Search

Collagen-binding activity (CBA) and FRETS-VWF73 assays are widely adopted methods for the measurement of the plasmatic activity of ADAMTS13, the von Willebrand factor (VWF) cleaving-protease. Accurately assessing the severe deficiency of ADAMTS13 is important in the management of thrombotic thrombocytopenic purpura (TTP). However, non-concordant results between the two assays have been reported in a small but relevant percentage of TTP cases. We investigated whether CBA or FRETS-VWF73 assay reflects ADAMTS13 proteolytic activity in acquired TTP patients with non-concordant measurements. Twenty plasma samples with non-concordant ADAMTS13 activity results, <10% using FRETS-VWF73 and ≥20% using CBA, and 11 samples with concordant results, <10% using either FRETS-VWF73 and CBA assays, were analysed. FRETS-VWF73 was performed in the presence of 1.5 M urea. ADAMTS13 activities were also measured under flow conditions and the VWF multimer pattern was defined in order to verify the presence of ultra-large VWF due to ADAMTS13 deficiency. In FRETS-VWF73 assay with 1.5 M urea, ADAMTS13 activity significantly increased in roughly 50% of the samples with non-concordant results, whereas it remained undetectable in all samples with concordant measurements. Under flow conditions, all tested samples showed reduced ADAMTS13 activity. Finally, samples with non-concordant results showed a ratio of high molecular weight VWF multimers higher than normal. Our results support the use of FRETS-VWF73 over CBA assay for the assessment of ADAMTS13 severe deficiency and indicate urea as one cause of the observed differences.

Background: The formation of ADAMTS13-specific circulating immune complexes (CICs) may be a pathophysiologic mechanism in autoimmune thrombotic thrombocytopenic purpura (TTP), but has not been systematically investigated., Objectives: (a) To develop an assay for ADAMTS13-specific CICs; (b) to evaluate their prevalence in autoimmune TTP; and (c) to assess their association with ADAMTS13-related measurements and clinical features in autoimmune TTP patients., Patients/methods: We developed and validated an ELISA method for ADAMTS13-specific CICs. ADAMTS13-specific CICs were searched for in 55 patients with autoimmune TTP from the Milan TTP Registry (URL:http://www.ttpdatabase.org/) and 28 controls. The associations between ADAMTS13-specific CIC levels and ADAMTS13 activity, antigen, anti-ADAMTS13 IgGs and acute TTP clinical features were assessed by multivariate linear regression., Results: Intra- and inter-assay coefficients of variation of the new test were 5.3 and 9.6%. In 36 patients with severe ADAMTS13 deficiency and anti-ADAMTS13 autoantibodies, the prevalence of ADAMTS13-specific CICs was 47% (n = 17; 95% confidence interval [CI], 32-63%). ADAMTS13-specific CICs were detected also in seven of 19 (37%; 95% CI, 19-59%) patients with reduced ADAMTS13 activity, but apparently negative anti-ADAMTS13 autoantibodies. ADAMTS13-specific CICs were not associated with ADAMTS13 activity, antigen or anti-ADAMTS13 IgGs. In patients with acute TTP, increasing levels of ADAMTS13-specific CICs were associated with a higher number of plasma-exchange procedures required to attain remission (per 0.1 increase in normalized OD values, beta, 2.9; 95% CI, -0.7 to 6.5)., Conclusions: Approximately one to two-thirds of patients with autoimmune TTP display ADAMTS13-specific CICs. A thorough investigation of the prognostic relevance of ADAMTS13-specific CIC levels in autoimmune TTP is warranted., (© 2013 International Society on Thrombosis and Haemostasis.)

Thrombotic thrombocytopenic purpura (TTP) is a microangiopathy syndrome caused by a congenital or acquired deficiency of ADAMTS13, a plasma metalloprotease that cleaves von Willebrand factor (VWF) and thus prevents the formation of platelet-rich thrombi in the microcirculation. TTP can be fatal if not appropriately and timely treated with the infusion of fresh frozen plasma (FFP) or exchange plasmapheresis, that reverse the process of microangiopathy by removing anti-ADAMTS13 autoantibodies and replacing functional ADAMTS13. The treatment of TTP with FFP is not free from risks and must be administered in hospitals or clinics, owing to the substantial amount of plasma volume infused or exchanged and the frequent need of catheter application. Moreover, most FFPs are not subjected to treatments to remove or inactivate blood-borne infectious agents. A number of recent reports indicate that certain plasma-derived VWF-factor VIII (FVIII) concentrates are clinically effective in the treatment of congenital TTP. In this study, we measured ADAMTS13 levels in various plasma-derived VWF-FVIII concentrates, showing that Koate(®) -DVI (Grifols), contained relatively high amounts of ADAMTS13 and that Alphanate(®) (Grifols) was the closest other product in terms of protease content. Koate(®) -DVI contains, on average (five lots tested), 0.091 ± 0.007 Units of ADAMTS13 activity per IU of FVIII. On the basis of this analysis and other reports of VWF-FVIII concentrate utilization in congenital TTP, potential dosing, and future clinical developments are discussed., (Copyright © 2013 Wiley Periodicals, Inc.)

