Search

N6-methyladenosine (m6A) modifications control multifaceted RNA metabolism and are one of the most extensively distributed modifications on the human transcriptome, including non-coding RNAs (ncRNAs). Previous concepts of ncRNAs as “junk” transcriptional products have evolved to the concept that ncRNAs are functional regulatory molecules that determine specific biological processes and cell fates. The dysregulation of m6A modifications and ncRNAs have been implicated in the development of human carcinogenesis. Certain types of ncRNAs have been reported to exert regulatory effects on m6A machinery. However, a better understanding of the relationship between m6A modifications and ncRNAs in cancer is still needed. This review discusses mutual interactions between m6A modifications and ncRNAs and their impacts on the development of human cancer. We summarize the clinical significance of m6A-ncRNA networks for cancer diagnosis and treatment, and we ask challenging questions that remain unanswered in this field of research. Understanding the complex coordination between m6A modifications and ncRNAs will be useful for guiding the development of therapeutic interventions.

The circadian rhythm is a widespread physiological phenomenon present in almost all forms of life and is constituted by a system of interlocked transcriptional/translational feedback loops (TTFLs). External zeitgebers regulate biological rhythms through the direct or indirect regulation of circadian genes. Oxidative stress is involved in many diseases and injuries, such as ageing, diabetes, Alzheimer's disease, and cancer. Despite an increasing number of studies on circadian rhythm disorders caused by oxidative stress, little is known about the effects of oxidants on clock gene expression and the underlying mechanism. In this study, we found that the protein expression of circadian genes Clock, Bmal1, Per1/2, and Cry1/2 in NIH3T3 cells was upregulated by hydrogen peroxide (H2O2), an important mediator of oxidative stress. In addition, H2O2 modulated the circadian rhythm of Bmal1-luciferase via RORα, REV-ERBα (NR1D1), and REV-ERBβ (NR1D2). Further studies showed that H2O2 regulated biological rhythm by PRX2-STAT3-REV-ERBα/β pathway. These findings provide an accessory loop-related mechanism by which non-transcriptional oscillation interplays with TTFLs.

Background Polycystic kidney disease (PKD) is an inherited disease that is life‐threatening. Multiple cysts are present in the bilateral kidneys of PKD patients. The progressively enlarged cysts cause structural damage and loss of kidney function. Methods This study examined and analyzed 12 families with polycystic kidney disease. Whole exome sequencing (WES) or whole genome sequencing (WGS) of the probands was performed to detect the pathogenic genes. The candidate gene segments for lineal consanguinity in the family were amplified by the nest PCR followed by Sanger sequencing. The variants were assessed by pathogenic and conservational property prediction analysis and interpreted according to the American College of Medical Genetics and Genomics. Results Nine of the 12 pedigrees were identified the disease causing variants. Among them, four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) were detected. After assessment, the four novel variants were considered to be pathogenic variants and cause autosomal dominant polycystic kidney disease in family. The detected variants were interpreted. Conclusion The four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) are pathogenic variants and cause autosomal dominant polycystic kidney disease in family., This study examined and analyzed 12 families with polycystic kidney disease using whole exome sequencing or whole genome sequencing and several prediction tools. After assessment and interpretion, the four novel variants were considered to be pathogenic variants and cause autosomal dominant polycystic kidney disease in family. The present study enriched the knowledge of the pathogenicity for autosomal dominant polycystic kidney disease and would improve the understanding of this autosomal dominant disorder.

Gene amplification chiefly manifests as homogeneously stained regions (HSRs) or double minutes (DMs) in cytogenetically and extrachromosomal DNA (ecDNA) in molecular genetics. Evidence suggests that gene amplification is becoming a hotspot for cancer research, which may be a new treatment strategy for cancer. DMs usually carry oncogenes or chemoresistant genes that are associated with cancer progression, occurrence and prognosis. Defining the molecular structure of DMs will facilitate understanding of the molecular mechanism of tumorigenesis. In this study, we re‐identified the origin and integral sequence of DMs in human colorectal adenocarcinoma cell line NCI‐H716 by genetic mapping and sequencing strategy, employing high‐resolution array‐based comparative genomic hybridization, high‐throughput sequencing, multiplex‐fluorescence in situ hybridization and chromosome walking techniques. We identified two distinct populations of DMs in NCI‐H716, confirming their heterogeneity in cancer cells, and managed to construct their molecular structure, which were not investigated before. Research evidence of amplicons distribution in two different populations of DMs suggested that a multi‐step evolutionary model could fit the module of DM genesis better in NCI‐H716 cell line. In conclusion, our data implicated that DMs play a very important role in cancer progression and further investigation is necessary to uncover the role of the DMs.

Physiological changes in humans are evident under environmental conditions similar to those on a Mars mission involving both a space factor (long-term isolation) and a time factor (the Mars solar day). However, very few studies have investigated the response of the liver to those conditions. Serum protein levels, bilirubin levels, aminotransferase activities, blood alkaline phosphatase, gamma-glutamyltransferase, lipid levels, and serum cytokines interleukin-6 and interferon-γ levels were analyzed 30 days before the mock mission; on days 2, 30, 60, 75, 90, 105, 120, 150, and 175 of the mission; and 30 days after the mission, in four subjects in 4-person 180-day Controlled Ecological Life Support System Experiment. Serum protein levels (total protein and globulin) decreased and bilirubin increased under the isolation environment from day 2 and exhibited chronic acclimatization from days 30 to 175. Effects of the Mars solar day were evident on day 75. Blood lipid levels were somewhat affected. No obvious peak in any enzyme level was detected during the mission. The change tendency of these results indicated that future studies should explore whether protein parameters especially globulin could serve as indicators of immunological function exposure to the stress of a Mars mission.

