Italy) (Insecta: Lepidoptera). SHILAP Revista de lepidopterologia, 46 (183), 455 - 472.","Scalercio, S. (2020) Macroheterocera of a mixed Calabrian black pine - European beech forest of Sila Mountains (Italy) (Insecta: Lepidoptera). SHILAP Revista de lepidopterologia, 48 (192), 651 - 669.","Scalercio, S., Di Marco, C. & Puletti N. (2022) A georeferenced dataset of nocturnal macrolepidoptera: a tool for forest management and biodiversity conservation. Data in Brief, 41, 107882. https: // doi. org / 10.1016 / j. dib. 2022.107882","Dinerstein, E., Olson, D., Joshi, A., Vynne, C., Burgess, N. D., Wikramanayake, E., Hahn, N., Palminteri, S., Hedao, P., Noss, R., Hansen, M., Locke, H., Ellis, E. C., Jones, B., Barber, C. V., Hayes, R., Kormos, C., Martin, V., Crist, E., Sechrest, W., Price, L., Baillie, J. E. M., Weeden, D., Suckling, K., Davis, C., Sizer, N., Moore, R., Thau, D., Birch, T., Potapov, P., Turubanova, S., Tyukavina, A., De Souza, N., Pintea, L., Brito, J. C., Llewellyn, O. A., Miller, A. G., Patzelt, A., Ghazanfar, S. A., Timberlake, J., Kloser, H., Shennan-Farpon, Y., Kindt, R., Barnekow Lilleso, J. - P., Van Breugel, P., Graudal, L., Voge, M., Al-Shammari, K. F. & Saleem, M. (2017) An Ecoregion-Based Approach to Protecting Half the Terrestrial Realm. BioScience, 1 (6), 1 - 12. https: // doi. org / 10.1093 / biosci / bix 014"]}

Yakovlev, R.V., de Vos, R., Hulsbosch, R. (2022): New genus of the family Ratardidae (Lepidoptera: Cossoidea) from New Guinea. Far Eastern Entomologist 452: 1-6, DOI: 10.25221/fee.452.1, URL: http://dx.doi.org/10.25221/fee.452.1

Rhynchobombyx anthonychristophereaton Prozorov, Saldaitis & Müller sp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: FB9E4BCD-8CE5-4DB9-A769-5475B212D20C (Figs 31–36, 50–51) Type material: HOLOTYPE ♂, DRC, [Kasaï Prov.] Kasaï- Occidental Prov., NE Ilebo and Kasai River, XI.1997, genitalia slide 0636 (CGM / BUM). PARATYPES (13♂ total): 11♂, data as for holotype but collected during X–XII.1997, genitalia slides 0635, 0637 (CGM / BUM); DRC: 2♂, Mai- Ndombe Prov., Ekongo camp, 02°45’23.09”S, 20°18’55.37”E, II.2017, leg. A. & T. Prozorovs, V. Kravchenko et al. (CGM / BUM). Diagnosis. Externally the species differs from the others by forewing concavity between CuA 2 and 1A like in Rh. nicolasroberteaton, but lighter colored. Description. Male habitus (Figs 31–33). Head and thorax reddish orange, abdomen yellow. Thorax dorsally bears triangular dark brown spot with pale center; dark brown line goes from the spot towards dark brown palpi. Forewing length: 14–15 mm; wingspan: 29–31 mm. Wing oval-shaped, apex obtuse, external margin slightly waved with concavity between CuA 2 and 1A. Background color uniform orange, cilia brown. Pattern consists of dark brown antemedial, postmedial and faded external crenulate lines, lunules between R 4, R 5, M 1 and M 2; blackish discal dot on R-Cu cell outer margin. Hindwing oval-shaped, external margin rounded, slightly waved. Main color from yellow to orangish yellow, costal and tornal fields darker brownish. Cilia brown. Male genitalia (Figs 34–36). Tegumen band-shaped, bears two short projections with blunt apexes and covered with chaetae along. Vinculum thin, ventrally widened into cup-like form. Sacculus elongated, finger-shaped with blunt apex. Cucullus tuber-like, covered with chaetae. Juxta a tiny plate fused with aedeagus. Aedeagus cylindrical with uneven dorsal sclerotized field right by vesica and ventral c-shaped basal spur with blunt apex. Vesica bag-shaped with two chambers: smaller lateral and bigger main, both covered with tiny denticles. Female remains unknown, expected to be bigger and darker than male. Etymology. The species is named in honour of Anthony Christopher Eaton (East Providence, Rhode Island, USA). Anthony Christopher is nature and sports enthusiast, especially wrestling. Distribution. The species is found in two locations in DRC, Kasaï and Mai- Ndombe Province (Figs 47–48). Biology. Adults were observed and collected from September to December and in February. The only known habitat is tropical moist broadleaf forests with rare mosaic grassland patches, the elevation is around 100 m above sea-level. Two paratype males were collected on the border between forest and grassland in an area of one hectare using an auto-trap (Figs 53–55). The larval foodplant remains unknown., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Mapilanga, Jean Joseph, Volkova, Julia S., Yakovlev, Roman V., Traore, Mohamed M., Saldaitis, Aidas & Müller, Günter C., 2021, Seven new species of Rhynchobombyx Aurivillius, 1909 from Congolian lowland forests (Lepidoptera: Lasiocampidae), pp. 35-53 in Ecologica Montenegrina 49 on pages 44-45, DOI: 10.37828/em.2021.49.3, http://zenodo.org/record/8044124

Rhynchobombyx gavinfilippone Prozorov, Saldaitis & Müller sp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: 44E768CA-284E-4BE3-8B01-4A8A4C1E2D5E (Figs 12–16, 48) Type material: HOLOTYPE ♂, DRC, [Haut-Uele Prov., Isiro] Uele: Paulis, 1.VIII.1959, genitalia slide GU 2011-167 (RMCA). PARATYPES: 3♂♂, data as for holotype but collected in 5.III.1957, 1.VIII.1959, 3.X.1959, genitalia slides GU 2011-154, GU 2011-155, GU 2011-158 (RMCA). Diagnosis. Externally the species resembles Rh. avadomenicarocchio and Rh. anthonychristophereaton but without forewing concavity between CuA 2 and 1A and vesica bears cornutus in male genitalia. Description. Male habitus (Figs 12–14). Head and thorax orangish, abdomen yellowish. Thorax dorsally bears triangular dark brown spot with pale center. Forewing length: 13–14 mm; wingspan: 28 mm. Wing oval-shaped, apex obtuse, external margin slightly waved. Background color uniform orangish, cilia darker brownish orange. Pattern consists of multiplied dark brown antemedial, postmedial and external crenulate lines, lunules between R 3, R 4, R 5 and M 1; blackish discal dot on R-Cu cell outer margin. Hindwing oval-shaped, external margin rounded, slightly waved. Main color from yellowish to orangish, costal and tornal fields darker brownish orange. Cilia brownish orange. Male genitalia (Figs 15–16). Tegumen band-shaped, bears two short projections with bent, sharpened apexes and covered with chaetae along. Vinculum thin, ventrally widened into cup-like form. Sacculus elongated, finger-shaped with blunt apex. Cucullus tuber-like, covered with chaetae. Juxta a tiny plate fused with aedeagus. Aedeagus cylindrical with uneven dorsal sclerotized field, right by vesica and ventral c-shaped basal spur with nearly pointed apex. Vesica bag-shaped with two chambers: smaller lateral and larger main, both covered with tiny denticles; main one bears claw-like cornutus with medial fossa along it that makes it look like it consists of pair of fused cornuti. Female remains unknown, expected to be bigger and darker than male. Etymology. The species is named in honour of Gavin Filippone (Pedricktown, New Jersey, USA). Gavin loves and collects insects, he watches programs to expand his knowledge of animals, reptiles and insects. Distribution. The species is found in DRC, Haut-Uele Province (Fig. 48). Biology. Adults were collected in August, October and March. The only known habitat is tropical moist broadleaf forests with rare mosaic grassland patches, the elevation is around 800 m above sea-level. The larval foodplant remains unknown.

Rhynchobombyx madisonellafriend Prozorov, Saldaitis & Müller sp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: 811929C3-6546-46C9-87D0-71133845E04E (Figs 45–46, 51) Type material: HOLOTYPE ♀, DRC, [Kasaï Prov.] Kasaï- Occidental Prov., NE Ilebo and Kasai River, XI.1997, genitalia slide 0630 (CGM / BUM). Diagnosis. Externally the species differs from the others by dark smooth blurred medial lines. Description. Female habitus (Fig. 45). Head, thorax and abdomen brown. Thorax dorsally bears triangular dark brown spot with pale center. Forewing length: 15 mm; wingspan: 31 mm. Wing oval-shaped, apex obtuse, external margin slightly waved. Background color reddish brown, darkens between medial lines around lighter eye with blackish discal dot, external field darker too. Pattern consists of dark brown smooth blurred antemedial and postmedial lines, dark brown fragmented external line. Cilia brown. Hindwing oval-shaped, external margin rounded, waved. Main color brown, darkens caudally; pronounced darker blurred medial line. Cilia brown. Female genitalia (Fig. 46). Papillae anales oval, densely covered with chaetae. Posterior apophyses little longer than anterior. Lamella antevaginalis membranous, lamella postvaginalis sclerotized, laterally thinned. Ductus bursae about one third size of corpus bursae, wrinkled, laterally sclerotized. Corpus bursae elongated, membranous, wrinkled. Male remains unknown, expected to be smaller and lighter than female. Etymology. The species is named in honour of Madison Ella Friend (Merrick, New York, USA). Madison Ella is nature lover and talented dancer and gymnast. She is creative and makes own clothes and jewelry. Distribution. The species is found in DRC, Kasaï Province (Fig. 51). Biology. Adult was collected in November. The only known habitat is tropical moist broadleaf forests with rare mosaic grassland patches (Figs 53–55), the elevation is around 100 m above sea-level. The larval foodplant remains unknown., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Mapilanga, Jean Joseph, Volkova, Julia S., Yakovlev, Roman V., Traore, Mohamed M., Saldaitis, Aidas & Müller, Günter C., 2021, Seven new species of Rhynchobombyx Aurivillius, 1909 from Congolian lowland forests (Lepidoptera: Lasiocampidae), pp. 35-53 in Ecologica Montenegrina 49 on pages 49-50, DOI: 10.37828/em.2021.49.3, http://zenodo.org/record/8044124

