Search

The integration of livestock with plantations is one of efforts to support livestock agribusiness. The large potential land area can be used for the development of cattle. However, the low production, nutrient content and digestibility of natural grasses in the plantation are still an obstacle to increase cattle productivity. Therefore, the development of shade tolerant of forages is one of the strategies to improve the quality and production of forages in the plantation area. This paper aims to review the role of Stenotaphrum secundatum as a shade tolerant forage in oil palm plantations in supporting cattle productivity. Biomass production of Stenotaphrum secundatum obtained was relatively high at 42,209 kg DM/ha/yr in oil palm plantations aged 3.5 years, estimated to be able to accommodate cattle of 11.8 AU/ha. With a moderate composition of nutrition, it can improve cattle growth performance with an average body condition score of 3.8. The livestock integration system by developing S. secundatum in the oil palm plantation area has a positive effect because it can reduce fertilizer and weeding costs of 4 million IDR/ha/yr. The average production of fresh fruit bunches (FFB) reaching 19.5 tons/ha/yr. It can be concluded that the role of S. secundatum in oil palm plantations can support cattle productivity and increase palm oil production.

Turfgrasses are ubiquitous in urban landscapes and can provide numerous ecosystem services. However, most warm season turfgrasses are produced, planted, and maintained as cultivar monocultures, which may predispose them to herbivore attack and reduce the services lawns provide. Though rarely done, host plant resistance can be used as a strategy to reduce herbivory and preserve beneficial services. Increasing turfgrass cultivar diversity may provide similar or greater benefits through associational resistance, whereas conserving desirable maintenance and aesthetic traits. However, no studies have examined this in warm season turfgrasses. To address this, we evaluated host plant resistance to fall armyworm (Spodoptera frugiperda [J.E. Smith] [Lepidoptera: Noctuidae]) in commercially available cultivars of St. Augustinegrass (Stenotaphrum secundatum [(Walt.) Kuntz] [Lepidoptera: Noctuidae]) and then investigated if the resistance or susceptibility of St. secundatum cultivars carried over in mixed cultivar plantings. Through a no-choice experiment and a limited-choice experiment, we detected no host plant resistance in monocultures of St. secundatum cultivars. However, we did find that as cultivar diversity increased, female Sp. frugiperda larval weight and herbivory decreased. Additionally, choice tests indicated that larvae prefer less diverse stands of St. secundatum cultivars. Interestingly, our results suggest that in the absence of host plant resistance, warm season turfgrass cultivar diversity may reduce herbivore pest fitness and damage. These results demonstrate that warm season turfgrass cultivar diversity may be a viable integrated pest management tool that warrants further investigation.

Made available in DSpace on 2022-05-01T08:44:44Z (GMT). No. of bitstreams: 0 Previous issue date: 2021-01-01 Successive mowing are the major maintenance costs of lawns. Thus, both the expenditure with mowing and the visual and physiological aspect of the lawn have led to the search for alternatives to mechanical management. Thus, this work aimed to study the effects of different rates of imazapic herbicide applied alone or combined with imazapyr as a growth regulator of Bahiagrass (Paspalum notatum) and St. Augustine grass (Stenotaphrum secundatum). The experimental design was a randomized block with four replicates, and the treatments consisted of six rates of imazapic herbicide (35; 70; 105; 140; 175 and 210 g a.i. ha-1) for both species, three rates of imazapic + imazapyr in tank mix (15.57 + 5.25; 23.625 + 7.875; 32.5 + 10.5 g a.i. ha-1) for Bahiagrass and four rates of imazapic + imazapyr mixture (7.875 + 2.625; 15.57 + 5.25; 23.625 + 7.875; 32.5 + 10.5 g a.i. ha-1) for St. Augustine grass. The effect of the treatments was evaluated by observing visible injury symptoms, canopy height, height and number of inflorescences and total dry matter of clippings. Applications of imazapic alone or combined with imazapyr were effective in reducing plant height, number and height of inflorescences and total amount of dry matter of clippings produced by Bahiagrass plants. Imazapic provided satisfactory control of St. Augustine growth, but its utilization caused an increase in the number of inflorescences present in the lawns. São Paulo State University Department of Agronomy State University of Mato Grosso Department of Plant Science São Paulo State University São Paulo State University Department of Plant Science São Paulo State University

Soil nitrification (microbial oxidation of ammonium to nitrate) can lead to nitrogen leaching and environmental pollution. A number of plant species are able to suppress soil nitrifiers by exuding inhibitors from roots, a process called biological nitrification inhibition (BNI). However, the BNI activity of perennial grasses in the nutrient-poor soils of Australia and the effects of BNI activity on nitrifying microbes in the rhizosphere microbiome have not been well studied. Here we evaluated the BNI capacity of bermudagrass (Cynodon dactylon L.), St. Augustinegrass (Stenotaphrum secundatum (Walt.) Kuntze), saltwater couch (Sporobolus virginicus), seashore paspalum (Paspalum vaginatum Swartz.), and kikuyu grass (Pennisetum clandestinum) compared with the known positive control, koronivia grass (Brachiaria humidicola). The microbial communities were analysed by sequencing 16S rRNA genes. St. Augustinegrass and bermudagrass showed high BNI activity, about 80 to 90% of koronivia grass. All the three grasses with stronger BNI capacities suppressed the populations of Nitrospira in the rhizosphere, a bacteria genus with a nitrite-oxidizing function, but not all of the potential ammonia-oxidizing archaea. The rhizosphere of saltwater couch and seashore paspalum exerted a weak recruitment effect on the soil microbiome. Our results demonstrate that BNI activity of perennial grasses played a vital role in modulating nitrification-associated microbial populations.

The obstacle in planting and developing forage plants is limited land. One solution to anticipate this is to utilize land in plantations by introducing forage shade-tolerant among the main crops. The area of oil palm plantations in Indonesia reaches 14,677,560 ha potentially used in the integration system. This article outlines the superiority of Stenotaphrum secundatum from the selection results so that the reader gets comprehensive information about this grass, both in terms of production, nutritional quality and digestibility. Stenotaphrum secundatum selection’s variety grass is a forage shade tolerant that had derived by positive mass selection method which had had been tried it’s adaptability at two different elevation in North Sumatra. This grass is very suitable to be integrated in plantation land. The average fresh yield of S. secundatum at 55 and 75% shading level reached 2,386 and 2,001 g/m2/harvest, respectively. The digestibility of Steno grass selection’s result on growing Boerka goat shows a fairly good value, which ranges from 60.7% to 72.8%. Palatability of S. secundatum grass in goats is very good with consumption reaching 3.6% of body weight. S. secundatum grass, besides being tolerant of shade, is also resistant to pests, as long as it is maintained with good management. The crossing of polyploid Steno grass with diploid has produced drought tolerant varieties. This grass also has advantages in terms of dry matter production, nutrient content and crude protein production compared to other grass species and can be planted in wider plantation areas with 55-75% shade.

Irrigation of residential and commercial lawns in excess of plant water requirements can result in waste of potable water supply and negative public perception regarding turf landscapes. A 3-year field study was conducted to evaluate simple historical ETo-based irrigation scheduling for maintenance of St. Augustinegrass [Stenotaphrum secundatum (Walt.) Kuntze ‘Raleigh’] lawns in College Station, TX, USA. Whole main plots were assigned crop coefficients of 1.00, 0.60, 0.36, or 0.24 (K100, K60, K36, and K24) used to adjust historical ETo (47-year average). Sub-plots received N rates of either 0.0, 0.4, or 0.8 kg ha−1 month−1 during the experimental period each year. Irrigation treatments were applied 3 days per week from July through September each year. Acceptable turf quality was maintained when irrigation depths were ≥47% of actual ETo. The K60 treatment provided adequate irrigation for turf performance but caused 31% overwatering in the wettest year. The K36 treatment resulted in acceptable turf quality not only in the wettest year, but also showed complete recovery of the turf sward by the end of fall in each year. This research has outlined a simple and effective method for conserving water used to irrigate St. Augustinegrass lawns.

