Search

The oligochaete earthworm, Eudrilus eugeniae is capable of regenerating both anterior and posterior segments. The present study focuses on the transcriptome analysis of earthworm E. eugeniae to identify and functionally annotate the key genes supporting the anterior blastema formation and regulating the anterior regeneration of the worm. The Illumina sequencing generated a total of 91,593,182 raw reads which were assembled into 105,193 contigs using CLC genomics workbench. In total, 40,946 contigs were annotated against the NCBI nr and SwissProt database and among them, 15,702 contigs were assigned to 14,575 GO terms. Besides a total of 9389 contigs were mapped to 416 KEGG biological pathways. The RNA-Seq comparison study identified 10,868 differentially expressed genes (DEGs) and of them, 3986 genes were significantly upregulated in the anterior regenerated blastema tissue samples of the worm. The GO enrichment analysis showed angiogenesis and unfolded protein binding as the top enriched functions and the pathway enrichment analysis denoted TCA cycle as the most significantly enriched pathway associated with the upregulated gene dataset of the worm. The identified DEGs and their function and pathway information can be effectively utilized further to interpret the key cellular, genetic and molecular events associated with the regeneration of the worm.

Purpose Verminephrobacter is a genus of symbiotic bacteria that live in the nephridia of earthworms. The bacteria are recruited during the embryonic stage of the worm and transferred from generation to generation in the same manner. The worm provides shelter and food for the bacteria. The bacteria deliver micronutrients to the worm. The present study reports the genome sequence assembly and annotation of a new strain of Verminephrobacter called Verminephrobacter eiseniae msu. Methods We separated the sequences of a new Verminephrobacter strain from the whole genome of Eisenia fetida using the sequence of V. eiseniae EF01-2, and the bacterial genome was assembled using the CLC Workbench. The de novo-assembled genome was annotated and analyzed for the protein domains, functions, and metabolic pathways. Besides, the multigenome comparison was performed to interpret the phylogenomic relationship of the strain with other proteobacteria. Result The FastqSifter sifted a total of 593,130 Verminephrobacter genomic reads. The de novo assembly of the reads generated 1832 contigs with a total genome size of 4.4 Mb. The Average Nucleotide Identity denoted the bacterium belongs to the species V. eiseniae, and the 16S rRNA analysis confirmed it as a new strain of V. eiseniae. The AUGUSTUS genome annotation predicted a total of 3809 protein-coding genes; of them, 3805 genes were identified from the homology search. Conclusion The bioinformatics analysis confirmed the bacterium is an isolate of V. eiseniae, and it was named Verminephrobacter eiseniae msu. The whole genome of the bacteria can be utilized as a useful resource to explore the area of symbiosis further.

The lumbricid earthworm Dendrobaena octaedra , widely distributed in the northern hemisphere, is a freeze tolerant worm species known for its ability to acclimate to the extreme cold condition. However, at the genome and transcriptome level, the species has not been explored to a great extent. The present study focuses on transcriptome analysis of Dendrobaena octaedra to identify and functionally annotate the potential transcripts and biological pathways associated with the freeze tolerance of the species. The Roche 454 pyrosequencing generated 181,856 reads for warm acclimated worms and 190,209 reads for cold acclimated worms which were de novo assembled to 6336 isotigs using the Newbler 2.3 assembler. In total, 2665 isotigs were annotated against the NCBI nr database and of them, 1753 isotigs were assigned to 9546 GO terms. The conserved domain analysis using InterProScan annotated 6309 isotigs into 1307 domains with EF-hand domain as the most highly represented domain. Further, the COG annotation classified 1426 isotigs into 25 functional categories and 895 isotigs were mapped to 90 KEGG pathways. Among them, 22 pathways were functionally enriched in the cold acclimated worms. The RNA seq analysis showed 96 differentially expressed genes of which 50 genes were upregulated in the cold acclimated worms. In addition, we identified 72 molecular chaperones which may have effect in regulating the cold tolerance of the species. The complete transcriptome resource of Dendrobaena octaedra can be effectively utilized further to interpret the key genetic, molecular and physiological mechanisms regulating the freeze tolerance and cold acclimation process of the species.

The present article reports the complete draft genome annotation of earthworm Eisenia fetida, obtained from the manuscript entitled “Timing and Scope of Genomic Expansion within Annelida: Evidence from Homeoboxes in the Genome of the Earthworm E. fetida” (Zwarycz et al., 2015) and provides the data on the repetitive elements, protein coding genes and noncoding RNAs present in the genome dataset of the species. The E. fetida protein coding genes were predicted from AUGUSTUS gene prediction and subsequently annotated based on their sequence similarity, Gene Ontology (GO) functional terms, InterPro domains, Clusters of Orthologous Groups (COGs) and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways information. The genome wide comparison of orthologous clusters and phylogenomic analysis of the core genes were performed to understand the events of genome evolution and genomic diversity between E. fetida and its related metazoans. In addition, the genome dataset was screened to identify the crucial stem cell markers, regeneration specific genes and immune-related genes and their functionally enriched GO terms were predicted from Fisher׳s enrichment analysis. The E. fetida genome annotation data containing the GFF (general feature format) annotation file, predicted coding gene sequences and translated protein sequences were deposited to the figshare repository under the DOI: https://doi.org/10.6084/m9.figshare.6142322.v1. Keywords: Eisenia fetida, Genome annotation, Orthologous groups, Regeneration