Rhynchobombyx nicolasroberteaton Prozorov, Saldaitis & Müller sp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: 8B4CE762-457F-4830-860B-701219A57867 (Figs 37–42, 50–51) Type material: HOLOTYPE ♂, DRC, [Kasaï Prov.] Kasaï- Occidental Prov., NE Ilebo and Kasai River, XI.1997, genitalia slide 0634 (CGM / BUM). PARATYPES (10♂ total): 9♂, data as for holotype but collected in XII and II.1997, genitalia slides 0632, 0633 (CGM / BUM); DRC: 1♂, Mai- Ndombe Prov., Ekongo camp, 02°45’23.09”S, 20°18’55.37”E, XI.2017, leg. A. & T. Prozorovs, V. Kravchenko et al. (CGM / BUM). Diagnosis. Externally the species darker than the others, resembles Rh. julianjameseaton, but with forewing concavity between CuA 2 and 1A. Description. Male habitus (Figs 37–39). Head, thorax and abdomen brown. Thorax bears dorsal triangular dark brown spot with pale center; dark brown line goes from the spot towards head. Forewing length: 14–15 mm; wingspan: 29–31 mm. Wing oval-shaped, apex obtuse, external margin slightly waved with concavity between CuA 2 and 1A. Pattern marmorate, orangish brown and brown with multiplied light and dark antemedial, postmedial and external crenulate lines; and blackish discal dot on R-Cu cell outer margin. Cilia brown. Hindwing oval-shaped, external margin rounded, slightly waved. Main color yellowish or reddish brown, darkens caudally. Cilia brown. Male genitalia (Figs 40–42). Tegumen band-shaped, bears two short projections with sharpen apexes and covered with chaetae along. Vinculum thin, ventrally widened into cup-like form. Sacculus elongated, finger-shaped with blunt apex. Cucullus tuber-like, covered with chaetae. Juxta a tiny plate fused with aedeagus. Aedeagus cylindrical with small uneven dorsal sclerotized field right by vesica and ventral c-shaped long basal spur with blunt apex. Vesica bag-shaped with two chambers: smaller lateral and bigger main, both covered with tiny denticles; main one bears cornutus formed by several fused smaller cornuti. Female remains unknown, expected to be bigger and darker than male. Etymology. The species is named in honour of Nicolas Robert Eaton (East Providence, Rhode Island, USA). Nicolas Robert is nature and sports enthusiast, especially baseball. Soon to be published author and rap music composer. Distribution. The species is found in two locations in DRC, Kasaï and Mai- Ndombe Province (Figs 50–51). Biology. Adults were observed and collected in November, December and February. The only known habitat is tropical moist broadleaf forests with rare mosaic grassland patches, the elevation is around 100 m above sea-level. One paratype male was collected on the border between forest and grassland in an area of one hectare using an auto-trap (Figs 53–55). The larval foodplant remains unknown., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Mapilanga, Jean Joseph, Volkova, Julia S., Yakovlev, Roman V., Traore, Mohamed M., Saldaitis, Aidas & Müller, Günter C., 2021, Seven new species of Rhynchobombyx Aurivillius, 1909 from Congolian lowland forests (Lepidoptera: Lasiocampidae), pp. 35-53 in Ecologica Montenegrina 49 on page 46, DOI: 10.37828/em.2021.49.3, http://zenodo.org/record/8044124

Rhynchobombyx anthonychristophereaton Prozorov, Saldaitis & Müller sp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: FB9E4BCD-8CE5-4DB9-A769-5475B212D20C (Figs 31–36, 50–51) Type material: HOLOTYPE ♂, DRC, [Kasaï Prov.] Kasaï- Occidental Prov., NE Ilebo and Kasai River, XI.1997, genitalia slide 0636 (CGM / BUM). PARATYPES (13♂ total): 11♂, data as for holotype but collected during X–XII.1997, genitalia slides 0635, 0637 (CGM / BUM); DRC: 2♂, Mai- Ndombe Prov., Ekongo camp, 02°45’23.09”S, 20°18’55.37”E, II.2017, leg. A. & T. Prozorovs, V. Kravchenko et al. (CGM / BUM). Diagnosis. Externally the species differs from the others by forewing concavity between CuA 2 and 1A like in Rh. nicolasroberteaton, but lighter colored. Description. Male habitus (Figs 31–33). Head and thorax reddish orange, abdomen yellow. Thorax dorsally bears triangular dark brown spot with pale center; dark brown line goes from the spot towards dark brown palpi. Forewing length: 14–15 mm; wingspan: 29–31 mm. Wing oval-shaped, apex obtuse, external margin slightly waved with concavity between CuA 2 and 1A. Background color uniform orange, cilia brown. Pattern consists of dark brown antemedial, postmedial and faded external crenulate lines, lunules between R 4, R 5, M 1 and M 2; blackish discal dot on R-Cu cell outer margin. Hindwing oval-shaped, external margin rounded, slightly waved. Main color from yellow to orangish yellow, costal and tornal fields darker brownish. Cilia brown. Male genitalia (Figs 34–36). Tegumen band-shaped, bears two short projections with blunt apexes and covered with chaetae along. Vinculum thin, ventrally widened into cup-like form. Sacculus elongated, finger-shaped with blunt apex. Cucullus tuber-like, covered with chaetae. Juxta a tiny plate fused with aedeagus. Aedeagus cylindrical with uneven dorsal sclerotized field right by vesica and ventral c-shaped basal spur with blunt apex. Vesica bag-shaped with two chambers: smaller lateral and bigger main, both covered with tiny denticles. Female remains unknown, expected to be bigger and darker than male. Etymology. The species is named in honour of Anthony Christopher Eaton (East Providence, Rhode Island, USA). Anthony Christopher is nature and sports enthusiast, especially wrestling. Distribution. The species is found in two locations in DRC, Kasaï and Mai- Ndombe Province (Figs 47–48). Biology. Adults were observed and collected from September to December and in February. The only known habitat is tropical moist broadleaf forests with rare mosaic grassland patches, the elevation is around 100 m above sea-level. Two paratype males were collected on the border between forest and grassland in an area of one hectare using an auto-trap (Figs 53–55). The larval foodplant remains unknown.

Rhynchobombyx julianjameseaton Prozorov, Saldaitis & Müller sp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: F2F0E302-E884-4BB3-8F15-8CF25788 AD 7E (Figs 23–30, 47, 50–51) Type material: HOLOTYPE ♂, DRC, [Kasaï Prov.] Kasaï- Occidental Prov., NE Ilebo and Kasai River, XI.1997, genitalia slide 0620 (CGM / BUM). PARATYPES (20♂, 1♀ total): 16♂, 1♀, data as for holotype but collected in X, XI, XII, I, III, V.1997, genitalia slides 0621–0624, 0759 (CGM / BUM); DRC: 2♂, Mai- Ndombe Prov., Ekongo camp, 02°45’23.09”S, 20°18’55.37”E, XII.2017, leg. A. & T. Prozorovs, V. Kravchenko et al. (CGM / BUM); Congo: 2♂, [Cuvette- Ouest Dept.], Odzala Nat. Park, 400–500 m, 0°23’N, 14°50’E, 29.I–3.III.1997, leg. V. Siniaev, S. Murzin, genitalia slides 17.471, 17.472 (MWM / ZSM). Diagnosis. Externally the species darker than the others, resembles Rh. nicolasroberteaton, but without forewing concavity between CuA 2 and 1A. Description. Male habitus (Figs 23, 25). Head and thorax brown to dark brown, abdomen from yellow to brown. Forewing length: 13–14 mm; wingspan: 30–31 mm. Wing oval-shaped, apex obtuse, external margin slightly waved. Pattern consists of lighter orangish brown to brown antemedial and postmedial fields and darker brown medial and external fields; multiplied light and dark antemedial, postmedial and external crenulate lines; and blackish discal dot on R-Cu cell outer margin. Cilia brown. Some males’ pattern fades. Hindwing oval-shaped, external margin rounded, slightly waved. Main color from yellow to brown, costal and anal fields darker. Cilia brown. Male genitalia (Figs 26–29). Tegumen band-shaped, bears two short projections with bifurcated apexes and covered with chaetae along. Vinculum thin, ventrally widened into cup-like form. Sacculus elongated, finger-shaped with blunt apex. Cucullus tuber-like, covered with chaetae. Juxta a tiny plate fused with aedeagus. Aedeagus cylindrical with uneven dorsal sclerotized field right by vesica and ventral c-shaped basal spur with nearly pointed apex. Vesica bag-shaped with two chambers: smaller lateral and bigger main, both covered with tiny denticles; main one bears claw-like cornutus with medial fossa that makes it look like it consists of pair of fused cornuti. Female habitus (Fig. 24). Forewing length: 17 mm; wingspan: 36 mm. Pattern similar to male, but hindwings darker. Female genitalia (Fig. 30). Papillae anales oval, densely covered with chaetae. Posterior apophyses 1.75 times longer than anterior. Lamella antevaginalis membranous, lamella postvaginalis sclerotized, mesally thinned. Ductus bursae about the size of corpus bursae, wrinkled, laterally sclerotized. Corpus bursae spherical, membranous, wrinkled. Etymology. The species is named in honour of Julian James Eaton (East Providence, Rhode Island, USA). Julian James is nature lover and sports enthusiast. He plays soccer and baseball and was accepted into his school soccer travel team. Distribution. The species is found in two locations in DRC, Kasaï and Mai- Ndombe Province, and in one location in Congo, Cuvette-Ouest Department (Figs 47, 50–51). Biology. Adults were observed and collected from October to January, in March and May. The only known habitat is tropical moist broadleaf forests with rare mosaic grassland patches, the elevation is around 100 m above sea-level in DRC and 500 m in Congo. Two paratype males were collected on the border between forest and grassland in an area of one hectare using an auto-trap (Figs 53–55). The larval foodplant remains unknown.

Rhynchobombyx julianjameseaton Prozorov, Saldaitis & Müller sp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: F2F0E302-E884-4BB3-8F15-8CF25788 AD 7E (Figs 23–30, 47, 50–51) Type material: HOLOTYPE ♂, DRC, [Kasaï Prov.] Kasaï- Occidental Prov., NE Ilebo and Kasai River, XI.1997, genitalia slide 0620 (CGM / BUM). PARATYPES (20♂, 1♀ total): 16♂, 1♀, data as for holotype but collected in X, XI, XII, I, III, V.1997, genitalia slides 0621–0624, 0759 (CGM / BUM); DRC: 2♂, Mai- Ndombe Prov., Ekongo camp, 02°45’23.09”S, 20°18’55.37”E, XII.2017, leg. A. & T. Prozorovs, V. Kravchenko et al. (CGM / BUM); Congo: 2♂, [Cuvette- Ouest Dept.], Odzala Nat. Park, 400–500 m, 0°23’N, 14°50’E, 29.I–3.III.1997, leg. V. Siniaev, S. Murzin, genitalia slides 17.471, 17.472 (MWM / ZSM). Diagnosis. Externally the species darker than the others, resembles Rh. nicolasroberteaton, but without forewing concavity between CuA 2 and 1A. Description. Male habitus (Figs 23, 25). Head and thorax brown to dark brown, abdomen from yellow to brown. Forewing length: 13–14 mm; wingspan: 30–31 mm. Wing oval-shaped, apex obtuse, external margin slightly waved. Pattern consists of lighter orangish brown to brown antemedial and postmedial fields and darker brown medial and external fields; multiplied light and dark antemedial, postmedial and external crenulate lines; and blackish discal dot on R-Cu cell outer margin. Cilia brown. Some males’ pattern fades. Hindwing oval-shaped, external margin rounded, slightly waved. Main color from yellow to brown, costal and anal fields darker. Cilia brown. Male genitalia (Figs 26–29). Tegumen band-shaped, bears two short projections with bifurcated apexes and covered with chaetae along. Vinculum thin, ventrally widened into cup-like form. Sacculus elongated, finger-shaped with blunt apex. Cucullus tuber-like, covered with chaetae. Juxta a tiny plate fused with aedeagus. Aedeagus cylindrical with uneven dorsal sclerotized field right by vesica and ventral c-shaped basal spur with nearly pointed apex. Vesica bag-shaped with two chambers: smaller lateral and bigger main, both covered with tiny denticles; main one bears claw-like cornutus with medial fossa that makes it look like it consists of pair of fused cornuti. Female habitus (Fig. 24). Forewing length: 17 mm; wingspan: 36 mm. Pattern similar to male, but hindwings darker. Female genitalia (Fig. 30). Papillae anales oval, densely covered with chaetae. Posterior apophyses 1.75 times longer than anterior. Lamella antevaginalis membranous, lamella postvaginalis sclerotized, mesally thinned. Ductus bursae about the size of corpus bursae, wrinkled, laterally sclerotized. Corpus bursae spherical, membranous, wrinkled. Etymology. The species is named in honour of Julian James Eaton (East Providence, Rhode Island, USA). Julian James is nature lover and sports enthusiast. He plays soccer and baseball and was accepted into his school soccer travel team. Distribution. The species is found in two locations in DRC, Kasaï and Mai- Ndombe Province, and in one location in Congo, Cuvette-Ouest Department (Figs 47, 50–51). Biology. Adults were observed and collected from October to January, in March and May. The only known habitat is tropical moist broadleaf forests with rare mosaic grassland patches, the elevation is around 100 m above sea-level in DRC and 500 m in Congo. Two paratype males were collected on the border between forest and grassland in an area of one hectare using an auto-trap (Figs 53–55). The larval foodplant remains unknown., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Mapilanga, Jean Joseph, Volkova, Julia S., Yakovlev, Roman V., Traore, Mohamed M., Saldaitis, Aidas & Müller, Günter C., 2021, Seven new species of Rhynchobombyx Aurivillius, 1909 from Congolian lowland forests (Lepidoptera: Lasiocampidae), pp. 35-53 in Ecologica Montenegrina 49 on pages 42-44, DOI: 10.37828/em.2021.49.3, http://zenodo.org/record/8044124