The potential growth of buffalo grass (Stenotaphrum secundatum) and couch grass (Cynodon dactylon) on artificial floating islands (AFIs) and their ability to remove total nitrogen (TN) and total phosphorus (TP) from a simulated paper mill wastewater was studied. This was done to assess the potential of AFIs for removal of nutrients from aerated stabilization basins (ASBs) that had occasional growth of blue-green algae (BGA) to bloom levels. Small scale AFIs were prepared using polyethylene foam and planted with the grasses in 30 L of tested water. Trials were conducted in a plastic covered greenhouse over a three-month period where temperatures ranged from 15 to 44 °C. The results showed that both buffalo and couch grasses can adapt to planting in AFIs showing increases of 125% and 148% in wet weight, respectively. Nutrient uptake by buffalo grass and couch grass were found to be similar. Percentage uptakes of TP and TN from the synthetic water by the buffalo grass were 82% and 47%, whereas by couch grass, uptakes were 83% and 45%, respectively.

In May 2014, 11 sandy soil samples were collected at a depth of about 5 to 15 cm from a golf course community in Wilmington, NC, composed of Bermudagrass (Cynodon dactylon) from the fairway, St. Augustinegrass (Stenotaphrum secundatum) from the lawn, and Zoysiagrass (Zoysia japonica) from the tee, all of which showed spotted yellowing and necrosis. Plant-parasitic nematodes were extracted from soil samples by a combination of elutriation and sugar centrifugal-flotation methods at the North Carolina Department of Agriculture and Consumer Services, Nematode Assay Lab, Raleigh, NC. The results revealed the presence of several plant-parasitic nematodes, with a stubby-root nematode (Trichodoridae) present. Population densities of stubby-root nematodes were 10 to 90 (average 50) nematodes per 500 cm3 of soil. This species was clearly different from the parthenogenetic stubby-root nematode Nanidorus minor (Colbran, 1956) Siddiqi, 1974 commonly found in North Carolina because of the presence of males and larger body size. Morphological and molecular analyses of this nematode identified the species as Trichodorus obtusus Cobb, 1913. Morphological features of T. obtusus specimens were examined in glycerol permanent mounts. Males (n = 5) had a ventrally curved spicule, three ventromedian precloacal papillae (one ventromedian cervical papilla anterior to the excretory pore, one pair of lateral cervical pores at the level of the ventromedian cervical papilla), and a tail with a non-thickened terminal cuticle. Males were 860 to 1,120 (average 1,018) μm long, body width 38 to 48 (42) μm, onchiostyle 53 to 60 (56) μm, and spicule 54 to 62 (59) μm. Females (n = 5) had a pore-like vulva, a barrel-shaped vagina, and one or two postadvulvar lateral body pores on each side. Females were 990 to 1,330 (1,148) μm long, body width 43 to 56 (48) μm, onchiostyle 50 to 64 (58) μm, and V 49.0 to 57.5% (53.0%). The morphology agreed with the description of T. obtusus (2). DNA was prepared by squashing a single nematode (n = 3) on a microscope slide and collecting in 50 μl of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0). The 18S rDNA region was amplified with the forward primers 18S-G18S4 (5′ GCTTGTCTCAAAGATTAAGCC 3′), SSUF07 (AAAGATTAAGCCATGCATG), and 18S965 (GGCGATCAGATACCGCCCTAGTT) and reverse primers 18S-18P (TGATCCWKCYGCAGGTTCAC), SSUR26 (CATTCTTGGCAAATGCTTTCG), and 18S1573R (TACAAAGGGCAGGGACGTAAT). The 28S D2/D3 region was amplified with the forward primer 28S391a (AGCGGAGGAAAAGAAACTAA) and reverse primer 28S501 (TCGGAAGGAACCAGCTACTA) (4). The resulting 18S (1,547-bp) and 28S D2/D3 (925-bp) sequences were deposited in GenBank under the accession numbers KM276665 and KM276666. The 18S sequence data was 100% homologous with two populations of T. obtusus (JX279930, 898 bp, and JX289834, 897 bp) from South Carolina and one (AY146460, 634 bp) from an unknown source, each with a 1-bp difference in a Blastn search. The 28S D2/D3 sequence data was less than 90% homologous with many Trichodorus species, but no T. obtusus sequence data was available. T. obtusus is known to occur only in the United States and to damage turfgrasses. It is reported in the states of Virginia, Florida, South Carolina, Texas, Iowa, Kansas, Michigan, New York, and South Dakota. This nematode has been reported as a pathogen of bermudagrass in Florida (1) and South Carolina (3), but pathogenicity to St. Augustinegrass and Zoysiagrass is unknown. To our knowledge, this is the first report of T. obtusus on turfgrasses in North Carolina. References: (1) W. T. Crow and J. K. Welch. Nematropica 34:31, 2004. (2) W. Decraemer. The Family Trichodoridae: Stubby Root and Virus Vector Nematodes. Kluwer Academic Publishers, Dordrecht, The Netherlands, 1995. (3) J. B. Shaver et al. Plant Dis. 97:852, 2013. (4) G. R. Stirling et al. Nematology 15:401, 2013.

The study was done in order to determine the effect of Arbuscular mycorrhizal fungi (AMF) addition in the soil on plant height, fresh weight, dry matter yield and botanical composition of mixed plants of A. pintoi legume and Stenotaphrum secundatum grass within coconut trees. Completely Randomized Design (CRD) was used in this experiment, with 4 treatments as follows: T0 = 0 gr AMF, T1 = 5 gr AMF, T2 =10 gr AMF and T3 = 15 gr AMF, 5 replications each treatment. So, there were 20 of experimental units. Measurements were taken after 30 days of planting. The level of AMF showed a significantly effects (PA. pintoi and S. secundatum. In short, the highest plant height, fresh weight and dry matter yield as well as the more proportional of botanical composition of A. pintoi and S. secundatum were found in the soil with application of 15 gr AMF.

The erosion of drains is a major limitation of the quality, the increasing of banana production and the environmental protection of industrial banana in Cote d'Ivoire. It leads inundations, death of banana trees and significant loss of production. Thence, the construction and the maintenance of drain costs too much and causes injure, snake bite, physical traumatisms, many diseases, … These events compromise the sustainable production of banana by reducing seriously worker’s the activities and finally increase the cost of production. The aim of the present work is to contribute to the sustainable development and human capacity building in the third world nations as far as banana production is concerned. The methods used so far to address this phenomenon proved inefficient. The technology innovation in this area has been to grow grass on the outer edges of the channels drained water. This resulted in a systematic reduction of erosion. Better still, it helped fertilize the soil, reduce the deportations of fertilizer and improve the quality of landscape of the plantations. Stenotaphrum secondatum is the best vegetable specie adapted to the biological control against water erosion of drains.

Developing turfgrass with good drought resistant is a major goal in breeding programs when water scarcity is one of the long-term challenges facing the turfgrass industry. It has been shown that plant transpiration does not decline until available soil water drops below a certain threshold. Studying the species and genotypic differences in this threshold may lead to turfgrass that conserve water and retain turfgrass quality during drought. The objective of this study was to characterize and compare the transpiration response of 19 warm-season turfgrass genotypes and cultivars in five species during soil drying and well-watered conditions in the greenhouse. The species included in the study were: Zoysia japonica (Steud), Zoysia matrella L., common bermudagrass (Cynodon dactylon L. Pers. var. dactylon), African bermudagrass (Cynodon transvaalensis Burtt-Davy), hybrid bermudagrass (C. dactylon L. var. dactylon × C. translvaalensis Burtt-Davy) and St. Augustinegrass [Stenotaphrum secundatum (Walter) Kuntze]. They were evaluated for evapotranspiration rate (ET) and the sensitivity of transpiration to soil drying which was indicated by a break point of the fraction transpirable soil water (FTSW). The range of break point during dry down was from 0.25 to 0.41, and genotypes within species had different ET when well-watered (ETck). Break point values were not correlated with the number of days to the endpoint, where ET declined below 10% of the control. Instead, the number of days to endpoint was negatively correlated with ETck (−0.59, P ≤ 0.01). Thus, these results found significant variability in turfgrass break point and ETck that could contribute to water conservation, and a better understanding of drought responses in warm season turfgrasses.