Background: The considerable genetic predisposition to deep vein thrombosis (DVT) is only partially accounted for by known genetic risk variants. Rare single-nucleotide variants (SNVs) of the coding areas of hemostatic genes may explain part of this missing heritability. The ADAMTS13 and VWF genes encode two interconnected proteins with fundamental hemostatic functions, the disruption of which may result in thrombosis., Objectives: To study the distribution and burden of rare coding SNVs of ADAMTS13 and VWF found by sequencing in cases and controls of DVT., Patients/methods: The protein-coding areas of 186 hemostatic/proinflammatory genes were sequenced by next-generation technology in 94 thrombophilia-negative patients with DVT and 98 controls. Gene-specific information on ADAMTS13 and VWF was used to study the association between DVT and rare coding SNVs of the two genes., Results: More than 70 billion base pairs of raw sequence data were produced to sequence the 700-kb target area with a median redundancy of × 45 in 192 individuals. Most of the 4366 SNVs identified were rare and non-synonymous, indicating pathogenetic potential. Rare (frequency of < 1%) and low-frequency (< 5%) coding SNVs of ADAMTS13 were associated with DVT (prevalence 17% vs. 4%; odds ratio [OR] 4.8 and 95% confidence interval [CI] 1.6-15.0 for rare coding; prevalence 36% vs. 23%, OR 1.9 and 95% CI 1.0-3.5 for low-frequency coding). Patients with rare coding SNVs of ADAMTS13 had lower plasma levels of ADAMTS-13 activity than patients without them. SNVs of VWF were not associated with DVT., Conclusions: We found an excess of rare coding SNVs of the ADAMTS13 gene in patients with DVT., (© 2013 International Society on Thrombosis and Haemostasis.)

Background: Thrombotic thrombocytopenic purpura (TTP) is a rare life-threatening disease. Of surviving patients, 45% develops an exacerbation or a late recurrence. Severe ADAMTS-13 deficiency, both during the acute episode and remission, is a well-established predictor of recurrence. The predictive value of anti-ADAMTS-13 antibodies, their inhibitory activity and Ig class subtype for disease recurrence is still to be established., Objectives: To analyze ADAMTS-13-related biomarkers (ADAMTS-13 and anti-ADAMTS-13 immunoglobulins, classes and subclasses) and their potential relationship with prognosis., Patients/methods: In 115 patients with TTP, we assessed the association between levels of these biomarkers and the severity of acute episodes; we analysed also the hazard ratio (HR) and 95% confidence interval (CI) of recurrence in association with biomarkers levels retrieved at the previous acute episode or during remission, using Cox regression models., Results: During the acute phase, higher IgA, IgG1 and IgG3 titers showed the strongest association with acute episode severity. In the survival analyzes, the only biomarker significantly associated with a high hazard of recurrence after an acute episode was the presence of IgG. Conversly, low ADAMTS-13 activity or antigen levels (<10%), the presence of ADAMTS-13 inhibitor or IgG during remission were all significantly associated with a higher hazard of recurrence., Conclusions: Both the Ig class and subclass are of predictive value for acute episode severity in patients with TTP. Although markers that could predict the risk of recurrence in the acute phase are limited, a thorough assessment of ADAMTS-13-related parameters during remission is warranted., (© 2012 International Society on Thrombosis and Haemostasis.)