Rhynchobombyx nasuta Aurivillius, 1909 (Figs 1–11, 47, 49–52) Rhynchobombyx nasuta Aurivillius, 1909, Arkiv för Zoologi 5(5): 26. Type locality: [DRC, Tshuapa Prov., Lomela River, Gombe-Isongo] Gombi. Lectotype male (RBINS), here designated. Type material examined. LECTOTYPE ♂, DRC, [Tshuapa Prov., Lomela River, Gombe-Isongo] Gombi, 13.XII.1906, leg. M. Waelbroeck, genitalia slide GU 2008-10 (RBINS); PARALECTOTYPE ♂, [DRC?] “Congo”, [unintelligibly], [18]91, genitalia slide RMprep 9968 (SNHM). Additional material examined. 29♂, DRC, [Kasaï Prov.] Kasaï- Occidental Prov., NE Ilebo and Kasai River, X–XII.1997, genitalia slide 0639–0640 (CGM / BUM); 4♂, DRC, Mai-Ndombe Prov., Ekongo camp, 02°45’23.09”S, 20°18’55.37”E, XI.2017, leg. A. & T. Prozorovs, V. Kravchenko et al. (CGM / BUM); 1♂, 1♀, Congo, [Cuvette-Ouest Dept.], Odzala Nat. Park, 400–500 m, 0°23’N, 14°50’E, 29.I–3.III.1997, leg. V. Siniaev, S. Murzin, genitalia slide 17.473 (ZSM / MWM); ♂, Angola, Benguela Prov., rd. Londengo–Sumbe, ca. 80 km S Sumbe, 10 km rd. to Bumba, 280 m, 11°47’33.1”S, 14°02’17.4”E, 18.XI.2017, leg. S. Naumann, E. Ott & H. Sulak, genitalia slide 0629 (CGM / BUM). Diagnosis. Forewing coloration brown and orange, not uniform like Rh. gavinfilippone, Rh. avadomenicarocchio, Rh. anthonychristophereaton, generally lighter than Rh. julianjameseaton, but adults are darker (Fig. 8) reminiscent of the lighter ones of Rh. julianjameseaton (Fig. 25), although vesica doesn’t bear cornutus. Medial lines not smooth like in Rh. arijakefriend or Rh. madisonellafriend but crenulated. Taxonomic notes. Aurivillius described the species after two males: one from Brussels museum, another from Émile Seeldrayers’ collection. The first one deposited in RBINS was studied and labeled a lectotype by Vadim Zolotuhin and Alexander Gurkovich back in 2008 and consequently suggested to be a valid lectotype (De Prins & De Prins, 2011 –2021), although no formal publication of the nomenclatorial act was followed. The male is clearly a syntype, it bears the label location of “Gombi | 13–12–06” and a collector “Waelbroeck,” both were mentioned in the original description. So, here we designate it a lectotype of Rh. nasuta, figure the specimen (Fig. 3), labels (Fig. 1) and its genitalia (Fig. 9). The second syntype male, deposited in SNHM, was studied by Zolotuhin and Gurkovich as well, herein we designate it a paralectotype and figure it as well (Figs 2, 5). We did not find the location of “Congogebiet: Gombi,” so we tried to investigate the details. Interestingly enough we found spelling “Gombi” only in Aurivillius’ article: for Rh. nasuta collected on “13–12–06” and Pachypasa nigrescens Aurivillius, 1909 collected on “13–12–03.” The variation “Gombe” or “Gombé” together with “Lomela” as M. Waelbroeck’s collecting area appeared in 6 other publications (Cameron, 1912; Lestage, 1918; Schouteden, 1918; Schouteden, 1920; Strand, 1912b and Strand, 1918). Lomela is a tributary of the Busira River, both belong to the Congo basin – “Congogebiet” mentioned in the original description. Busira was also listed many times as Waelbroeck’s collecting area (for example in Schouteden, 1918). Surcouf mentioned that Waelbroeck was “on the steamer ‘Président Urban’ in Bussira on October 15 th, 1905 ” (Surcouf, 1911), and he was in Gombe not long before on October 6 th, 1905 (Strand, 1912b). We suggest that Gombi is only a misspelling of Gombe which is somewhere along Lomela. The only “Gombe” we found is Gombe- Isongo about 125 km away from the Lomela’s mouth to Busira (Fig. 49), assuming it is the correct area, we therefore designate it as the type locality for Rh. nasuta and Ch. nigrescens. Even though the characteristics of the typical Rh. nasuta are clear to us, we prefer to postpone the species detailed redescription for the forthcoming article when the relationship of dark forms from Angola (Fig. 8) and the DRC is clarified and more rarely occurring females are studied. We also would like to additionally describe the genus characters like chorionic sculpture of egg and chaetotaxy of first instar larva recently collected in DRC, head, legs and wing venation with discussion of the genus position within Lasiocampidae., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Mapilanga, Jean Joseph, Volkova, Julia S., Yakovlev, Roman V., Traore, Mohamed M., Saldaitis, Aidas & Müller, Günter C., 2021, Seven new species of Rhynchobombyx Aurivillius, 1909 from Congolian lowland forests (Lepidoptera: Lasiocampidae), pp. 35-53 in Ecologica Montenegrina 49 on pages 36-39, DOI: 10.37828/em.2021.49.3, http://zenodo.org/record/8044124, {"references":["Aurivillius C. (1909) Diagnosen neuer Lepidopteren aus Afrika 9. Arkiv for Zoologi, 5 (5), 1 - 29.","De Prins J. & De Prins W. 2011 - 2021. Afromoths, online database of Afrotropical moth species (Lepidoptera). Available from: http: // www. afromoths. net [accessed 10. XII. 2021].","Cameron, P. (1912) On the Hymenoptera from Belgian Congo in the Congo Museum, Tervueren. Annales de la Societe entomologique de Belgique, 56, 357 - 401.","Lestage, J. - A. (1918) Les Ephemeres d'Afrique (notes critiques sur les especes connues). Revue zoologique africaine, 6, 65 - 114.","Schouteden, H. (1918) Contribution a la faune des Acraeides du Congo Belge. I. - Genre Acraea Fabr. Revue zoologique africaine, 6, 145 - 162.","Schouteden, H. (1920) Prionides du Congo Belge des collections du Musee du Congo. Revue zoologique africaine, 8, 121 - 126.","Strand, E. (1912 b) Lepidoptera aus dem begischen Kongo. Archiv fur Naturgeschichte, 78 (12), 89 - 100.","Strand, E. (1918) Ueber einige Heterocera der Familien Arctiidae, Lymantriidae, Geometridae, Saturniidae, Lasiocampidae, Pyralididae und Aegeriidae aus Belgisch Kongo. Entomologische Rundschau, 35 (7 - 12), 28, 32, 35 - 36, 42, 45 - 46.","Surcouf, J. R. M. (1911) Note sur les tabanides du Congo Belge des Musees de Bruxelles et de Tervueren. Revue zoologique africaine, 1, 22 - 37."]}

Rhynchobombyx avadomenicarocchio Prozorov, Saldaitis & Müller sp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: BB530F5C-24E3-427E-A3DF-81B7AC8DC244 (Figs 17–22, 50–51) Type material: HOLOTYPE ♂, DRC, [Kasaï Prov.] Kasaï- Occidental Prov., NE Ilebo and Kasai River, XI.1997, genitalia slide 0615 (CGM / BUM). PARATYPES (28♂, 1♀ total): 24♂, 1♀ data as for holotype but collected in IX–II, V, VI.1997, genitalia slides 0616–0619 (CGM / BUM); DRC: 4♂, Mai- Ndombe Prov., Ekongo camp, 02°45’23.09”S, 20°18’55.37”E, XI.2017, leg. A. & T. Prozorovs, V. Kravchenko et al. (CGM / BUM). Diagnosis. Externally the species resembles Rh. gavinfilippone and Rh. anthonychristophereaton but darker colored, without forewing concavity between CuA 2 and 1A and vesica doesn’t bear cornutus in male genitalia. Description. Male habitus (Figs 17, 19). Head and thorax orangish brown, abdomen from yellow to yellowish brown. Thorax bears dorsal triangular dark brown spot with pale center. Forewing length: 12–13 mm; wingspan: 26–27 mm. Wing oval-shaped, apex obtuse, external margin smooth. Background color uniform orangish brown, only darkens towards the external margin until it is dark brown between R 3, R 4, R 5 and M 1. Pattern consists of dark brown antemedial, postmedial and external crenulate lines also with blackish discal dot on R-Cu cell outer margin. Cilia orangish brown. Hindwing oval-shaped, external margin rounded, slightly waved. Main color yellowish, costal and tornal fields darker. Cilia brown. Male genitalia (Figs 20, 22). Tegumen band-shaped, bears two short projections with sharpened apexes and covered with chaetae along. Vinculum thin, ventrally widened into cup-like form. Sacculus elongated, finger-shaped with blunt apex. Cucullus tuber-like, covered with chaetae. Juxta a tiny plate fused with aedeagus. Aedeagus cylindrical with uneven dorsal sclerotized field right by vesica and ventral c-shaped basal spur with nearly pointed apex. Vesica bag-shaped with two chambers: smaller lateral and bigger main, both covered with tiny denticles; main one bears claw-like cornutus with medial fossa along that makes it looking like it consists of pair of fused cornuti. Female habitus (Fig. 18). Forewing length: 14 mm; wingspan: 30 mm. Pattern similar to male, but hindwings darker. Female genitalia (Fig. 21). Papillae anales spherical, densely covered with chaetae. Anterior and posterior apophyses nearly equal in length. Lamella antevaginalis membranous, lamella postvaginalis sclerotized. Ductus bursae uneven, wrinkled, inflated, sclerotized. Corpus bursae long, membranous, wrinkled, it’s cut and full length unknown. Etymology. The species is named in honour of Ava Domenica Rocchio (Staten Island, New York, USA). Ava Domenica loves nature and studies all insects and worms that she encounters. She wants to become an Entomologist. Distribution. The species is found in three locations in DRC, Kasaï and Mai- Ndombe Province (Figs 50– 51). Biology. Adults were observed and collected from September to February, also in May and June. The only known habitat is tropical moist broadleaf forests with rare mosaic grassland, the elevation is around 100 m above sea-level. Four paratype males were collected on the border between forest and grassland in an area of one hectare using an auto-trap (Figs 53–55). The larval foodplant remains unknown., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Mapilanga, Jean Joseph, Volkova, Julia S., Yakovlev, Roman V., Traore, Mohamed M., Saldaitis, Aidas & Müller, Günter C., 2021, Seven new species of Rhynchobombyx Aurivillius, 1909 from Congolian lowland forests (Lepidoptera: Lasiocampidae), pp. 35-53 in Ecologica Montenegrina 49 on pages 40-42, DOI: 10.37828/em.2021.49.3, http://zenodo.org/record/8044124