The role of turfgrasses in C and N cycling in the southeastern U.S. has not been well documented. The objectives of this research were to determine the characterization of chemical quality, clipping decomposition rates, and C and N release from warm- and cool-season turfgrasses. The study was conducted for 46 weeks in 2012 in Auburn, AL. Four warm season turfgrasses were used included (bermudagrass [Cynodon dactylon (L.) Pers. × C. transvaalensis Burtt Davy], centipedegrass (Eremochloa ophiuroides (Munro) Hack), St. Augustinegrass (Stenotaphrum secundatum (Walter) Kuntze), zoysiagrass (Zoysia japonica Steud.), and one cool season turfgrass (tall fescue (Festuca arundinacea Schreb)). Litter was placed into nylon bags at an oven dry rate of 3.6 Mg?ha?1. Litter bags were retrieved after 0, 1, 2, 4, 8, 16, 24, 32, and 46 weeks, and analyzed for total C and N. A double exponential decay model was used to describe mass, C, and N loss. Results indicated that tall fescue decomposition occurred rapidly compared to warm season turfgrasses. Litter mass loss measured after 46 weeks was determined to be 61.7%, 73.7%, 72.2%, 86.8%, and 45.4% in bermudagrass, centipedegrass, St. Augustinegrass, tall fescue, and zoysiagrass respectively. Zoysiagrass litter had a higher lignin concentration, while tall fescue had the lowest lignin. Over 46 weeks’ release of C was in the order: zoysiagrass > bermudagrass = centipedegrass = St. Augustinegrass > tall fescue, and release of N was in the order zoysiagrass > centipedegrass > bermudagrass = St. Augustinegrass > tall fescue. Our study concluded that, zosiagrass is a better choice for home lawns.

As population growth and demands for potable water increase, use of low-quality or effluent sources of irrigation is becoming more prevalent. Because these water sources often contain elevated levels of dissolved salts, turfgrasses must increasingly possess mechanisms for coping with salinity stress. The objectives of this research were to utilize Scanning Electron Microscopy (SEM) combined with Energy Dispersive X-ray Spectroscopy (EDS) to explore and characterize anatomical and physiological responses of four salinity-tolerant cultivars/experimental lines of warm-season turfgrass species including bermudagrass (Cynodon ssp.), zoysiagrass (Zoysia ssp.), St. Augustinegrass (Stenotaphrum secundatum), and seashore paspalum (Paspalum vaginatum) to salinity stress. Grasses were grown in the greenhouse under two levels of salinity stress (control = 2.5 and 30 dS m−1) prior to examination of adaxial and cross-sectional leaf surfaces using SEM and EDS. St. Augustinegrass leaf anatomy did not differ between control and elevated salinity. In bermudagrass, salt glands were observed at the 30 dS m−1 salinity level, however, none were detected at the 2.5 dS m−1 level. Zoysiagrass appeared to possess constitutive salt gland development, which although were present under 2.5 dS m−1 salinity, noticeably increased in density with increasing salinity. Seashore paspalum did not possess salt glands, but rather, exhibited bladder-like structures, in which EDS detected high levels of Na following salinity stress. These findings highlight differences in anatomical responses to salinity stress among warm-season turfgrass species. The information may aid breeders and physiologists in developing a more comprehensive understanding of warm-season turfgrass anatomical responses to salinity stress.

Population growth in towns and cities requires new construction of homes and conversion of native land use to urban and suburban landscapes. Municipal tap water is generally used for irrigating these urban and suburban landscapes and its water quality can differ globally dependent on whether it is sourced from ground or surface waters. We examined runoff dissolved organic carbon (DOC) and organic nitrogen (DON) concentrations, fluxes and exports from newly installed, fertilized and unfertilized St. Augustine (Stenotaphrum secundatum (Walt.) Kuntze ‘Raleigh’) sod irrigated with a sodic municipal tap water during two 5-week establishment periods (August and September). In unfertilized plots, concentrations of DOC in runoff significantly increased from 20.5 to 73.7 mg L-1 and from 29.6 to 113.3 mg L-1 Runoff concentrations of DOC in fertilized plots significantly increased from 27.3 to 72.0 mg L-1 and from 30.0 to 120.3 mg L-1. Concentrations of DON in runoff did not increase in either unfertilized or fertilized plots. Total DOC exports were 2036 ± 803 kg km-2 and 3341 ± 227 kg km-2 and DON exports were 99 ± 43 kg km-2 and 134 ± 15 kg km-2 respectively for the two turfgrass installation dates for the unfertilized plots. Fertilization had no significant effect on DOC and DON exports (p = 0.29 and 0.18). Na+, K+, Mg2+ and Ca2+ were implicated in both DOC and DON fluxes suggesting that as resources for irrigation water for urban landscapes decline and alternative irrigation water supplies such as grey and black water are utilized we would expect, due to their higher Na+ content that DOC and DON fluxes to urban watersheds will increase.

The use of warm season turfgrasses is a consolidated trend in the climatic transition zone of Mediterranean countries, in particular St. Augustinegrass (Stenotaphrum secundatum (Walt.) Kuntze) begins to be widespread in warm coastal areas. However, little is known about the performance of the different cultivars of this species in southern Europe. In 2016-2017 a trial was carried out in three locations in Italy, Padova, Pisa, and Palermo, located in the north, center and south of the country respectively. Four cultivars (Floratine, Captiva, Sapphire, Palmetto) and five ecotypes (CeRTES 201, CeRTES 202, CeRTES 203, CeRTES 204, CeRTES 205) were compared in terms of their growth characteristics and morphological traits during establishment. The results highlighted that stolon growth was significantly affected by the location, as well as green colour retention. Stolon growth rate, internode length and internode volume and turf quality were, however, significantly determined by the accession effect. The quality of the ecotypes was also in some cases comparable to that of the cultivars. In Padova, winterkill occurred in most of the accessions, while in Pisa and Palermo, all the entries survived. In conclusion, St. Augustinegrass is suitable for turf use in the central and southern coastal area of Italy.

St. Augustinegrass [Stenotaphrum secundatum (Walt.) Kuntze] is a warm season turfgrass and is widely used for lawns and landscapes in the southern United States of America. The southern chinch bug (Blissusinsularis Barber) is the most damaging insect of St. Augustinegrass. Use of resistant cultivars is an environmentally sound and sustainable method to control this insect pest. Two newly identified resistant St. Augustinegrass lines (NUF3231 and NUF4872) were compared with three commercial cultivars for turfgrass quality and other important traits. The two lines had turf color and turf visual quality similar to those of Captiva and similar to or better than those of Floratam and Palmetto during the experiment. NUF4872 had higher level of resistance to gray leaf spot than Floratam and Palmetto. Stolon architectures of NUF3231 were similar to those of Captiva whereas NUF4872 had the stolons similar to those of Floratam. The results indicated that the two lines could potentially be released as commercial cul...