Background: In mammalian cells a regulatory mechanism, known as nonsense-mediated mRNA decay, degrades mRNA harboring premature termination codons. This mechanism is intron-dependent and functions as a quality control mechanism to eliminate abnormal transcripts and modulates the levels of a variety of naturally occurring transcripts., Design and Methods: In this study, we explored the molecular mechanism of ADAMTS13 deficiency in two compound heterozygous siblings carrying a 29-nucleotide deletion mutation located in exon 3 (c.291&#95;319delGGAGGACACAGAGCGCTATGTGCTCACCA) in one allele and a single base (A) insertion mutation (c.4143&#95;4144insA) in the second CUB domain previously reported in the other allele. Real-time quantitative reverse transcriptase polymerase chain reaction was used to explore whether the premature termination codons introduced by the deletion of the 29 nucleotides triggered the nonsense-mediated mRNA decay., Results: In vitro-expression studies demonstrated that the premature termination codons inserted by the 29 bp deletion probably lead to a reduction of ADAMTS13 mRNA levels through the regulatory mechanisms of nonsense-mRNA decay. Furthermore, the 4143&#95;4144insA mutation causes an impairment of secretion that leads to retention of the mutant protein in the endoplasmic reticulum, as observed in immunofluorescence studies., Conclusions: In conclusion, this work reports how two different ADAMTS13 gene defects acting at two different levels, i.e, impairment of steady-state mRNA level caused by the premature termination codon mediated decay mechanism induced by the 29 bp deletion mutation and alteration of the secretion pathway due to 4143&#95;4144insA, lead to a severe deficiency of ADAMTS13.

Background: From 20 to 50% of patients who survive an acute episode of the acquired form of thrombotic thrombocytopenic purpura relapse but clinical and laboratory markers of recurrence are not well established., Design and Methods: In 109 patients enrolled in an international registry we evaluated, in the frame of a retrospective cohort study, the predictive role of the metalloprotease ADAMTS13 as measured in plasma during remission. Anti-ADAMTS13 antibodies and von Willebrand factor were also evaluated in a smaller number of the same patients., Results: Median values of ADAMTS13 activity and antigen were significantly lower in patients with recurrent thrombotic thrombocytopenic purpura than in those with no recurrence (activity: 12% vs. 41%; p=0.007; antigen: 36% vs. 58%; p=0.003). A severe deficiency of ADAMTS13 activity (10% or less) was associated with a higher likelihood of recurrence (odds ratio 2.9; 95% confidence interval 1.3 to 6.8; p=0.01). Anti-ADAMTS13 antibodies were also more prevalent in patients with recurrent thrombotic thrombocytopenic purpura (odds ratio 3.1; 95% confidence interval 1.4 to 7.3; p=0.006). The presence during remission of both severe ADAMTS13 deficiency and anti-ADAMTS13 antibodies increased the likelihood of recurrence 3.6 times (95% confidence interval 1.4 to 9.0; p=0.006). The presence of ultralarge von Willebrand factor multimers and of associated diseases or conditions did not increase recurrence., Conclusions: Survivors of an acute episode of acquired thrombotic thrombocytopenic purpura with severely reduced levels of ADAMTS13 and/or with anti-ADAMTS13 antibodies during remission have an approximately three-fold greater likelihood of developing another episode of thrombotic thrombocytopenic purpura than patients with higher protease activity and no antibody.

The inherited deficiency of the von Willebrand factor-cleaving protease ADAMTS13 is associated with rare forms of thrombotic thrombocytopenic purpura (TTP). We investigated a woman with a family history of chronic recurrent TTP and undetectable plasma levels of ADAMTS13 activity. Genetic analysis revealed two missense mutations in the heterozygous state: p.Val88Met substitution in the metalloprotease domain and p.Gly1239Val substitution in the first CUB domain of ADAMTS13. To explore the mechanism of ADAMTS13 deficiency in this patient, the wild type (WT; ADAMT13(WT)) and each mutant construct (ADAMTS13(Val88Met), ADAMTS13(Gly1239Val)) were transiently expressed in HEK 293 and COS-7 cells. To recapitulate the compound heterozygous state of the patient, both mutant ADAMTS13 proteins were also expressed together. The p.Val88Met mutation led to a defect of secretion of the protease associated with a reduction of enzymatic activity, the p.Gly1239Val mutation led to a secretion defect causing intracellular accumulation of the protease. The mechanistic effects of the mutations were further explored by means of differential immunofluorescence, that demonstrated an homogeneous distribution of ADAMTS13(WT) in the Cis-Golgi and endoplasmic reticulum (ER) compartments, a reduction of ADAMTS13(Val88Met) in both compartments, while ADAMTS13(Gly1239Val) failed to reach the Cis-Golgi compartment and remained in the ER., ((c) 2006 Wiley-Liss, Inc.)