Rhynchobombyx gavinfilippone Prozorov, Saldaitis & Müller sp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: 44E768CA-284E-4BE3-8B01-4A8A4C1E2D5E (Figs 12–16, 48) Type material: HOLOTYPE ♂, DRC, [Haut-Uele Prov., Isiro] Uele: Paulis, 1.VIII.1959, genitalia slide GU 2011-167 (RMCA). PARATYPES: 3♂♂, data as for holotype but collected in 5.III.1957, 1.VIII.1959, 3.X.1959, genitalia slides GU 2011-154, GU 2011-155, GU 2011-158 (RMCA). Diagnosis. Externally the species resembles Rh. avadomenicarocchio and Rh. anthonychristophereaton but without forewing concavity between CuA 2 and 1A and vesica bears cornutus in male genitalia. Description. Male habitus (Figs 12–14). Head and thorax orangish, abdomen yellowish. Thorax dorsally bears triangular dark brown spot with pale center. Forewing length: 13–14 mm; wingspan: 28 mm. Wing oval-shaped, apex obtuse, external margin slightly waved. Background color uniform orangish, cilia darker brownish orange. Pattern consists of multiplied dark brown antemedial, postmedial and external crenulate lines, lunules between R 3, R 4, R 5 and M 1; blackish discal dot on R-Cu cell outer margin. Hindwing oval-shaped, external margin rounded, slightly waved. Main color from yellowish to orangish, costal and tornal fields darker brownish orange. Cilia brownish orange. Male genitalia (Figs 15–16). Tegumen band-shaped, bears two short projections with bent, sharpened apexes and covered with chaetae along. Vinculum thin, ventrally widened into cup-like form. Sacculus elongated, finger-shaped with blunt apex. Cucullus tuber-like, covered with chaetae. Juxta a tiny plate fused with aedeagus. Aedeagus cylindrical with uneven dorsal sclerotized field, right by vesica and ventral c-shaped basal spur with nearly pointed apex. Vesica bag-shaped with two chambers: smaller lateral and larger main, both covered with tiny denticles; main one bears claw-like cornutus with medial fossa along it that makes it look like it consists of pair of fused cornuti. Female remains unknown, expected to be bigger and darker than male. Etymology. The species is named in honour of Gavin Filippone (Pedricktown, New Jersey, USA). Gavin loves and collects insects, he watches programs to expand his knowledge of animals, reptiles and insects. Distribution. The species is found in DRC, Haut-Uele Province (Fig. 48). Biology. Adults were collected in August, October and March. The only known habitat is tropical moist broadleaf forests with rare mosaic grassland patches, the elevation is around 800 m above sea-level. The larval foodplant remains unknown., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Mapilanga, Jean Joseph, Volkova, Julia S., Yakovlev, Roman V., Traore, Mohamed M., Saldaitis, Aidas & Müller, Günter C., 2021, Seven new species of Rhynchobombyx Aurivillius, 1909 from Congolian lowland forests (Lepidoptera: Lasiocampidae), pp. 35-53 in Ecologica Montenegrina 49 on page 39, DOI: 10.37828/em.2021.49.3, http://zenodo.org/record/8044124

Rhynchobombyx arijakefriend Prozorov, Saldaitis & Müller sp. n. http://zoobank.org/ urn:lsid:zoobank.org:act: AF8466D0-D98F-40ED-A6E9-468B37DA4056 (Figs 43–44, 48) Type material: HOLOTYPE ♂, DRC, [Haut-Uele Prov., Isiro] Uele: Paulis, 1.VIII.1959, genitalia slide GU 2011-152 (RMCA). Diagnosis. Almost diagonal smooth postmedial line differs the species from the others. Description. Male habitus (Fig. 43). Head and thorax reddish brown, abdomen yellow. Thorax dorsally bears triangular dark brown spot with pale center. Forewing length: 13 mm; wingspan: 28 mm. Wing oval-shaped, apex obtuse, external margin smooth. Background color reddish brown, darkens to brown towards the apex and brightens to greenish brown by tornal angle. Pattern consists of doubled dark brown and greenish brown crenulate antemedial and smooth postmedial lines; and blackish discal dot on R-Cu cell outer margin. Cilia reddish brown. Hindwing oval-shaped, external margin rounded, slightly waved. Main color yellowish, costal and tornal fields darker. Cilia reddish brown. Male genitalia (Fig. 44). Tegumen band-shaped, bears two short projections with sharpen apexes and covered with chaetae along. Vinculum thin, ventrally widened into cup-like form. Sacculus elongated, finger-shaped with blunt apex. Cucullus tuber-like, covered with chaetae. Juxta a tiny plate fused with aedeagus. Aedeagus cylindrical with small uneven dorsal sclerotized field right by vesica and ventral c-shaped long basal spur with blunt apex. Vesica bag-shaped with two chambers: smaller lateral and bigger main, both covered with tiny denticles; main one bears cornutus formed by several fused smaller cornuti. Female remains unknown, expected to be bigger and darker than male. Etymology. The species is named in honour of Ari Jake Friend (Merrick, New York, USA). Ari Jake is nature lover, outdoorsman, loves to fish and explore for minerals. He is sports enthusiast: plays baseball, basketball and flag football. Distribution. The species is found in DRC, Haut-Uele (Fig. 48). Biology. Adult was collected in August. The only known habitat is tropical moist broadleaf forests with rare mosaic grassland patches, the elevation is around 800 m above sea-level. The larval foodplant remains unknown.

Notes on Typhonoya longipennis (Hering, 1941) (Figs 20���25) Distribution. The following countries were mentioned previously in Prozorov, 2011 as the range of this species: Liberia, Ivory Coast, DRC, Uganda, Kenya, Tanzania, Malawi, Zambia, and Zimbabwe. New material is examined: GUINEA: 1♂, S��r��dou, 23.II.1958, R. Pujol leg. (MNHN). LIBERIA: 1♂, Putu Range, 5.6672��, ���8.18694, 20.XII.2010 ��� 5.I.2011, Sz. S��fi��n, E. Zakar leg. (RMCA). IVORY COAST: 1♂, Ta�� National Park, 11.XII.1982, H. Politzar leg. (ZSM/MWM). DRC: 1♂, Mai-Ndombe, Ekongo camp, 02��45���23.09���S, 20��18���55.37���E, XII.2017, A.&T. Prozorovs, V. Kravchenko & al. leg. (ZSM/BUM, genitalia slide 0595). TANZANIA: 1♀, Morogoro Dist., Kitulangalo Forest Reserve, 420���540 m, 1.I.1993, L. Aarvik leg. (NHMO); 2♂, Biharamulo Dist., Nyakanazi, 17.III.1990, A. Bj��rnstad leg. (NHMO, nr. 20240, 20241); 1♂, Kigoma Dist., Tubira Forest, 4.XI.1989, A. Bj��rnstad leg. (NHMO, nr. 17860); 1♂, Mpanda Dist., 57 km S Uvinza, 1650 m, 9.XI.1990, A. Bj��rnstad leg. (NHMO, nr. 22534); 1♂, Kasulu Dist., 10 km SE Rungwe, 20.I.1990, A. Bj��rnstad leg. (NHMO, nr. 19053). MALAWI: 1♂, Lilongwe Dist., Dzalanyama Forest Reserve, 14��15���S, 33��25���E, 1300 m 29.III���1.IV.2010 (CVZ); 3♂, Mzimba Dist., Mzuzu, Nkhorongo, 11��23���S, 39��59���E, 1375 m, 30.I.2011, R. Murphy leg. (CAS); 1♂, same data but 3.XI.2008 (CAS); 1♂, Mangochi Dist., 25 km E Mangochi, Namizimu Forest Reserve, Uzuzu Hill, 14��24���46���S, 35��22���42���E, 1010 m, 17���18.IV.2011, R. Yakovlev leg. (CAS); 1♀, Nkhata Bay Dist., Nkhata Bay, Kolwe Forest Reserve, 11��36���39���S, 34��14���60���E, 540 m, 19.IV.2011, R. Yakovlev leg. (CAS). MOZAMBIQUE: 2♂, Maputo, Marracuene Dist., Jay���s Beach Lodge, 25��42���S, 32��45���E, 26.VIII.2001, K. Gainsford leg. (DNHM). RSA: 1♀, KwaZulu-Natal, Ndumu, Tembe Elephant Reserve, 27��03���S, 32��25���E, 100 m, 2.II.2002, M. Mansell leg. (DNHM). Labels of the following imagoes were not archived in full due to the short-term nature of museum visits, although we suggest mentioning them: KENYA: 5♂, 1♀, [former] Coast Prov., Malindi (DNHM); 4♂, Gede, Arabuko Sokoke National Reserve (DNHM). MALAWI: 1♂, Northern Prov., Mzuzu Dist. (DNHM). ZIMBABWE: 1♂, Manicaland Prov. (DNHM); 1♂, Aberfoyle, 850 m (DNHM); 1♂, Honde Valley, Aberfoyle (DNHM); 1♂, [Harare] Salisbury, S. Rhodesia (NHMZ). Earliest and newer collection sites are marked on the conclusive map (Fig. 35). Biology. In Prozorov, 2011 flying period is a mosaic: January, February, April, May, July, October, and December. Here we add March, August, September and November. Thus, only specimens collected in June are not yet known but it is more likely that T. longipennis is polyvoltine and flies the whole year round. The species is collected in tropical and subtropical moist broadleaf forests (Guinean montane, western Guinean lowland, central Congolian lowland, northeast Congolian lowland, Albertine Rift montane and northern Swahili coastal forests ecoregions) and tropical and subtropical grasslands, savannas and shrublands (central Zambezian wet miombo woodlands and dry miombo woodlands ecoregions) (Dinerstein et al., 2017)., Published as part of Prozorov, Alexey M., Prozorova, Tatiana A., Mapilanga, Jean Joseph, Hausmann, Axel, M��ller, G��nter C., Yakovlev, Roman V., Volkova, Julia S. & Zolotuhin, Vadim V., 2021, A new species of Typhonoya Prozorov (Lepidoptera, Lasiocampidae, Lasiocampinae, Gastropachini) from the moist broadleaf forest of the Democratic Republic of the Congo, pp. 417-428 in Zootaxa 5067 (3) on page 423, DOI: 10.11646/zootaxa.5067.3.5, http://zenodo.org/record/5681946, {"references":["Hering E. M. (1941) Neue Heteroceren aus dem Congo-Gebiet. Revue de Zoologie et Botanique Africaines, 35 (1), 72 - 84.","Prozorov, A. M. (2011) Typhonoya gen. nov. and Weberolegra gen. nov. - two new genera for African Gastropacha Ochsenheimer, 1810 (Lepidoptera, Lasiocampidae). Neue Entomologische Nachrichten, 67, 97 - 106.","Dinerstein, E., Olson, D., Joshi, A., Vynne, C., Burgess, N. D., Wikramanayake, E., Hahn, N., Palminteri, S., Hedao, P., Noss, R., Hansen, M., Locke, H., Ellis, E. C., Jones, B., Barber, C. V., Hayes, R., Kormos, C., Martin, V., Crist, E., Sechrest, W., Price, L., Baillie, J. E. M., Weeden, D., Suckling, K., Davis, C., Sizer, N., Moore, R., Thau, D., Birch, T., Potapov, P., Turubanova, S., Tyukavina, A., De Souza, N., Pintea, L., Brito, J. C., Llewellyn, O. A., Miller, A. G., Patzelt, A., Ghazanfar, S. A., Timberlake, J., Kloser, H., Shennan-Farpon, Y., Kindt, R., Barnekow Lilleso, J. - P., Van Breugel, P., Graudal, L., Voge, M., Al-Shammari, K. F. & Saleem, M. (2017) An Ecoregion-Based Approach to Protecting Half the Terrestrial Realm. BioScience, 1 (6), 1 - 12. https: // doi. org / 10.1093 / biosci / bix 014"]}

Xyleutes ramamurthyi Yakovlev & Sankararaman, sp. nov. (Fig. 2) Type locality. India, Kerala, Malappuram, Thottapally. Type material. Holotype in UASB. Distribution. India (Western Ghats).