Increased urban demand for landscape irrigation, as well as interest in promoting water-use efficient species by municipalities, water purveyors, and homeowners associations emphasize the need for comparative data on consumptive water use by warm-season lawn grasses. The objective of this study was to quantify actual evapotranspiration (ETa) and to develop crop coefficients (Kc) for four warm-season turfgrass species, namely ‘Tifway’ bermudagrass (Cynodon dactylon (L.) Pers. x Cynodon transvaalensis Burtt-Davy), ‘Empire’ zoysiagrass (Zoysia japonica Steud.), ‘Floratam’ St. Augustinegrass [Stenotaphrum secundatum (Walter) Kuntze], and ‘Argentine’ bahiagrass (Paspalum notatum Flugge). Crop coefficients were derived by dividing ETa (measured directly from lysimeter weight change over 24 to 72-h periods) by reference evapotranspiration (ETo) calculated from the ASCE–EWRI Standardized Method using onsite weather station data. Data were collected over three seasons from non-stressed, well-watered turf. For 17 of the 30 measurement periods, Kc did not differ among the 4 species, and on 24 of 30 periods zoysiagrass, bermudagrass, and St. Augustinegrass Kc did not differ from one another. A trend toward elevated Kc was observed in bahiagrass in years 2 and 3, particularly during early spring measurement periods. Kc values for all species fluctuated across seasons and years, peaking to ∼0.8 during active growth periods when vapor pressure deficit and solar radiation were greatest, and declining to ∼0.3 in late fall and winter. Root growth differences among the species appeared to have a stronger relationship to ET rates than did shoot growth rate. Results demonstrated that the commonly recommended warm-season turf coefficient of 0.6, while approximating overall average annual ETa, under-predicted ETa during active growth periods and over-predicted ETa during late fall and winter periods, when turf was slowly growing or quiescent. The results indicate seasonal refinement of Kc values may be needed to more effectively meet consumptive water use requirements of warm-season turfgrasses.

Proper management of turfgrass systems is critical for reducing the risk of nutrient loss and protecting urban surface waters. In the southern United States, irrigation can be the most significant management practice regulating the biogeochemical and hydrological cycles of turfgrass systems. A turfgrass runoff research facility was used to assess the effects of deficit irrigation and fertilizer applications on turfgrass canopy cover and nitrate-N (NO₃–N) exports in runoff from St. Augustinegrass [Stenotaphrum secundatum (Walt.) Kuntze] turf over a 2-yr period. Treatments were arranged as a randomized complete block design having eight combinations of irrigation (100, 75, or 50% of estimated turfgrass water requirements) and fertility level (0, 88, and 176 kg N ha⁻¹ yr⁻¹). Runoff from 31 rainfall events and one irrigation excess event were used to estimate annual and seasonal NO₃–N exports. The majority of annual NO₃–N exports occurred during the late winter and spring. Deficit irrigation reduced summer and early autumn runoff volumes. Lower summer and autumn runoff volumes (from deficit irrigation) coincided with reduced NO₃–N exports from runoff during Year 1. Deficit irrigation combined with fertilizer applications increased runoff [NO₃–N] in Year 2, suggesting that the previous year’s export reduction contributed to higher N accumulation in the system and thus a higher N loss potential. These findings suggest that deficit irrigation can be a tool for reducing seasonal nutrient exports from St. Augustinegrass lawns so long as fertilizer inputs are moderate.

St. Augustine grass (Stenotaphrum secundatum (Walter) Kuntze) is an economically important turfgrass in the southeastern United States. However, this turf species is prone to southern chinch bug, Blissus insularis Barber (Heteroptera: Blissidae) outbreaks. This insect is the most destructive pest of St. Augustine grass wherever this turf grass is grown. Host plant resistance has historically been an effective management tool for southern chinch bug. Since 1973, the 'Floratam' St. Augustine grass cultivar effectively controlled southern chinch bug in the southeast. However, southern chinch bug populations from Florida and Texas have now circumvented this resistance, through mechanisms still unknown. Therefore, identifying and deploying new cultivars with resistance to the southern chinch bug is imperative to combat this pest in an economically and environmentally sustainable manner. Currently, the number of cultivars with resistance against southern chinch bug is limited, and their efficacy, climatic adaptability, and aesthetic characters are variable. Hence, the main focus of this study is the identification of alternative sources of resistance to southern chinch bugs in previously uncharacterized St. Augustine grass plant introductions (PIs) and its closely related, crossbreeding species, Pembagrass (Stenotaphrum dimidiatum (L.) Brongniart). The PIs exhibited a wide range of responses to southern chinch bug feeding, as indicated by damage ratings. Damage ratings for seven PIs grouped with our resistant reference cultivars. Moreover, nine PIs exhibited antibiosis, based on poor development of southern chinch bug neonates, when compared with our susceptible reference cultivars. Altogether our study has produced strong support to indicate these materials are good candidates for future southern chinch bug resistance breeding in St. Augustine grass.

Warm season turf taxa of centipedegrass [Eremochloa ophiuroides (Munro) Hack], bermudagrass [Cynodon L.C. Rich, spp.], St. Augustinegrass [Stenotaphrum secundatum (Walt.) Kuntze], and zoysiagrass [Zoysia Willd. spp.] were evaluated for tolerance to adult twolined spittlebug (Prosapia bicincta Say) feeding in choice and no-choice experiments, and for their ability to support nymphal development (antibiosis potential). Among 133 selections evaluated, few showed evidence of potential antibiosis and/or improved tolerance over commercially available cultivars. Most of the centipedegrass taxa evaluated were susceptible to the spittlebug. However, some potential antibiosis among Chinese centipedegrass taxa was identified, and there was a gradient in the ability to tolerate spittlebug feeding. Among centipedegrasses, TC 358 and TC 362 showed moderate tolerance and recovery in no-choice and choice trials. The most tolerant bermudagrasses in no-choice trials were 00 - 23, 03 - 14, and 03 - 15. Centipedegra...

St. Augustinegrass (Stenotaphrum secundatum) is a warm-season grass species commonly utilized as turf in the southeastern US. Improvement in the drought tolerance of St. Augustinegrass has significant value within the turfgrass industry. Detecting quantitative trait loci (QTL) associated with drought tolerance will allow for advanced breeding strategies to identify St. Augustinegrass germplasm with improved performance for this trait. A multi-year and multi-environment study was performed to identify QTL in a ‘Raleigh’ x ‘Seville’ mapping population segregating for phenotypic traits associated with drought tolerance. Phenotypic data was collected from a field trial and a two-year greenhouse study, which included relative water content (RWC), chlorophyll content (CHC), leaf firing (LF), leaf wilting (LW), green cover (GC) and normalized difference vegetative index (NDVI). Significant phenotypic variance was observed and a total of 70 QTL were detected for all traits. A genomic region on linkage group R6 simultaneously harbored QTL for RWC, LF and LW in different experiments. In addition, overlapping QTL for GC, LF, LW and NDVI were found on linkage groups R1, R5, R7 and S2. Sequence alignment analysis revealed several drought response genes within these regions. The QTL identified in this study have potential to be used in the future to identify genes associated with drought tolerance and for use in marker-assisted breeding.

The southern chinch bug, Blissus insularis Barber, is the most damaging insect pest of St. Augustinegrass, Stenotaphrum secundatum (Walt.) Kuntze. However, there is little understanding of the impact of the insect feeding on the plant biomass or nutrient flux in tissues. The objective of this study was to measure biomass and nutrient change in St. Augustinegrass caused by feeding of southern chinch bugs. Chinch bugs were collected by vacuuming infestations in commercial and residential lawns in southern Florida. After collection, chinch bugs were placed in buckets containing St. Augustinegrass potted plants whereas controls were plants with no chinch bugs. Nutrient concentrations were measured for nine elements (N, P, K, Ca, Mg, Mn, Fe, Cu, Zn) in leaf and stolon tissue. At the termination of the test, chinch bug treated buckets had >100 chinch bugs/bucket in them and controls had none. Stolons were 31% shorter in chinch bug exposed plants than controls with no chinch bugs. Above-ground dry matte...