Bacillus species 062011 msu is a harmful pathogenic strain responsible for causing abscessation in sheep and goat population studied by Mariappan et al. (2012) [1]. The organism specifically targets the female sheep and goat population and results in the reduction of milk and meat production. In the present study, we have performed the whole genome sequencing of the pathogenic isolate using the Ion Torrent sequencing platform and generated 458,944 raw reads with an average length of 198.2 bp. The genome sequence was assembled, annotated and analysed for the genetic islands, metabolic pathways, orthologous groups, virulence factors and antibiotic resistance genes associated with the pathogen. Simultaneously the 16S rRNA sequencing study and genome sequence comparison data confirmed that the strain belongs to the species Bacillus cereus and exhibits 99% sequence homo;logy with the genomes of B. cereus ATCC 10987 and B. cereus FRI-35. Hence, we have renamed the organism as Bacillus cereus 062011msu. The Whole Genome Shotgun (WGS) project has been deposited at DDBJ/ENA/GenBank under the accession NTMF00000000 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA404036(SAMN07629099)). Keywords: Bacillus cereus, Genome sequencing, Abscessation, Virulence factors

In annelid worms, the nerve cord serves as a crucial organ to control the sensory and behavioral physiology. The inadequate genome resource of earthworms has prioritized the comprehensive analysis of their transcriptome dataset to monitor the genes express in the nerve cord and predict their role in the neurotransmission and sensory perception of the species. The present study focuses on identifying the potential transcripts and predicting their functional features by annotating the transcriptome dataset of nerve cord tissues prepared by Gong et al., 2010 from the earthworm Eisenia fetida. Totally 9762 transcripts were successfully annotated against the NCBI nr database using the BLASTX algorithm and among them 7680 transcripts were assigned to a total of 44,354 GO terms. The conserve domain analysis indicated the over representation of P-loop NTPase domain and calcium binding EF-hand domain. The COG functional annotation classified 5860 transcript sequences into 25 functional categories. Further, 4502 contig sequences were found to map with 124 KEGG pathways. The annotated contig dataset exhibited 22 crucial neuropeptides having considerable matches to the marine annelid Platynereis dumerilii, suggesting their possible role in neurotransmission and neuromodulation. In addition, 108 human stem cell marker homologs were identified including the crucial epigenetic regulators, transcriptional repressors and cell cycle regulators, which may contribute to the neuronal and segmental regeneration. The complete functional annotation of this nerve cord transcriptome can be further utilized to interpret genetic and molecular mechanisms associated with neuronal development, nervous system regeneration and nerve cord function.

Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats "CACAGA" and "TCTCTGCGCCTGCGCCGGCGCGGCGCGCC" and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.

Zika virus (ZIKV) is a reemerging human pathogen that causes congenital abnormalities, including microcephaly and eye disease. The cellular/molecular basis of ZIKV and host interactions inducing ocular and neuronal pathogenesis are unclear. Herein, we noted that the Hippo/Salvador-Warts-Hippo signaling pathway, which controls organ size through progenitor cell proliferation and differentiation, is dysregulated after ZIKV infection. In human fetal retinal pigment epithelial cells, there is an early induction of transcriptional coactivator, Yes-associated protein (YAP), which is later degraded with a corresponding activation of the TANK binding kinase 1/interferon regulatory factor 3 type I interferon pathway. YAP/transcriptional co-activator with a PDZ-binding domain (TAZ) silencing results in reduced ZIKV replication, indicating a direct role of Hippo pathway in regulating ZIKV infection. Using an invivo Ifnar1-/- knockout mouse model, ZIKV infection was found to reduce YAP/TAZ protein levels while increasing phosphorylated YAP Ser127 in the retina and brain. Hippo pathway is activated in major cellular components of the blood-brain barrier, including endothelial cells and astrocytes. In addition, this result suggests AMP-activated protein kinase signaling pathway's role in regulating YAP/TAZ in ZIKV-infected cells. These data demonstrate that ZIKV infection might initiate a cross talk among AMP-activated protein kinase-Hippo-TBK1 pathways, which could regulate antiviral and energy stress responses during oculoneuronal inflammation.

The Escherichia coli phage CMSTMSU was isolated from shrimp farm effluent water in Ramanathapuram, India. The phage exhibited lytic activity against both E. coli and the fish pathogen Pseudomonas aeruginosa., The Escherichia coli phage CMSTMSU was isolated from shrimp farm effluent water in Ramanathapuram, India. The phage exhibited lytic activity against both E. coli and the fish pathogen Pseudomonas aeruginosa. Here we report the draft genome sequence, assembly, and annotation of the isolated CMSTMSU phage. This genome resource can be used to utilize the phage as a crucial biocontrol agent in the fish aquaculture sector.

Radiotherapy (RT) in relapsed brain tumors has been used sparingly because of the risk of toxicity, particularly white matter necrosis. However, evidence from preclinical animal models and increasing data from clinical series show that brain and spinal cord have marked repair potential, and re irradiation should be considered a valid option in selected patients. The choice of technique and dose fractionation for re irradiation depends on tumor characteristics (volume and location), previous RT dose and volume, and patient characteristics (age and performance status). For small volume tumors in noneloquent areas, single fraction SRS and brachytherapy may be good options. For small and intermediate volume tumors in eloquent areas, FSRT or hypofractionated RT may be used. For large volume recurrences, requiring partial brain irradiation, conventional fractionation is safer and offers palliation with minimal risk of radiation induced toxicitie.

The treatment options for recurrent tumors are limited. Re irradiation is being increasingly considered as an option, in view of the advances in treatment techniques, particularly the ability to document doses, overlay plans, intensity modulation, and image guidance. preclinical and clinical studies has been to estimate the total cumulative doses (EQD2) also termed as normalized total dose (NTD) that can be delivered to various tissues. In this review article reirradiation radiobiology of different tissues and dose fractionation have been discussed.