Xyleutes ramamurthyi Yakovlev & Sankararaman, sp. nov. (Fig. 2) Type locality. India, Kerala, Malappuram, Thottapally. Type material. Holotype in UASB. Distribution. India (Western Ghats)., Published as part of Yakovlev, Roman V., Sankararaman, Hariharakrishnan, Balaji, Rajasekaran Krishna & Balakrishnan, Valappil, 2021, A world catalogue of Xyleutes Hübner, 1820 (Lepidoptera: Cossidae: Zeuzerinae) with description of a new species from the Western Ghats of India, pp. 565-574 in Zootaxa 5040 (4) on page 570, DOI: 10.11646/zootaxa.5040.4.6, http://zenodo.org/record/5531747

Carohamilia masoni (Schaus, 1894) comb. n. Figs 1−2, 11, 17 Zeuzera masoni Schaus, 1894: 235 Xyleutes masoni Dyar 1940: 1266, pl. 167e Psychonoctua masoni Blanchard & Knudson 1985: 426−431. Aramos masoni Schoorl 1990: 125−126 Material examined: Type material. Lectotype ♂: Mexico: Jalapa, Collection Wm. Schaus, Type No. 12569, U.S.N.M. Genitalia Slide By RWH USNM 12090, USNMENT 01198 175 (USNM) (Fig. 1). — Further material. USA: 1 ♂, Texas, Cameron Co. [RSP:1] N 25.99641° W 97.56871°, Resaca de la Palma St. Pk. subtropical resaca woodland 10 May 2008; MV Sheet 1 H. L. Kons Jr. & R. J. Borth. (MWM), (GenPrMWM: 28.629), (Figs. 2, 11); 1 ♂, Texas, Cameron Co. [RSP:43] N 25.98863° W 97.56429°, Resaca de la Palma St. Pk. subtropical resaca woodland 13 May 2008; MV Sheet 3 H.L. Kons Jr. & R.J. Borth (MWM). Reported from Guatemala (Quirigua, Cayuga and Queriflia), Mexico (Cordoba and Sinaola) and USA, Texas (Southmost, Cameron Co., Brownsville, Hidalgo Co., Santa Ana National Wildlife Refuge) (Blanchard & Knudson 1985; Schoorl (1990). Remarks. A detailed description was given by Blanchard & Knudson (1985). Later, we indicated the unclear taxonomic position of Z. masoni (Yakovlev et al. 2019b), considering the distinct difference of the male genitalia of other Neotropical Zeuzerinae species currently known. Diagnosis. The species differs from the other congeners in the male externally and in the genital structure: the forewing has a very dense grey pattern which is significantly darker than in C. ophelia, with a black longitudinal stroke medially, from the base to the apex of the wing; the valve has a wavy saccular margin, significantly narrowed to the apex. Distribution. USA (Texas), Mexico, Guatemala.

Carohamilia terrafirma (Schaus, 1911) comb. n. Figs. 6���8, 14, 17 Psychonoctua terrafirma Schaus, 1911: 629. =? Psychonoctua nullifer Dyar, 1914: 349 (synonymized by Dyar (1940: 1268)). Material examined: Type material. Holotype of Psychonoctua terrafirma Schaus, 1911, ♂: Costa Rica: Sixola Riv, Mar., Type No. 17303 U.S.N.M. USNMENT 01198216 (USNM) (Fig. 6); Holotype of Psychonoctua nullifer Dyar, 1914, ♀: Panama: Taboga Isl. [Jelz /2] August Busck, Type No. 16435 U.S.N.M., USNMENT 01198178 (USNM) (Fig. 8). ��� Further material. Colombia: 1 ♂, Muzo, R. Cantinero, 400 m (A. H. Fassl), NHMUK 012832454, SLIDE NHMUK 010315487 (NHMUK) (Figs 7, 14); 1 ♂, Antioquia SW of Dabeiba, 780 m, 6��59���27���N 76��16���28���W; 17���18.III.2017, V. Sinyaev (RYB); Ecuador: 3 ♂, Esmeraldes Prov., 3 km E Mompiche, 140 m, 0��29���37���N 79��59���46������W; 25���29.I.2013, leg. Sinjaev & Dr. R. Brechlin, GenPrMWM: 37.167 (MWM); 1 ♂, Esmeraldes, San Mateo, 26.VIII.56, leg. J. F��rster (ZSM). Diagnosis. The species differs from the other species of the genus in the following characters: - the largest species of the genus (length of the fore wing is 20���22 mm, in the other species less than 20 mm); - the male fore wing has an expressed reticulated pattern, well developed black spot at the base and a discal spot; - the saccular margin of the valve has two well-expressed semicircular notch. Notes. The affiliation of Psychonoctua nullifer Dyar, 1914 with Carohamilia terrafirma (Schaus, 1911) was established by Dyar (1940: 1268) without any published argument. Basing on the present materials, we can neither confirm nor refute this taxonomic decision, so we leave the synonymy suggested by Dyar (1940) disputable. Distribution. Costa Rica, Panama, Colombia, Ecuador. Examining the type specimens of Carohamilia sensu Schoorl (1990) we found significant differences in the genital structure and in the wing pattern between С. ophelia and С. lineaeplena (Figs. 1, 9, 11, 15): - in С. lineaeplena, the fore wing pattern consists of transverse equidistant wavy lines, whereas in С. ophelia an expressed dark area is present basally on the fore wing with a dark discal spot; - in С. lineaeplena there is a sharply constriction on the rod-like lateral processes of the juxta apically, whereas in С. ophelia only the basal part is tapered; - in С. lineaeplena the saccus is semicircular and short, in С. ophelia the saccus is robust and very elongated; - the phallus of С. lineaeplena is large, with a lateral cornutus on the vesica, in С. ophelia the phallus is thin and long, without cornuti. The morphological features of С. lineaeplena indicates that this species belongs to the genus Schreiteriana (male genitalia: the reduction of the gnathos and transtilla processes, the valva of simple form, without armament, peculiar structure of the phallus, the vesica with a long ribbon-like sclerite in its lateral surface), previously redescribed (Pencо et al. 2016).) We establish a new combination ��� Schreiteriana lineaeplena (Dognin, 1911), comb. n. In addition, the complete external identity and the same male genital structure of S. lineaeplena and of the recently described S. urcuchillay Yakovlev, Penco & Witt, 2017, indicate that these species are synonyms. Thus, S. lineaeplena = Schreiteriana urcuchillay Yakovlev, Penco et Witt, 2017 syn. n., Published as part of Naydenov, Artem E., Yakovlev, Roman V. & Penco, Fernando C., 2021, Redescription and review of the Neotropical genus Carohamilia Dyar, 1940 (Lepidoptera: Cossidae: Zeuzerinae), pp. 557-563 in Zootaxa 4985 (4) on pages 561-562, DOI: 10.11646/zootaxa.4985.4.8, http://zenodo.org/record/4964402, {"references":["Schaus, W. (1911) Newspecies of Heterocera from Costa Rica. The Annals and Magazine of Natural History; Zoology, Botany, and Geology, Series 8, 7, 612 - 634. https: // doi. org / 10.1080 / 00222931108692985","Dyar, H. G. (1914) Report on the Lepidoptera of the Smithsonian Biological Survey of the Panama Canal zone. Proceedings of the United States National Museum, 47 (2050), 139 - 350. https: // doi. org / 10.5479 / si. 00963801.47 - 2050.139","Dyar, H. G. (1940) Cossidae. Seitz, A. (ed.) Die exotischen Grossschmetterlinge, Die Amerikanischen Spinner und Schwarmer. Stuttgart: Alfred Kernen, 1265 - 1285.","Schoorl, J. W. (1990) A phylogenetic study on Cossidae (Lepidoptera: Ditrysia) based on external adult morphology. Zoologische Verhandelingen, 63, 4 - 295.","Penco, F. P., Yakovlev, R. V. & Witt, Th. J. (2016) Taxonomic notes on the genera Brypoctia Schoorl, 1990 and Schreiteriana Fletcher & Nye, 1982 (Lepidoptera, Cossidae). Zootaxa, 4205 (3), 297 - 300. https: // doi. org / 10.11646 / zootaxa. 4205.3.10","Dognin, P. (1911) Heteroceres nouveaux de l'Amerique du Sud. Fascicule II. Oberthur & Fils, Rennes, 1911, 55 - 56. https: // doi. org / 10.5962 / bhl. title. 59881","Yakovlev, R. V., Penco, F. C. & Witt, T. J. (2017) Five new species of the genus Schreiteriana Fletcher et Nye, 1982 (Lepidoptera: Cossidae) from Peru and Columbia (South America). Russian Entomological Journal, 26 (4), 339 - 342. https: // doi. org / 10.15298 / rusentj. 26.4.07"]}

Carohamilia poam (Dyar, 1918) comb. n. Figs. 4−5, 13, 17 Psychonoctua poam Dyar, 1918: 366-367 Material examined: Type material. Holotype ♂: “ Mexico: Prob. State, Veracruz ”, R. Muller Collector, 43-86, U.S. N.M. Type No. 21315, USNMENT 01198207 (USNM) (Fig. 4). — Further material. Belize: 1 ♂, Punta Gorda, June 1933, J.J. White, SLIDE NHMUK 010315488, NHMUK 012832455 (NHMUK) (Fig. 5, 13). Literature records (cited by Schoorl (1990)): Guatemala: 8 ♂: various localities (NHMUK). Diagnosis. The species differs from the other congeners in the following characters: - the reticulated pattern is expressed throughout all the forewing; - the dark area on the forewing at its base is poorly expressed; - the black discal spot on the fore wing is small; - on the saccular margin of the valve (in the middle third) a trapezoidal process with a wide base. Distribution. Mexico, Belize, Guatemala (Schoorl 1990).

Carohamilia masoni (Schaus, 1894) comb. n. Figs 1���2, 11, 17 Zeuzera masoni Schaus, 1894: 235 Xyleutes masoni Dyar 1940: 1266, pl. 167e Psychonoctua masoni Blanchard & Knudson 1985: 426���431. Aramos masoni Schoorl 1990: 125���126 Material examined: Type material. Lectotype ♂: Mexico: Jalapa, Collection Wm. Schaus, Type No. 12569, U.S.N.M. Genitalia Slide By RWH USNM 12090, USNMENT 01198 175 (USNM) (Fig. 1). ��� Further material. USA: 1 ♂, Texas, Cameron Co. [RSP:1] N 25.99641�� W 97.56871��, Resaca de la Palma St. Pk. subtropical resaca woodland 10 May 2008; MV Sheet 1 H. L. Kons Jr. & R. J. Borth. (MWM), (GenPrMWM: 28.629), (Figs. 2, 11); 1 ♂, Texas, Cameron Co. [RSP:43] N 25.98863�� W 97.56429��, Resaca de la Palma St. Pk. subtropical resaca woodland 13 May 2008; MV Sheet 3 H.L. Kons Jr. & R.J. Borth (MWM). Reported from Guatemala (Quirigua, Cayuga and Queriflia), Mexico (Cordoba and Sinaola) and USA, Texas (Southmost, Cameron Co., Brownsville, Hidalgo Co., Santa Ana National Wildlife Refuge) (Blanchard & Knudson 1985; Schoorl (1990). Remarks. A detailed description was given by Blanchard & Knudson (1985). Later, we indicated the unclear taxonomic position of Z. masoni (Yakovlev et al. 2019b), considering the distinct difference of the male genitalia of other Neotropical Zeuzerinae species currently known. Diagnosis. The species differs from the other congeners in the male externally and in the genital structure: the forewing has a very dense grey pattern which is significantly darker than in C. ophelia, with a black longitudinal stroke medially, from the base to the apex of the wing; the valve has a wavy saccular margin, significantly narrowed to the apex. Distribution. USA (Texas), Mexico, Guatemala., Published as part of Naydenov, Artem E., Yakovlev, Roman V. & Penco, Fernando C., 2021, Redescription and review of the Neotropical genus Carohamilia Dyar, 1940 (Lepidoptera: Cossidae: Zeuzerinae), pp. 557-563 in Zootaxa 4985 (4) on pages 558-559, DOI: 10.11646/zootaxa.4985.4.8, http://zenodo.org/record/4964402, {"references":["Schaus, W. (1894) On new species of Heterocera from Tropical America. Proceedings of the Zoological Society of London, 1894, 225 - 243.","Dyar, H. G. (1940) Cossidae. Seitz, A. (ed.) Die exotischen Grossschmetterlinge, Die Amerikanischen Spinner und Schwarmer. Stuttgart: Alfred Kernen, 1265 - 1285.","Blanchard, A. & Knudson, E. C. (1985) Psychonoctua masoni (Schaus), new combination (Lepidoptera: Cossidae: Zeuzerinae), redescription and first records from Texas and USA. Proceedings of the Entomological Society of Washington, 87 (2), 426 - 431.","Schoorl, J. W. (1990) A phylogenetic study on Cossidae (Lepidoptera: Ditrysia) based on external adult morphology. Zoologische Verhandelingen, 63, 4 - 295.","Yakovlev, R. V., Penco, F. & Witt, T. (2019 b) Review of the genus Brypoctia Schoorl, 1990 (Lepidoptera, Cossidae) with descriptions of five new species from Central and South America. Entomological Review, 99 (3), 407 - 415. https: // doi. org / 10.1134 / S 0013873819030138"]}