As a result of increasing demand for potable water, local and national initiatives to conserve municipal water supplies have been implemented. Many of these initiatives focus on reducing irrigation of turfgrass in urban landscapes and may totally ban irrigation during periods of severe water shortage. Proper selection of adapted turfgrass species and cultivars is vital to long-term water conservation initiatives. Turfgrasses that can survive and recover from extended hot and dry periods under limited to no irrigation would best meet water conservation objectives. The present study was conducted to evaluate the recuperative potential of transplanted plugs of 24 commonly grown cultivars of three warm-season turfgrass species after incremental increases in water stress imposed by withholding all water for up to 60 days. A 2-year field study was conducted consisting of eight blocks containing 25 plots each. Each block was planted with one plot each of eight cultivars of bermudagrass (Cynodon dactylon sp.), seven cultivars of st. augustinegrass (Stenotaphrum secundatum sp.), and nine cultivars of zoysiagrass (five of Zoysia japonica sp. and four of Zoysia matrella sp.). Four blocks were planted on native soil with no restriction to rooting, whereas the other four had an effective root zone of only 10 cm of soil. Cup cutter plugs were collected at predetermined intervals, transported to College Station, TX, replanted, and grown under well-watered conditions. Measurements of the lateral spread of the plugs were taken every 10 to 14 days for the first 60 to 70 days after planting (DAP). The lateral spread of plugs collected after 0 days of summer dry-down (DSD) was greatest for bermudagrass, intermediate for st. augustinegrass, and lowest for zoysiagrass. In most cases there were no consistent differences between cultivars within a species. All species grown on the 10-cm deep root zone were unable to survive the 60-day period without water and died within the first 40 days. For each species, lateral spread was increasingly delayed or reduced with increasing DSD. Although all three species grown on native soil were able to survive and recover from a 60-day period without water, the bermudagrass cultivars had the most rapid recovery rates measured as lateral spread of transplanted plugs.

Understanding responses of turf grasses to drought stress is important for water resource management to maintain an acceptable level of quality for turfs under prolonged drought conditions. Four cultivars of St. Augustine grass (SA) (Stenotaphrum secundatum [Walt.] Kuntze) were evaluated for morphological and physiological responses to four watering treatments in greenhouse studies. Soil moisture treatments had greater impact on stolon number, photosynthetic rate, and dry matter production than on leaf sheath length and chlorophyll fluorescence. Full irrigation and the 75% field capacity (FC) did not result in significant differences in most of the characteristics, whereas the 25% FC significantly reduced morphological growth, physiological activities, and dry matter production of cultivars. The time when the morphological characteristics started showing differences among the watering treatments varied, with stolon numbers beginning to show response to watering treatments at week 2 (two weeks after wateri...

Warm-season turfgrasses may be subjected to increasing drought as future urban irrigation regulations become more restrictive. Species differences in water use and transpiration response to drying soil may be exploited in the future to increase survival and maintain green color under drying soil conditions. This study was undertaken to provide background documentation on the sensitivity to soil–water deficit of three warm-season grasses: ‘Argentine’ bahiagrass (Paspalum notatum); ‘Floratam’ St. Augustinegrass (Stenotaphrum secundatum), and ‘Empire’ zoysiagrass (Zoysia japonica). Each of these turfgrasses demonstrated a two-phased linear transpiration response to gradually drying soil as expressed by a normalized ratio between the transpiration rates of drought stressed to well-watered plants (NTR). In this study, well-watered bahiagrass used 30% more water on a daily basis than did well-watered St. Augustinegrass or zoysiagrass. However, under drought, the three grass species transpired the same amount of water during the soil drying period up until NTR to 0.1. Since bahiagrass reached an NTR of 0.1 at 10.3 days versus 12.7 and 13.0 days for St. Augustinegrass and zoysiagrass, respectively, bahiagrass demonstrated a more rapid water loss rate during the drying period. The fraction of transpirable soil water (FTSW) remaining in the soil at the breakpoints for bahiagrass, St. Augustinegrass and zoysiagrass were 0.13, 0.16, and 0.19, respectively, in 2010, but were 0.18, 0.30, and 0.22, respectively, under slightly warmer conditions in 2011. The consistently low FTSW breakpoint for bahiagrass means that compared to the other species, bahiagrass continues to use water at a high rate late into the soil drying cycle before conserving soil water by decreasing stomatal conductance. That is, bahiagrass is likely to be subjected to greater soil–water deficits in lengthy droughts and needs mechanisms to better survive these droughts. The differences in breakpoints by year may be due to a combination of soil factors and temperature differences in the greenhouse.

St. Augustinegrass, Stenotaphrum secundatum (Walt.) Kuntze, is used as lawn grass throughout the southern United States for its wide adaptation to varying environmental conditions. The southern chinch bug, Blissus insularis Barber, is the plant's most damaging insect pest. Host plant resistance of St. Augustinegrass has been determined in numerous studies using various techniques. However, efficacy of these various procedures in determining St. Augustinegrass resistance to southern chinch bug has not been determined. The objective of this study was to determine the effect of time and methodologies in assesing St. Augustinegrass resistance to southern chinch bugs. Four varieties were tested for resistance using 4 methods (bag, jar, box, tube) and 5 time intervals to measure chinch bug mortality. Overall, survival was greater in whole-plant methods (box and tube) than excised stolon methods (bag and jar). The bag test gave the most erratic results of the 4 methods. The effect of time in determining...

In Mediterranean areas, very scarce rainfalls during the summer season are a limiting factor to the sowing and managing of turfgrasses. This work evaluates the response to different irrigation regimes (50 or 75% of reference evapotranspiration) of Cynodon dactylon (L.) Pers. cv Transcontinental , Paspalum vaginatum Swartz cv Salam , Pennisetum clandestinum (Chiov.) Hochst. cv AZ1 , Stenotaphrum secundatum (Walt.) Kuntze cv Palmetto and Zoysia japonica Steud. cv El Toro . Performance of turfgrasses was evaluated in term of turf quality, colour index and ground cover. Only when rainfalls were scarce, water regime restoring the 75% of the evapotranspiration (ET o ) showed significant effects. Under rainy conditions, the restoration of only the 50% of ET o was able to give highly acceptable values. The best performance was observed for Z. japonica , C. dactylon and P. vaginatum , whereas P. clandestinum and S. secundatum showed lower adaptability to water stress.

St. augustinegrass (Stenotaphrum secundatum (Walt.) Kuntze) is a popular turfgrass in the southern United States as a result of its superior shade tolerance and relatively low input requirements. However, it is the least cold-tolerant of commonly used warm-season turfgrass species. 'Raleigh', released in 1980, has superior cold tolerance and is adapted and widely used in U.S. Department of Agriculture hardiness zones 8 to 9. More than 25 years after its release, 'Raleigh' is still the industry's standard in terms of cold tolerance. However, the original foundation and breeder stock fields of the cultivar have been lost, placing the integrity of the cultivar at risk. The objectives of this study were to investigate whether current 'Raleigh' production fields across the southern United States are true to the original source. In this study, 15 amplified fragment length polymorphism (AFLP) primer combinations were used to assess levels of genetic variability among three original stocks of 'Raleigh' and 46 samples obtained from sod farms and universities in six states. Genetic similarities among the original stocks were Sij = 1, whereas similarities between this group and all other samples ranged from 0.24 to 1.0. Results based on cluster analysis, principal coordinate analysis, and analysis of molecular variance (AMOVA) revealed separation between original stocks of 'Raleigh' and some commercial samples. Results from this study offer further evidence that molecular markers provide a useful and powerful technique for identity preservation of clonally propagated cultivars and the detection of genetic variants in sod production fields and turfgrass breeding programs. St. augustinegrass (Stenotaphrum secun- datum (Walt.) Kuntze) is a coarse-textured, warm-season, perennial turfgrass species well adapted for home lawns and commercial landscapes across the southern United States and upward into the southern regions of the

The southern chinch bug (Blissus insularis Barber) is the most damaging insect pest of St. Augustinegrass (Stenotaphrum secundatum Walt. Kuntze), across the southern U.S.A. Susceptibility to the southern chinch bug and reproductive potential of the bugs on 24 cultivars from 7 genera in 8 turfgrasses were evaluated under greenhouse conditions. Stenotaphrum secundatum (‘Raleigh’, ‘Texas Common’, and ‘Captiva’) cultivars were the most susceptible among all the turfgrass genera and each produced populations ≥97.5 bugs per 15-cm diameter plant within the 11-week test period from Jul to Sep 2008. Substantial populations also developed on zoysiagrass (Zoysia spp.) (‘Emerald’, ‘Empire’, ‘Palisades’, and ‘Zorro’) cultivars and on ‘609’ buffalograss (Buchloe dactyloides (Nutt.) Engelm.). Low population development was recorded on cultivars of bermudagrass (Cynodon spp.), centipedegrass (Eremochloa ophiuroides (Munro) Hack.), seashore paspalum (Paspalum vaginatum Swartz), bahiagrass (Paspalum notatum Flugge...

The influence of turfgrass genotype (bermudagrass, Cynodon dactylon (L.), centipedegrass Eremochloa ophiuroides Munro Hack, St. Augustinegrass Stenotaphrum secundatum [Walt.] Kuntze, zoysiagrass, Zoysia spp., and tall fescue, Festuca arundinacea Schreb) on occurrence of hymenopteran parasitoids was evaluated in residential turf during May, June and July in 2005. Most wasps belonged to Chalcidoidea (55%) and Platygastroidea (29%). Adult wasps representing Mymaridae, Platygastridae, Scelionidae and Braconidae were captured in all turfgrasses. Among all wasps, 26.5% were mymarids and included Gonatocerus sp. and Mymar sp. Eulophidae, Aprostocetus and Pnigalio sp. were less abundant in centipedegrass compared with other turfgrasses. Trichogrammatids (18.2% of total wasps) were more abundant in St. Augustinegrass or tall fescue than in zoysiagrass. Platygastrid wasps, Allotropa and Fidiobia sp., were most often collected from zoysiagrass and St. Augustinegrass. Scelionids represented 23% of the total parasitoi...

Methods are needed for utilizing nutrients contained within animal wastewater lagoons. One potential method for capturing nutrients in a useful form is to grow vegetation on the lagoon. A study was conducted from 2005 to 2008 to determine the feasibility of growing vegetation on floating platforms on a single-stage swine wastewater lagoon. Five species were selected from earlier studies as having potential for growth on a commercial swine farm wastewater lagoon: common bermuda grass (Cynodon dactylon (L.) Pers.), Tifton 85 bermuda grass (Cynodon dactylon (L.) Pers.), St. Augustine grass (Stenotaphrum secundatum (Walter Kuntze)), fall panicum (Panicum dichotomiflorum (L.) Michx.), and giant reed (Arundo donax L.). The plants were periodically harvested as needed, and the biomass was weighed and analyzed for N, P, K, Ca, Mg, S, Al, B, Cd, Cr, Cu, Fe, Mn, Mo, Na, Ni, Pb, and Zn. Giant reed and St. Augustine grass were found to be unsuitable for long-term growth on the wastewater lagoon. The greatest biomass production (sum of six cuttings) was 3.6 kg m-2 dry matter from Tifton 85 bermuda grass, followed by common bermuda grass (3.2 kg m-2 dry matter) and fall panicum (3.1 kg m-2 dry matter). All of the plant species accumulated greater than 1000 ppm Na. Nutrient (N, P, and K) uptake and removal from the wastewater with biomass harvesting was primarily a function of biomass produced. The greatest annual uptake and removal of N and P from the wastewater was by Tifton 85 bermuda grass in 2006, where three cuttings of the floating vegetation removed totals of 69 and 25 g m-2 N and P, respectively. Annual uptake and removal of K was greatest by fall panicum, where uptake and removal by three cuttings in 2007 totaled 78 g m-2. In 2008, weeds that had populated the mats were harvested for biomass and elemental uptake. Uptake and total removal of nutrients in two cuttings of the weeds in 2008 was lower than what was observed with the planted species. Total uptake and removal of N, P, and K by the weeds in 2008 was approximately 30, 10, and 30 g m-2. The study showed that plant species exist that can grow and thrive on single-stage anaerobic wastewater lagoons on floating platforms for at least two years while taking up N, P, and K from the wastewater. Harvesting of biomass (which could potentially be used as a soil amendment or as cellulosic feedstock for bioenergy) from floating mats hence could be a mechanism for animal producers to both remove and productively use nutrients contained in the wastewater.

In Florida, state agencies are concerned about St. Augustinegrass [Stenotaphrum secundatum (Walt.) Kuntze] for being a possible high water user and excess (N) applications in home lawns. This has resulted in a desire by some municipalities to substitute St. Augustinegrass with bahiagrass (Paspalum notatum Flugge). Consequently, the aim of this study was to determine the effect of different N fertilizer rates on water use and turf quality of bahiagrass and St. Augustinegrass commonly used in residential yards. The experiment was a split-plot randomized complete block design repeated over two trials. Whole plots arranged in blocks consisted of either bahiagrass cultivar 'Pensacola' or St. Augustinegrass cultivar 'Floratam'. Subplots consisted of two N rates (98 and 294 N kg ha -1 yr -1 ). Water use rates, was influenced by grass type and by N rates with bahiagrass having higher water use rates (WURs) than St. Augustinegrass in one of the two trails. The high N rate increased turfgrass WURs but only in Trial 1. In both trials clipping yields (CY) were greater for bahiagrass than St. Augustinegrass. Furthermore, the higher N rate produced greater CY than the lower N rate. All treatments produced acceptable turfgrass quality when averaged for each trial though, not for ever cycle. Bahiagrass generally produced superior quality ratings than St. Augustinegrass. In addition, the higher N rate always produced higher quality scores than the lower N rate.

As water resources become restricted for use on amenity turfgrass systems, the inability for consumers to delineate incremental drought stress relating to plant health can result in the misuse of water resources during drought conditions. Seven cultivars of St. Augustinegrass (SA) [Stenotaphrum secundatum (Walt.) Kuntze] and two root zone depths were evaluated for drought response and recovery during consecutive 60-d drought and 60-d recovery periods over 2 yr. Using digital image analysis, drought response and recovery were quantifi ed as the number of days to decrease or increase to 50% green ground cover, respectively. Both study years provided unique conditions for investigating drought response as the mean time to reach 50% green ground cover differed by 24 d between the 2 yr of study. Some SA cultivars lost 50% green ground cover in 23 d while other cultivars lasted the entire 60 d drought period without losing 50% green ground cover. Floratam provided the most consistent drought response and recovery compared to other SA cultivars. Once water was no longer limited, cultivars demonstrated up to a 52 d difference in attaining 50% green ground cover. Results could signifi cantly impact home consumer irrigation behaviors and infl uence consumer expectations of turfgrass following drought conditions.

The southern chinch bug, Blissus insularis Barber (Hemiptera: Blissidae), is the most destructive insect pest of St. Augustinegrass, Stenotaphrum secundatum (Walt.) Kuntze. Management of B. insulaiis has depended on frequent insecticide applications, which has resulted in populations becoming resistant to several insecticide classes. To facilitate developing a resistance management program for this pest, it is necessary to develop methods to rear insects of known age, generation, and pesticide exposure history. Synchronized rearing methods were developed after testing five different laboratory methods. The use of glass jars and a combined diet of fresh corn, Zea mays L., cob and St. Augustinegrass proved to be best for producing B. insuhris of known age and generation. Body size was consistent over nine generations of rearing. Production of a high proportion of brachypterous B. insuhris (the nondispersal adult form) also suggests that populations were not stressed during laboratory rearing. This work presents the first successful synchronized rearing method for B. insuhris.