Carohamilia ophelia (Schaus, 1921) Figs. 3, 12, 17 Lentagena ophelia Schaus, 1921: 393 Carohamilia Ophelia Dyar, 1940: 1269. Material examined: Type material. Holotype ♂: Guatemala: Cayuga, March, Schaus and Barnes coll., TypeNo. 23430 U.S.N.M., USNMENT 01198176 (USNM) (Figs. 3, 14). Literature records (cited by Schoorl (1990)): Mexico: 2 ♂, Yucatan, Chichen Itza (CMNH); 2 ♂, near Concordia, Sinoloa (CMNH); 1 ♂, Concordia, Sinaloa (NHMA). The specimens from Mexico were not studied morphologically, so their affiliation to C. ophelia is not confirmed. Diagnosis. The species differs from the other representatives of the genus by the following features: - the fore wing is pale, with a black area basally, black stroke at the costal edge in the postdiscal area and a black discal spot; - the saccular margin of the valve is straight. Distribution. Guatemala. The distribution of the species in Mexico is not confirmed. To clarify the species attribution of the specimens from Mexico, given by Schoorl (1990), we need to study the genital morphology of these specimens., Published as part of Naydenov, Artem E., Yakovlev, Roman V. & Penco, Fernando C., 2021, Redescription and review of the Neotropical genus Carohamilia Dyar, 1940 (Lepidoptera: Cossidae: Zeuzerinae), pp. 557-563 in Zootaxa 4985 (4) on pages 559-560, DOI: 10.11646/zootaxa.4985.4.8, http://zenodo.org/record/4964402, {"references":["Schaus, W. (1921) New species of Lepidoptera in the United States National Museum. Proceedings of the United States National Museum, 59, 349 - 396. https: // doi. org / 10.5479 / si. 00963801.2372.349","Dyar, H. G. (1940) Cossidae. Seitz, A. (ed.) Die exotischen Grossschmetterlinge, Die Amerikanischen Spinner und Schwarmer. Stuttgart: Alfred Kernen, 1265 - 1285.","Schoorl, J. W. (1990) A phylogenetic study on Cossidae (Lepidoptera: Ditrysia) based on external adult morphology. Zoologische Verhandelingen, 63, 4 - 295."]}

Dyspessa ulgen Yakovlev, Shapoval, Ivonin, Knyazev & Kuftina, sp. nov. (Figs. 4 A���B) Type. Holotype. Male, sample ID���YK500, GenBank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene is MN401259; NE Kazakhstan, Tarbagatai Mts. range, 6 km W Karabuirat Village, 1020 m, 47��21���N / 81��06���E, 02.06.2018, P. Gorbunov leg. (GenPr # 9, coll. Yakovlev / 2018), deposited in the Zoological Institute of the Russian Academy of Sciences (St. Petersburg). Paratypes: 12 females, field codes YK501 (Gen-Bank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene is MN401260), YK502, YK503, YK504, YK505, YK506, YK507, YK508, YK509, YK510, YK511, YK512, same data and locality (deposited in ZISP, MWM, and RYB private collection); 9 females, field codes YK513, YK514, YK515, YK516, YK517, YK518, YK519, YK520, YK521), Eastern Kazakhstan, Kalba Mts, 40 km NW Kokpekty, 49��00���N / 82��00���, 760 m, 19.06.2018, R. Yakovlev, V. Doroshkin, V. Rudoj & A. Naydenov leg. (in RYB private collection); 4 females, field codes YK522, YK523, YK524, YK525, Eastern Kazakhstan, Kalba Mts., 6 km NW Panteleymonovka vill., 1130 m, 49��12���N / 83��12���E, 14.06.2012, R. Yakovlev leg. (in RYB private collection); 1 female, field code YC051 (GenBank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene is MN401262), Russia, Altai Republic, Kosh-Agach distr., 5 km E Tebeler, Yustyt river valley, 1800 m, 24��� 25.06.2015, V. Ivonin leg. (private col-lection of Vadim Ivonin, Novosibirsk); 1 female, field code YC050 (GenBank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene is MN401261) E Kazahstan, Kurchum distr., 26 km SE of Barsk-Batyr vill., 1800 m, 48��29���N / 84��07���, 20.06.2014, A. Volynkin, S. Titov leg. (in RYB private collection); 3 females, field codes YK701, YK702, YK703, Russia, Altai Krai, Loktevsky distr., Aley river valley, 1 km N of Ust���yanka vill., 51��09���47.6���N / 81��35���45.8���E, 330 m, 17��� 18.05.2020, leg. A.E. Naydenov (in RYB private collection). Diagnosis. The new species is most similar to D. ulula (Fig. 4D), from which it differs by: - the dark wings (D. ulula is much paler, the basic background is yellowish, the pale spots are much more expressed); - the expressed stepped bending on the costal edge of the valve (in D. tristis (Fig. 5A) and D. saldaitisi (Fig. 5B) the finely serrated surface on the costal edge of the valve in medium third; in D. ulula (Fig. 5C), the costal edge of valve is smoothly rounded; in D. saissanica (Fig. 5D) the proximal end of the process on the costal edge of the valve is sharp; - the phallus strongly bent in the medium third (in D. ulula, the phallus is less curved). The new species also differs from D. saissanica, D. saldaitisi D. tristis, and D. ulula (Figs 4C, 4E, 4F,) by the well-expressed dark color of the wings. Genetically, the new species differs from most closely related D. ulula by at least 36 fixed nucleotide substitutions (p-distance is 5.5%) within the studied 658bp fragment of the mitochondrial COI gene. COI barcode sequence of the holotype, 658 base pairs. AACATTATATTTTATTTTTGGAATTTGATCCGGAATAGTAGGTACTTCCTTAAGTCTATTAATTC- GAGCTGAATTAGGAAATCCAGGATCTTTAATTGGTAATGATCAAATTTATAATACTATTGTGACAACT- CATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGGGGATTTGGTAATTGATTAG TGCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTACTCCCCCCTTCTT- TA A C C C T T T TA AT T T C TA G G A G TAT T G T T G A A A AT G G A G C T G G A A C A G G AT G A A C A G T T- TA C C C T C C C C TAT C C T C TA ATAT C G C T C AT G G T G G A A G T T C A G T C G AT C TA G C TAT T T T T T C T TTACACTTAGCAGGAATTTCTTCCATCTTAGGAGCAATTAATTTTATTACCACTATCATTAATATAC- GCCCCTATAATATATCATTCGATCAAATACCCCTTTTTGTTTGAGCAGTTGGAATTACCGCATTAT- TACTTTTACTATCTCTTCCAGTATTAGCGGGAGCTATCACTATATTATTAACAGATCGAAATTTAAA TACTTCATTTTTTGACCCTGCGGGAGGGGGAGATCCAATTTTATACCAACATTTATTT Description. Male. (Fig. 4A) Length of forewing 10 mm. Antenna bipectinate, equal to half of the forewing length, antenna crest 1.5 times of antenna rod diameter. Thorax and abdomen are densely covered with pale grey scales. Forewing grey with a poorly developed pale pattern of pale cream spots along the costal edge in the discal cell, and two spots in the cubital area (one at wing base, second in the discal area). Fringe mottled, dark at veins, pale between veins. Hindwing ground colour and hindwing fringe grey, unicolorous. Female (Fig. 4B). Length of forewing 9��� 11 mm. Antenna bipectinate, equal to half of the forewing length, an-tenna crest 0.5 times of antenna rod diameter. Thorax and abdomen are densely covered with pale grey scales. Wing pattern resembles that of males. Female genitalia (Fig. 5F). Ovipositor long, papillae analis semicircular, anterior apophyses three times shorter than posterior apophyses, ostium aperture slit-shaped, narrow. Male genitalia (Fig. 5E). Uncus triangle, apically blunt; gnathos arms short, thick; gnathos small, poorly sclerotized; valve basally sclerotized, caudal end membranous, lanceolately narrowing, stepped bending on the costal edge of the valve (in medium third); transtilla process short, basally very wide, apically narrowing, apex semicircular; juxta tiny, with a pair of short rod-shaped lateral processes; saccus semicircular, robust; phallus equal to 3/4 of valve length, thin, apically narrowing, strongly bent in the medium third, vesica aperture in dorso-apical position, equal to 2/3 of phallus length, vesica without cornuti. Distribution. Kazakhstan (Eastern Kazakhstan Province), Russia (Altai Krai Province). Etymology. Ulgen������demiurge, the supreme deity in shamanism of Altaians, Khakas, and Shors., Published as part of Yakovlev, Roman V., Shapoval, Nazar A., Ivonin, Vadim V., Knyazev, Svyatoslav A., Kuftina, Galina N. & Masharskiy, Alexey E., 2020, A new species of Carpenter Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains, pp. 85-95 in Zootaxa 4896 (1) on pages 91-94, DOI: 10.11646/zootaxa.4896.1.3, http://zenodo.org/record/4359282

Holcoceroides landeri Yakovlev & László, sp. n. Figs 1−2, 7, 11 https://zoobank.org/ urn:lsid:zoobank.org:act: A632E178-4724-48E8-B094-F988979B1240 Holotype, male, “ Guinea, Geipa Camp, Forêt de Diecké, 7º26ʹ7.06ʹʹN, 8º50ʹ47.87ʹʹW, 435 m, 5‒14.iv.2019, Cold Cathode UV Light Trap (8 W), Safian, Sz., Koivogui, S. leg., ANHRT: 2019.7”, unique number: ANHRTUK 00107396, genitalia slide number: LG 5196 (ANHRT). Paratype: 1 female, with the same data as the holotype, unique number: ANHRTUK 00107399, genitalia slide number: LG 5290 (ANHRT). Description Male (Fig. 1). Forewing length 10 mm. Antenna short, half as long as length of forewing, filiform with flattened segments in both sexes, its proximal 5/6 dark brown, distal 1/6 paler brown. Forewing relatively short, broad, dark-brown, densely scattered with pale brown scales basally, discally (at cubital veins) and postdiscally, with a blurred black streak postdiscally (at medial veins). Hindwing uniformly dark brownish grey without pattern. Male genitalia (Fig. 7). Uncus conspicuously broad at base, bifurcate, consisting of two short, broadly rounded more or less semicircular arms; tegumen robust, trapezoidal; gnathos arms thick, short, medial plate of gnathos small, heavily sclerotized, with a short, finely serrated process projecting posteriorly; valva broad at base, apically gradually tapered, rather triangular, apex lanceolate, costal margin with a large, acute triangular medial process projecting caudad; juxta large, robust, medially ring-like, with a long cylindrical anterior process and a pair of robust, acute trigonal posterior lobes; saccus large, apically rounded, U-shaped; phallus rather narrow, more or less as long as valva, slightly curved in proximal third, ventral surface finely serrated in its distal 1/5, vesica aperture oblique, positioned dorso-apically, equal to 2/5 of phallus in length, vesica without cornuti. Female (Fig. 2). Forewing length 10.5 mm. Sexual dimorphism limited, expressed only by the slightly wider forewing of female compared to that of male; male and female wing pattern and coloration nearly identical. Female genitalia (Fig. 11). Ovipositor conspicuously long; papillae anales narrow, apically rounded; apophyses posteriores three times as long as apophyses anteriores; ostium bursae cup-shaped, deeply incised; ductus bursae long and thin, slightly sclerotized posteriorly, membranous anteriorly; cervix bursae membranous, slightly rugose, ductus seminalis narrow; posterior third of corpus bursae tubular, slightly broader than ductus bursae, anterior two-thirds of corpus bursae ovoid, signum bursae absent. Diagnosis The new species is distinguished from the other species of the genus in the following characters: - from H. ferrugineotincta (Figs 3−5, 8−9) – by the shorter uncus, absence of the robust hooked harpe, specific shape of the juxta, and the shorter, less acute triangular process of the costal margin of the valva. The differences in the female genitalia are as follows: in H. ferrugineotincta, the posterior apophyses are about two times longer than the anterior ones (in H. landeri, they are three times longer); ductus seminalis adjoins with the corpus bursae in its proximal third (whereas in H. landeri, in its medium third); - from H. cheick (Figs 6, 10) – by the significantly smaller size (the forewing length of H. cheick is 15 mm), the presence of the long triangular process of the costal margin of valva, the absence of the serrated harpe on the ventral margin of valva, the less heavily sclerotized transtilla process and the markedly different configuration of juxta. Etymology. The new species is named after the famous explorer of West Africa, Richard Lemon Lander (1804—1834), Winner of the Gold Medal of the Geographical Royal Society, who died in Nigeria at the age of 29 at the hands of bandits., Published as part of Yakovlev, Roman V. & László, Gyula M., 2020, Holcoceroides landeri - a new species of Carpenter-Moths (Lepidoptera, Cossidae: Politzariellinae) from the Republic of Guinea, pp. 29-34 in Ecologica Montenegrina 33 on pages 30-33, DOI: 10.37828/em.2020.33.5, http://zenodo.org/record/8028541, {"references":["Yakovlev, R. V., Muller, G. C., Kravchenko, V. D., Petranyi, G. & Safian, Sz. (2019) Three new species of subfamily Politzariellinae (Lepidoptera: Cossidae) from Guinea and Zambia. Russian Entomological Journal, 28 (3), 312 - 316. https: // doi. org / 10.15298 / rusentj. 28.3.10"]}