Red imported fire ant, Solenopsis invicta Buren (Hymenoptera; Formicidae) is a major pest in urban landscapes including residential/commercial lawns, sports fields, golf courses, parks, and highway rights-of-way. Foraging preferences for various turfgrass clippings were investigated under controlled lab conditions. Among bermudagrass (Cynodon sp.) cultivars, clippings of ‘Tifway’ and ‘Baby’ were 7 times more preferred than clippings of ‘Tifton 10’ and ‘GN1’. The Texas bluegrass × Kentucky bluegrass hybrid (Poa pratensis L. × P. arachnifera Torr.), TXKY 00-34-2 had 5 times more foraging ants on it than TXKY 01-59-9. Among the zoysiagrasses (Zoysia japonica), ‘El Toro’ was only 2 times more preferred than ‘Crowne’. For St. Augustinegrass (Stenotaphrum secundatum Walt. Kuntze), ‘BitterBlue’ was 3.4 times more preferred than ‘Floratam’. On the buffalograss cultivars (Buchloe dactyloides (Nutt.) Engelm.), there were 2 and 4 times more ants foraging ‘Texoka’ than either ‘Prairie’ or ‘Bison’, respective...

Nitrogen and P leaching losses from fertilized turfgrass remain an environmental concern. In the present study, we examined the effects of sod type, fertilization, and irrigation on turf quality, NO 3 –N and PO 4 –P leaching following St. Augustinegrass [Stenotaphrum secundatum (Walt.) Kuntze] sod installation. Treatments included muck- vs. sand-produced sod, no fertilization, fertilization with 4.9 g N m –2 at installation or at 30 d after installation (DAI), and routine irrigation or irrigation at stress from 30 to 60 DAI. Drainage was collected from lysimeters installed in each plot and analyzed for NO 3 –N and PO 4 –P to determine total leaching losses. Across all treatments, drainage averaged 290, 902, and 604 mm during each of the three trials. Fertilization at 30 DAI signifi cantly reduced PO 4 –P leaching losses compared to fertilization at 0 DAI. Muck sod type signifi cantly reduced the quantity of NO 3 –N leached. Muck sod also signifi cantly reduced PO 4 –P leached and resulted in better turf quality in two of the three trials. In the context of minimizing nutrient leaching, these results support the use of muck-grown sod established during low rainfall periods with fertilization delayed at least 30 DAI and with judicious use of irrigation.

Sting nematodes (Belonolaimus longicaudatus) can injure roots of many warm-season turfgrasses in sandy, well-drained soils and on artificial, sand-based putting greens. Resistant or tolerant grasses could reduce the need for chemical control. This research was initiated to assess the host status and relative tolerance of six warm-season genotypes—four zoysia-grasses (Zoysia Willd.), one St. Augustinegrass [Stenotaphrum secundatum (Walt.) Kuntze], and one bermudagrass [Cynodon dactylon (L.) Pers. x C. transvaalensis Burtt—Davy]—to the sting nematode by two screening methodologies in sequential glasshouse trials in 2007. All entries were hosts with final sting populations 1.7 to 11.0 times greater than initial inoculation levels. Results indicate that evaluating root lengths of unestablished sprigs under sting nematode pressure may improve the identification of genotypes with greater genetic tolerance than in methods using established plants. Total root lengths were not reduced by sting nematodes in UFZ-10, indicating greater tolerance than found in other entries. Treatments of 'Empire', 'Cavalier', 'Emerald', 'TifEagle', and 'Floratam' inoculated 45 d after planting exhibited total root length reductions of 24, 29, 29, 32, and 37%, respectively, when compared with uninoculated controls. The observed variability suggests that gains from selecting for sting nematode resistance or tolerance are possible in zoysiagrass.

St. Augustinegrass [Stenotaphrum secondatum (Walt.) Kuntze] is a home lawn grass widely used in the southern United States. At present, phosphorus (P) fertilization of St. Augustinegrass is based primarily on Mehlich 1 P test. One criticism of Mehlich 1 extractant is that it extracts some fraction of soil P pool that is not available to plants, whereas, iron (Fe) oxide P and water‐extractable P methods are reported to be better related to plant growth in some cases. Literature relative to the soil test procedure comparison for St. Augustinegrass was not found. The objective of this study was to evaluate Mehlich 1 P, Fe oxide P, and water‐extractable P to identify the most suitable soil test method for St. Augustinegrass growth. Established pots of ‘Floratam’ were subjected to P application of 0, 0.14, 0.27, 0.54, and 1.07 g m−2 every 4 wk for 12 wk. Measurements included tissue growth rates, tissue P concentration, soil Mehlich 1 P, Fe oxide P, and water‐extractable P concentrations. Phosphorus applicatio...

The effect of taxa [common Bermuda grass, Cynodon dactylon (L.); centipedegrass, Eremochloa ophiuroides Munro Hack; St. Augustinegrass, Stenotaphrum secundatum [Walt.] Kuntze; and zoysiagrass, Zoysia spp.], density, height, and weed density on abundance of natural enemies, and their potential prey were evaluated in residential turf. Total predatory Heteroptera were most abundant in St. Augustinegrass and zoysiagrass and included Anthocoridae, Lasiochilidae, Geocoridae, and Miridae. Anthocoridae and Lasiochilidae were most common in St. Augustinegrass, and their abundance correlated positively with species of Blissidae and Delphacidae. Chinch bugs were present in all turf taxa, but were 23-47 times more abundant in St. Augustinegrass. Anthocorids/lasiochilids were more numerous on taller grasses, as were Blissidae, Delphacidae, Cicadellidae, and Cercopidae. Geocoridae and Miridae were most common in zoysiagrass and were collected in higher numbers with increasing weed density. However, no predatory Heteroptera were affected by grass density. Other beneficial insects such as staphylinids and parasitic Hymenoptera were captured most often in St. Augustinegrass and zoysiagrass. These differences in abundance could be in response to primary or alternate prey, or reflect the influence of turf microenvironmental characteristics. In this study, Simpson's diversity index for predatory Heteroptera showed the greatest diversity and evenness in centipedegrass, whereas the herbivores and detritivores were most diverse in St. Augustinegrass lawns. These results demonstrate the complex role of plant taxa in structuring arthropod communities in turf. An increased understanding of how turf species and cultivars help shape pest and beneficial arthropod communities will enhance predictive abilities and further pest management objectives.

Low maintenance vegetation may reduce N leaching following establishment compared to routinely fertilized conventional turfgrass lawns. Therefore, using a fi eld-scale facility we examined N leaching from contrasting residential landscape models established on a sandy soil. Four replications each of a St. Augustinegrass [Stenotaphrum secundatum (Walt.) Kuntze] monoculture (SA) and a mixed-species (MS) landscape were randomly assigned to 47.5-m 2 plots. Fertilizer N was applied to the SA landscape bimonthly at a rate of 50 kg ha –1 (total of 900 kg N ha –1 ), while the MS landscape was fertilized bimonthly at a rate of 40 kg N ha –1 only during establishment (total of 480 kg ha –1 ). Data were collected for 3 yr (16 mo to 52 mo after planting). Cumulative mean inorganic-N leached was 4.1 kg ha –1 and 7.4 kg ha –1 for the SA and MS landscapes, respectively. Relatively long establishment requirements for the MS landscape led to signifi cantly greater inorganic-N leaching (5.2 kg ha –1 ) in year 1 of the study compared to the SA landscape (1.3 kg ha –1 ). After year 1, inorganic-N leaching was comparable on both landscapes, although it was signifi cantly less on the MS landscape in year 3 when no fertilizer was applied. Overall, inorganic-N leaching was low (