Plebejus chrisreai Churkin, Kolesnichenko & Yakovlev, sp. n. Plate 1 and 2, figs. 7 (holotype), 8–12, 21–23 (paratypes). Holotype: ♂, SW Mongolia, Khovd aimak, Dzhungarian Gobi des., Ushig spring, 1200 m.a.s.l., 27.06.2018, 45°35’ N, 90°56’ E, S. Churkin, K. Kolesnichenko, V. Pletnev, Odbayar Tz. leg.(ZISP). Paratypes: 172 ♂, 136 ♀, same data, S. Churkin, K. Kolesnichenko, V. Pletnev, Odbayar Tz. leg.; 30 ♂, 20 ♀, same locality, 3.07.2015, R. Yakovlev leg.; 1 ♂, 1 ♀, SW Mongolia, Khovd aimak, Dzhungarian Gobi des., Del Khaar Uul, 1350 m.a.s.l., water spring, 7.07.2018, 45°39’ N, 90°54’ E, S. Churkin leg. Paratypes are deposited in private collections of S. Churkin (Reutov), V. Pletnev (Reutov), K. Kolesnichenko (Moscow), Odbayar Tz. (Ulan-Bator), P. Beda (Ljubertzy), G. Grieshuber (Ortenburg); in the Institute of General and Experimental Biology MAS and in ZISP. Additional material: 24 ♂, 20 ♀, SW Mongolia, Khovd aimak, Dzhungarian Gobi, Olon bulak (spring), 1550 m.a.s.l., 4.07.2018, 45°10’25” N, 91°19’41” E, S. Churkin, K. Kolesnichenko, V. Pletnev, Odbayar Tz. leg.; 5 ♂, 3 ♀, SW Mongolia, Khovd aimak, Dzhungarian Gobi, 20 km S Altai somon, water spring, 1150 m.a.s.l., 5.07.2018, 45°32’47” N, 92°10’58” E, S. Churkin leg. Description. Male. Holotype FW length 13 mm, paratypes 11–15 mm (average 13–14 mm, n = 40). Fringes from the upperside white with narrow blackish inner part. Upperside blue with light violet hue, costal side of forewing with obvious suffusion of whitish scales. Black margins thin, ends of veins blackish. Hindwing often (but not always) with submarginal black dots between veins. Forewing underside light gray with black discal spot and s-curved postdiscal series of black spots, Cubital spot usually enlarged and shifted toward the base. Submarginal series looks erased (with rare exceptions), apical part of the spots strongly reduced, only two cubital spots more or less developed with slightly expressed orange segments. Hindwing underside whitish-gray or light-gray with whitish marginal half of wing, Base with obvious but narrow and not dense bluish-greenish suffusion. Blackish spots normally developed, basal and postdiscal series complete (4 basal and 8 postdiscal spots), discal spot not thin. Cubital spot in postdiscal series strongly shifted toward the base. Submarginal pattern complete, each spot consists of v-shaped internal thin black segment, well-developed bright orange or reddish-orange segment and external plate of greenish-blue metallic scales. Marginal band whitish, external parts of all metallic plates also sometimes appear whitish. Female. FW length 13–15 mm (average as in males, n=30). Fringes whitish, with very thin dark inner part joined with blackish spots at end of veins. Upperside whitish with blue hue of base of both wings (bluish shining is more obvious on hindwings), veins slightly blackish but do not look contrasting. Discal spot thin but often (not always) developed on both wings. Forewing with darkened submarginal band with brownish not contrasting oval spots between veins. Hindwing submarginal series complete and consists of large black spots, rarely outlined internally by reddish-orange lunules. Forewing underside whitish or light grayish-white, pattern more developed than in males, submarginal spots often with developed orange segments, except apical and anal ones. Postdiscal spot strongly s-curved. Hindwing underside whitish or light grayish-white/ brownish-white. Pattern as in males, bluish-green suffusion less developed. Submarginal spots with more expressed orange segments and metallic plates. Individual variation. According to our statistics, whitish females present over 70%, but the colour varies depending on locality. Rarely females fully bluish (Pl. 1: 21), very rarely obscured and have brownish hue (but never totally brown; Pl. 1: 22). It seems that females from Olon Bulak and Altai somon (east part of the distribution area) statistically darker, but our material is mainly worn and not sufficient to confirm this observation. Males rarely have thick black margins, while blackish ends of the veins not so prominent—but ground blue colour is light in all cases. Male genitalia (Pl. 3: 1, Pl. 4: 1, Pl. 5: 1, 2, 5). Labis (distal parts of uncus) with moderately long and thin ends from lateral view. Valva without developed convexities, with moderately smooth outlines, upper distal projection (“upper lip”) very wide, lower distal projection (“lower lip”) also widened and massive. Juxta has straight branches which gradually move apart to ends—but the true shape nearly impossible to observe without separation. Aedeagus thin, proximal part without large ventral inflation, and obviously but only moderately wider than distal part. Distal part with visible narrowing in middle and widened near distal end. Aedeagus curved, but curving located after joining of proximal and distal parts—so that this joining itself straight, and only distal part curved downwards. Curving usually weakly expressed, aedeagus often looks moderately straight. Distal part obviously longer than proximal part. Diagnosis. The size of P. chrisreai is statistically smaller than that of P. germani, the latter has a forewing length of 13.5–16 mm in both sexes (average 14–15 mm: n=55 totally). Even two other taxa are also slightly larger (see below, forewing length 14–15.5 mm). The new species differs from all other Mongolian relatives by a light colour of the upperside: P. germani and P. anikini have common dull or deep violet-blue colour. The difference is based on the pigment and not on the quantity of the white scales (that is quite obvious under magnification; P. germani has practically the same quantity of these whitish scattered scales). As a rule, the new species usually has more expressed blackish ends of the veins, but it is not such a constant feature (see Pl. 1: 23, 24, where the veins characters are changed but the ground colours are still different). The whitish upperside of the females presents unique distinction which is not known among Plebejus spp. in East Palaearctic. Even the rare dark aberrations (Plate 1:22) cannot be confused with dark-brown females of P. anikini or P. germani. The light underside can be easily differentiated from the dark-gray underside of the relatives. The orange lunules are bright and usually have a reddish hue, while in all other taxa these lunules are pale and yellowish, and exceptions are rare. In addition, the postdiscal row of both other species are usually moderately straight without a shifted cubital spot; the area between postdiscal and submarginal series is not contrastingly whitish compared with the colouration of P. chrisreai. These features are not consistent but easily recognizable in the series (Pl. 2: 2; the male of P. germani with a moderately curved postdiscal row on the forewing underside). The genitalia distinctions are as follows: labis are thinner than in P. germani but similar and even wider/shorter than that in P. anikini (Pl. 3). Valva has no distinctive convexities (opposite to P. germani but similar to P. anikini), distal lips are very wide: the upper lip is distinctively wider than in the closest P. germani, the lower lip is obviously wider than the very thin and shortened lower lip of P. anikini (Pl. 4; some details of the width of the lips are not clearly visible but the distinctions given here are consistent and useful in the comparison of the real sclerites). The juxta has a specific structure—in both other species, the branches of the sclerite are convex. The aedeagus is moderately similar to that of P. anikini, the place of curving is distally moved from the point of the joining of the proximal and distal parts. In P. germani the place of curving is situated just at the joining of the distal and proximal parts, the degree of the curving is much more expressed as a rule. In addition, the proximal part of the new species is obviously thinner (not so heavy) compared to P. anikini and especially to P. germani, the distal part is longer than the proximal part, while in both other species the character is opposite. Bionomics (Pl. 6: 1). Bushes near the springs in the desert consist of the Tamarix sp. and food plant Halimodendron halodendron (the females laid the eggs). We anticipate that the species has several generations. Distribution (Pl. 7). The species was numerous and collected in 4 localities—but we only included the material from Ushig springs and the closely situated spring near Del Khaar Mt in the type series. Two other localities were excluded to avoid possible future problems. Etymology. The species is named after Christopher Anton (Chris) Rea, British rock and blues singer-songwriter and guitarist. The songs of Chris Rea accompanied us in the mountains and deserts for over two decades of expeditions and always brought us luck.

Plebejus chrisreai Churkin, Kolesnichenko & Yakovlev, sp. n. Plate 1 and 2, figs. 7 (holotype), 8���12, 21���23 (paratypes). Holotype: ♂, SW Mongolia, Khovd aimak, Dzhungarian Gobi des., Ushig spring, 1200 m.a.s.l., 27.06.2018, 45��35��� N, 90��56��� E, S. Churkin, K. Kolesnichenko, V. Pletnev, Odbayar Tz. leg.(ZISP). Paratypes: 172 ♂, 136 ♀, same data, S. Churkin, K. Kolesnichenko, V. Pletnev, Odbayar Tz. leg.; 30 ♂, 20 ♀, same locality, 3.07.2015, R. Yakovlev leg.; 1 ♂, 1 ♀, SW Mongolia, Khovd aimak, Dzhungarian Gobi des., Del Khaar Uul, 1350 m.a.s.l., water spring, 7.07.2018, 45��39��� N, 90��54��� E, S. Churkin leg. Paratypes are deposited in private collections of S. Churkin (Reutov), V. Pletnev (Reutov), K. Kolesnichenko (Moscow), Odbayar Tz. (Ulan-Bator), P. Beda (Ljubertzy), G. Grieshuber (Ortenburg); in the Institute of General and Experimental Biology MAS and in ZISP. Additional material: 24 ♂, 20 ♀, SW Mongolia, Khovd aimak, Dzhungarian Gobi, Olon bulak (spring), 1550 m.a.s.l., 4.07.2018, 45��10���25��� N, 91��19���41��� E, S. Churkin, K. Kolesnichenko, V. Pletnev, Odbayar Tz. leg.; 5 ♂, 3 ♀, SW Mongolia, Khovd aimak, Dzhungarian Gobi, 20 km S Altai somon, water spring, 1150 m.a.s.l., 5.07.2018, 45��32���47��� N, 92��10���58��� E, S. Churkin leg. Description. Male. Holotype FW length 13 mm, paratypes 11���15 mm (average 13���14 mm, n = 40). Fringes from the upperside white with narrow blackish inner part. Upperside blue with light violet hue, costal side of forewing with obvious suffusion of whitish scales. Black margins thin, ends of veins blackish. Hindwing often (but not always) with submarginal black dots between veins. Forewing underside light gray with black discal spot and s-curved postdiscal series of black spots, Cubital spot usually enlarged and shifted toward the base. Submarginal series looks erased (with rare exceptions), apical part of the spots strongly reduced, only two cubital spots more or less developed with slightly expressed orange segments. Hindwing underside whitish-gray or light-gray with whitish marginal half of wing, Base with obvious but narrow and not dense bluish-greenish suffusion. Blackish spots normally developed, basal and postdiscal series complete (4 basal and 8 postdiscal spots), discal spot not thin. Cubital spot in postdiscal series strongly shifted toward the base. Submarginal pattern complete, each spot consists of v-shaped internal thin black segment, well-developed bright orange or reddish-orange segment and external plate of greenish-blue metallic scales. Marginal band whitish, external parts of all metallic plates also sometimes appear whitish. Female. FW length 13���15 mm (average as in males, n=30). Fringes whitish, with very thin dark inner part joined with blackish spots at end of veins. Upperside whitish with blue hue of base of both wings (bluish shining is more obvious on hindwings), veins slightly blackish but do not look contrasting. Discal spot thin but often (not always) developed on both wings. Forewing with darkened submarginal band with brownish not contrasting oval spots between veins. Hindwing submarginal series complete and consists of large black spots, rarely outlined internally by reddish-orange lunules. Forewing underside whitish or light grayish-white, pattern more developed than in males, submarginal spots often with developed orange segments, except apical and anal ones. Postdiscal spot strongly s-curved. Hindwing underside whitish or light grayish-white/ brownish-white. Pattern as in males, bluish-green suffusion less developed. Submarginal spots with more expressed orange segments and metallic plates. Individual variation. According to our statistics, whitish females present over 70%, but the colour varies depending on locality. Rarely females fully bluish (Pl. 1: 21), very rarely obscured and have brownish hue (but never totally brown; Pl. 1: 22). It seems that females from Olon Bulak and Altai somon (east part of the distribution area) statistically darker, but our material is mainly worn and not sufficient to confirm this observation. Males rarely have thick black margins, while blackish ends of the veins not so prominent���but ground blue colour is light in all cases. Male genitalia (Pl. 3: 1, Pl. 4: 1, Pl. 5: 1, 2, 5). Labis (distal parts of uncus) with moderately long and thin ends from lateral view. Valva without developed convexities, with moderately smooth outlines, upper distal projection (���upper lip���) very wide, lower distal projection (���lower lip���) also widened and massive. Juxta has straight branches which gradually move apart to ends���but the true shape nearly impossible to observe without separation. Aedeagus thin, proximal part without large ventral inflation, and obviously but only moderately wider than distal part. Distal part with visible narrowing in middle and widened near distal end. Aedeagus curved, but curving located after joining of proximal and distal parts���so that this joining itself straight, and only distal part curved downwards. Curving usually weakly expressed, aedeagus often looks moderately straight. Distal part obviously longer than proximal part. Diagnosis. The size of P. chrisreai is statistically smaller than that of P. germani, the latter has a forewing length of 13.5���16 mm in both sexes (average 14���15 mm: n=55 totally). Even two other taxa are also slightly larger (see below, forewing length 14���15.5 mm). The new species differs from all other Mongolian relatives by a light colour of the upperside: P. germani and P. anikini have common dull or deep violet-blue colour. The difference is based on the pigment and not on the quantity of the white scales (that is quite obvious under magnification; P. germani has practically the same quantity of these whitish scattered scales). As a rule, the new species usually has more expressed blackish ends of the veins, but it is not such a constant feature (see Pl. 1: 23, 24, where the veins characters are changed but the ground colours are still different). The whitish upperside of the females presents unique distinction which is not known among Plebejus spp. in East Palaearctic. Even the rare dark aberrations (Plate 1:22) cannot be confused with dark-brown females of P. anikini or P. germani. The light underside can be easily differentiated from the dark-gray underside of the relatives. The orange lunules are bright and usually have a reddish hue, while in all other taxa these lunules are pale and yellowish, and exceptions are rare. In addition, the postdiscal row of both other species are usually moderately straight without a shifted cubital spot; the area between postdiscal and submarginal series is not contrastingly whitish compared with the colouration of P. chrisreai. These features are not consistent but easily recognizable in the series (Pl. 2: 2; the male of P. germani with a moderately curved postdiscal row on the forewing underside). The genitalia distinctions are as follows: labis are thinner than in P. germani but similar and even wider/shorter than that in P. anikini (Pl. 3). Valva has no distinctive convexities (opposite to P. germani but similar to P. anikini), distal lips are very wide: the upper lip is distinctively wider than in the closest P. germani, the lower lip is obviously wider than the very thin and shortened lower lip of P. anikini (Pl. 4; some details of the width of the lips are not clearly visible but the distinctions given here are consistent and useful in the comparison of the real sclerites). The juxta has a specific structure���in both other species, the branches of the sclerite are convex. The aedeagus is moderately similar to that of P. anikini, the place of curving is distally moved from the point of the joining of the proximal and distal parts. In P. germani the place of curving is situated just at the joining of the distal and proximal parts, the degree of the curving is much more expressed as a rule. In addition, the proximal part of the new species is obviously thinner (not so heavy) compared to P. anikini and especially to P. germani, the distal part is longer than the proximal part, while in both other species the character is opposite. Bionomics (Pl. 6: 1). Bushes near the springs in the desert consist of the Tamarix sp. and food plant Halimodendron halodendron (the females laid the eggs). We anticipate that the species has several generations. Distribution (Pl. 7). The species was numerous and collected in 4 localities���but we only included the material from Ushig springs and the closely situated spring near Del Khaar Mt in the type series. Two other localities were excluded to avoid possible future problems. Etymology. The species is named after Christopher Anton (Chris) Rea, British rock and blues singer-songwriter and guitarist. The songs of Chris Rea accompanied us in the mountains and deserts for over two decades of expeditions and always brought us luck., Published as part of Churkin, Sergei V., Kolesnichenko, Kirill A. & Yakovlev, Roman V., 2019, Two new taxa of Plebejus Kluk, 1780 (Lepidoptera, Lycaenidae) from the Gobi desert, Mongolia, pp. 45-58 in Zootaxa 4695 (1) on pages 47-52, DOI: 10.11646/zootaxa.4695.1.3, http://zenodo.org/record/3530113

Strigocossus otti Yakovlev, Sulak & Witt, sp. nov. (Figs. 13���16) Material. Holotype ♂, Angola, Prov. Cuanza Sul, 26 km E Cassongue, 11��52.257��S 15��09.320��E, 1650 m, 28.III.2014, leg. Sulak, Naumann & Ott (MWM, GenPr 26756). Paratypes: 1 ♂, same data and locality as holotype (MWM); 2 ♂, Angola, Huila Prov., Caconda-Huambo, vic. N. Monaco, S13��261��E015��227��, 10.XI.2012, 1610 m, leg. Weninger (MSW). Description. Male: Wingspan 79���84 mm (holotype 79 mm). Antenna bipectinate along proximal half (rami three times as long as antenna rod diameter), unipectinate along distal half (crest processes almost equal to antenna rod diameter). Frons covered with pale grey scales, dense speckling of dark brown flakes on crown. Thorax with dark brown trapezoidal spot dorsally, tegula and patagium pale grey. Abdomen covered with pale grey scales. Forewing long, pale grey, with pattern of small dark spots along costal edge, thin transverse undulate lines throughout wing, discal area pale, bright dark spot discally between veins Cu1 and Cu2, dark crescent-shaped spot submarginally. Hindwing short, dark brown, with poorly expressed reticulated pattern submarginally and marginally. Genitalia: Uncus long, strongly sclerotized, apically uncinate; gnathos reduced, with basally wide, apically narrower arms; valva evenly edged, leaf-like in shape, wide; juxta with long wide lateral processes; saccus robust, semicircular; phallus large (equal in length to valva), thick, with well-developed longitudinal folds, robust fusiform cornutus in lateral surface, long sclerotized strip with longitudinal folds on lateral surface of vesica. Female: unknown. Diagnosis. The new species can be distinguished from the most similar species of Strigocossus: S. capensis, S. crassa, S. elephas, and S. moderata by the specific grey coloring of the wings and by the expressed longitudinal folds on the sclerotized strip on the lateral surface of the vesica. Etymology. The new species is named after one of the collectors of the type series, Mr. Elk Ott (Munich)., Published as part of Yakovlev, Roman V., Sulak, Harald & Witt, Thomas J., 2019, Preliminary list of Cossidae sensu str. (Lepidoptera, Cossoidea: Cossidae: Cossinae & Zeuzerinae) of the Republic of Angola with description of a new Strigocossus species, pp. 445-460 in Zootaxa 4586 (3) on page 453, DOI: 10.11646/zootaxa.4586.3.3, http://zenodo.org/record/2647220

Oreocossus occidentalis Strand, 1912 (Fig. 19) Oreocossus occidentalis Strand, 1912: 35. Type locality. Nkolentangan [Equatorial Guinea]. Distribution. Ethiopia, Equatorial Guinea, Cameroon, Angola, Congo, Uganda, Kenya, Tanzania, Mozambique, Republic of South Africa (Rougeot 1977; V��ri et al. 2002). Material examined. Holotype ♂, Spain Guinea [Equatorial Guinea], Nkolentangan, G. Tessmann S.G. (MNKB), examined., Published as part of Yakovlev, Roman V., Sulak, Harald & Witt, Thomas J., 2019, Preliminary list of Cossidae sensu str. (Lepidoptera, Cossoidea: Cossidae: Cossinae & Zeuzerinae) of the Republic of Angola with description of a new Strigocossus species, pp. 445-460 in Zootaxa 4586 (3) on page 456, DOI: 10.11646/zootaxa.4586.3.3, http://zenodo.org/record/2647220, {"references":["Strand, E. (1912) Zoologische Ergebnisse der Expedition des Herrn G. Tessmann nach Sud-Kamerun und Spanisch-Guinea. 101. Lepidoptera. Archiv fur Naturgeschichte, Abt. A, 12, 30 - 37.","Rougeot P. C. (1977) Lepidoptera. In: Missions entomologiques en Ethiopie 1973 - 1975. Fascicule 1. Memoires du Museum national d'Histoire naturelle, (A), 105, pp. 1 - 150.","Vari, L., Kroon, D. M. & Kruger, M. (2002) Cossidae. In: Classification and Checklist of the species of Lepidoptera recorded in Southern Africa. Simple Solutions Australia, Chastwood, pp. 1 - 385."]}

Azygophleps Hampson, 1892 Azygophleps Hampson, 1892: 309. Type species: Hepialus scalaris Fabricius, 1775., Published as part of Yakovlev, Roman V., Sulak, Harald & Witt, Thomas J., 2019, Preliminary list of Cossidae sensu str. (Lepidoptera, Cossoidea: Cossidae: Cossinae & Zeuzerinae) of the Republic of Angola with description of a new Strigocossus species, pp. 445-460 in Zootaxa 4586 (3) on page 456, DOI: 10.11646/zootaxa.4586.3.3, http://zenodo.org/record/2647220, {"references":["Hampson, G. F. (1892) Moths. Vol. I. The fauna of British India including Ceylon and Burma. Dr. W. Junk b. v. Publishers, The Hague, 527 pp.","Fabricius, J. C. (1775) Systema Entomologiae sistens insectorum classes, ordines, genera, species, adiectis synonymis, locis, descriptionibus, observationibus. In Officina Libraria Kortii, Flensburgi et Lipsiae, 832 pp."]}