Compost application to turfgrasses may contribute to accumulation of macronutrients in soil and eventually pose leaching and runoff hazards. The objectives of this study were to determine the influence of compost on soil-dissolved organic C (DOC) and accumulation of NH4OAc-EDTA-extractable and water-soluble nitrogen (N), phosphorus (P), potassium (K), calcium (Ca), magnesium (Mg), and sulfur (S) in St. Augustinegrass [Stenotaphrum secundatum (Walt.) Kuntze] turf. Dissolved organic C increased from 3 to 29 months after application for unamended and compost-amended soils, indicating contribution from decomposition of both compost and St. Augustinegrass residues. Dissolved organic C was 75%, 78%, and 101% greater 29 months after application of 0, 80, and 160 mg·ha−1 of compost, respectively, than before application. Dissolved organic C and macronutrients exhibited considerable seasonal variation, because DOC and EDTA-extractable P, Ca, Mg, and S increased after compost application, whereas NO3 declined. Water-soluble K, Ca, and Mg declined, whereas P and S increased from 0 to 29 months. Similar seasonal changes in macronutrient concentrations occurred for unamended and compost-amended soil, indicating that composts, in addition to turfgrass residues, influenced DOC and macronutrient dynamics. Long-term nutrient accumulation occurred in compost-amended turfgrass, but seasonal dynamics were more related to the growth stage of turfgrass than compost. Formation of DOC-cation complexes appeared to contribute to macronutrient mobility, because decreases in DOC and nutrient concentrations occurred during turfgrass dormancy in winter and after high precipitation levels, indicating the potential for leaching of DOC-associated nutrients from soil.

The objective of this study was to assess canopy broadband spectral reflectance for turfgrasses under drought stress. Optimum turf quality (TQ) and leaf firing (LF) models were developed and compared based on two, three, and five wavelength bands. Sods of bermudagrass (Cynodon dactylon L. × C. transvaalensis Burtt-Davy), seashore paspalum (Paspalum vaginatum Swartz), zoysiagrass (Zoysia japonica Steud.), and St. Augustinegrass [Stenotaphrum secundatum (Walt.) Kuntze], and seeded tall fescue (Festuca arundinacea Schreb.) were used in this study with three cultivars each of bermudagrass, seashore paspalum, and tall fescue. Traditional vegetation indices (VIs) based on two bands within 660 to 950 nm were not as sensitive as three to five broadband models using a wider band range of 660 to 1480 nm. Optimum models were cultivar specific models, even within a species. The broadband wavelength at R900 and R1200 should be considered in drought sensitive spectral models since they were most often observed and exhibited high partial R2 values. These results suggest that mobile broadband spectral devices to map turfgrass responses to drought stress would benefit by the availability of three to five broadbands that could be user selected for optimum, cultivar specific models.

Compost application to turf grasses can increase dissolved organic matter and nutrient levels in soil but may also enhance leaching and runoff losses. The objectives of this study were to determine the influence of composts on soil organic matter and accumulation of DTPA-and water-extractable Mn, Fe, Cu, and Zn in St. Augustine Grass [Stenotaphrum secundatum (Walt.) Kuntze] turf. Composts increased soil organic C (SOC) soon after application, but no further increases occurred beyond 11 months. In contrast, dissolved organic C (DOC) increased from 3 to 29 months after application, indicating contributions from decomposition of composts and St. Augustine Grass residues. Dissolved organic C was 75, 78, and 101% greater 29 months after application of 0, 80, and 160 Mg ha−1 of compost, respectively, than before application. While DTPA-extractable Mn and Cu increased from 0 to 29 months, Fe and Zn decreased and were often below background levels. By 29 months, DTPA-extractable Mn and Cu for soil receiving 160 M...

Compost application to turf grasses can increase availability of nutrients in soil and improve growth, but can potentially lead to accumulation of macronutrients in soil and contribute to leaching and runoff losses. The objectives of this study were to investigate the influence of compost source and application rate on concentrations of plant-available macronutrients in soil over 29 months after a one-time application to saint augustine grass [Stenotaphrum secundatum (Walt.) Kuntze] and Bermuda grass [Cynodon dactylon (L.) Pers.] turf. Compost application increased soil organic C, P, Ca, and S concentrations by 3 months after addition, but further increases from 3 to 29 months were seldom observed. In contrast, NO3-N and K levels declined while Mg levels increased slightly from 3 to 29 months. Seasonal or cyclical patterns of soil macronutrient levels were apparent, as lower concentrations were observed during dormant stages of Bermuda grass growth in winter. Initial macronutrient concentrations of compos...

Summary • The response of biological nitrogen fixation (BNF) to elevated CO2 was examined in white clover (Trifolium repens)-dominated swards under both high and low phosphorus availability. • Mixed swards of clover and buffalo grass (Stenotaphrum secundatum) were grown for 15 months in 0.2 m2 sand-filled mesocosms under two CO2 treatments (ambient and twice ambient) and three nutrient treatments [no N, and either low or high P (5 or 134 kg P ha−1); the third nutrient treatment was supplied with high P and N (240 kg N ha−1)]. • Under ambient CO2, high P increased BNF from 410 to 900 kg ha−1. Elevated CO2 further increased BNF to 1180 kg ha−1 with high P, but there was no effect of CO2 on BNF with low P. Allocation of N belowground increased by approx. 50% under elevated CO2 irrespective of supplied P. • The results suggest that where soil P availability is low, elevated CO2 will not increase BNF, and pasture quality could decrease because of a reduction in aboveground N.

The objectives of this study were to evaluate effects of natural organic and inorganic fertilizers on various warm-season turfgrass species and to determine if lower rates of natural organic products would provide adequate turfgrass response. Studies were conducted in 2000 and 2001 in two locations in Florida on St. Augustinegrass (Stenotaphrum secundatum Walt. Kuntze) and bermudagrass (Cynodon dactylon x C. transvaalensis Burtt-Davy) cultivars. Each fertilizer product was applied at a low and a high rate throughout the growing season at rates consistent with current University of Florida recommendations for best turfgrass performance and response. In general, highest visual ratings for quality, color, and density were obtained with the higher rate of nitrogen (N), regardless of source, although the low rate of the 27N-1.3P-3.3K fertilizer produced ratings equal to the higher (N) rates from other sources in St. Augustinegrass. Trends were similar for spectral reflectance values, in that best results generally occurred in response to higher N rate, with the exception of the 27N-1.3P-3.3K fertilizer at the lower rate. From the results of this research, it appears that the higher N rate produces better turfgrass responses, regardless of fertilizer source.

The quantity of fertilizer applied to residential land use is increasing rapidly with urban expansion. Phosphorus (P) and potassium (K) are essential plant nutrients often included in fertilizers used on residential landscapes. As a result, the potential exists for substantial P and K losses to ground and surface waters via runoff and leaching. Landscape vegetation and maintenance protocols play important roles in mitigating nutrient losses. Therefore, the objectives of this comparative study were to examine fertilizer P and K leaching losses from contrasting residential landscape models established on a sandy soil. Four replications each of a St. Augustinegrass [Stenotaphrum secundatum (Walt.) Kuntze] monoculture (SA) and a mixed-spedes (MS) landscape were randomly assigned to 47.5-m 2 plots. The use of common management practices was part of each landscape model, as granular fertilizers were applied to the SA monoculture routinely (bimonthly) throughout the study (61 kg P ha -1 and 424 kg K ha -1 ) but only during establishment for the MS landscape (105 kg P ha -1 and 630 kg K ha -1 ). Losses of P and K in surface runoff were negligible. However, during the 45 mo of data collection, cumulative mean P leached was 37.8 kg ha -1 on the MS model and 22.9 kg ha -1 on the SA model, while cumulative mean K leached was 346 kg ha -1 on the MS landscape and 185 kg ha -1 on the SA landscape. Notably, leaching losses were high during establishment and following intense precipitation, but the SA landscape model minimized these losses compared with the MS model. Regardless of landscape, leaching losses of P, and perhaps K, were high enough to raise concern over ecological impacts on neighboring hydrologically linked systems.