Sleep loss is one of large challenges during space missions. A variety of sleep problems have been shown in space. We aimed to further characterize more representative and consecutive sleep-wake pa...

The core circadian clock gene, Clock, is a positive component of the transcription/translation feedback loop in the master pacemaker suprachiasmatic nucleus (SCN) in mammals. The robust daytime peak of some clock genes in the wild-type SCN is absent in Clock mutant mice. However, very little is known about the impact of Clock mutation on the expression of other functional genes in SCN. Here, we performed cDNA microarray and found 799 differentially expressed genes (DEGs) at zeitgeber time 2 (ZT2) and 1289 DEGs at ZT14 in SCN of Clock△19/△19 mutant mice. KEGG pathway analysis showed that the changed mRNAs were highly associated with hedgehog signaling pathway, retinol metabolism, allograft rejection, drug metabolism, hematopoietic cell lineage and neuroactive ligand-receptor interaction. The top 14 and 71 hub genes were identified from the protein-protein interaction (PPI) network at ZT2 and ZT14, respectively. The sub-networks revealed hub genes were involved in olfactory transduction and neuroactive ligand-receptor interaction pathways. These results demonstrate the Clock△19/△19 mutation alters the expression of various genes involved in a wide spectrum of biological function in mouse SCN, which are helpful for better understanding the function of Clock and potential regulatory mechanisms.

Microgravity has many detrimental impact on brain functions, however the underlying mechanism remain unclear. In present study, 28 days of tail-suspension (30°) was used to simulate microgravity in rats. We showed that oxidative stress in hippocampus was increased after 28 days of simulated microgravity in consideration of the decreased expression of NF-E2-related factor 2 (Nrf2) and the declined activities of total superoxide dismutase (T-SOD), CuZn-SOD, glutathione peroxidase (GSH-PX) and total antioxidant capacity (T-AOC). Using RNA-seq, we further investigated the effect of simulated microgravity on the expression of genes in hippocampus, and 849 genes were found to be differentially expressed. According to pathway analysis, the differentially expressed genes involved in cytoskeleton, metabolism, immunity, transcription regulation, etc. It is interesting to note that the differentially expressed genes were involved in hypoxia-associated pathway. In agreement with this, the expression of hypoxia induced factor-1α (HIF-1α), the master regulator of oxygen homeostasis, was significantly increased. Meanwhile, HIF-2α, a HIF-1α paralog, was elevated compared with the control group. The expression of pyruvate dehydrogenase kinase 1 (PDK1), lactate dehydrogenase A (LDHA) and vascular endothelial growth factor (VEGF), three well-defined downstream targets of HIF-1α, were up-regulated in hippocampus after 28 days of simulated microgravity exposure. Additionally, brain oxygen saturation (SO2) and blood flow analyzed by the tissue oxygen analysis system were also significantly reduced. These findings indicate that simulated microgravity might cause an alteration in oxygen homeostasis, providing novel insight into better understanding of how simulated microgravity affects the function of hippocampus and a new direction to the development of countermeasure for brain dysfunction during spaceflight (actual microgravity).

Background Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. Methods We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. Results Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. Conclusion Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

To investigate the expression of memory-related antioxidant genes and miRNAs under simulated weightlessness and the regulation of mechano growth factor (MGF) E domain, the peptide preventing nerve damage. Igf-iea and mgf mRNA levels, expression of antioxidant genes sod1 and sod2 and levels of miR-134 and miR-125b-3p increased in rat hippocampus after 14 days tail suspension to simulate weightlessness which was inhibited with intramuscular injection of E domain peptide. Therefore, administration of MGF E domain peptide could reverse increased expressions of memory-related igf-iea, mgf, sod1, sod2, miR-134 and miR-125b-3p in rat hippocampus under simulated weightlessness. MGF may regulate the redox state and miRNA-targeted NR-CREB signaling, and intramuscular injection may be the alternative administration because of its safety, convenience and ability to pass through the blood brain barrier.

// Yantao Bao 1, * , Jia Liu 1, * , Jia You 1 , Di Wu 1 , Yang Yu 1, 2 , Chang Liu 1 , Lei Wang 1, 3 , Fei Wang 1 , Lu Xu 1 , Liqun Wang 1 , Nan Wang 1 , Xing Tian 1 , Falin Wang 1 , Hongbin Liang 1 , Yating Gao 1 , Xiaobo Cui 1 , Guohua Ji 1 , Jing Bai 1 , Jingcui Yu 4 , Xiangning Meng 1 , Yan Jin 1 , Wenjing Sun 1 , Xin-yuan Guan 5, 6 , Chunyu Zhang 1 , Songbin Fu 1, 7 1 Laboratory of Medical Genetics, Harbin Medical University, Harbin, China 2 Department of Genetics and Eugenics, Maternity and Child Care Center of Qinghuangdao, Qinghuangdao, China 3 Genetic Diagnosis Center, First People's Hospital of Yunnan Province, Yunnan, China 4 Scientific Research Centre, Second Affiliated Hospital, Harbin Medical University, Harbin, China 5 Department of Clinical Oncology, Faculty of Medicine, The University of Hong Kong, Hong Kong, China 6 State Key Laboratory of Oncology in South China and Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China 7 Key Laboratory of Medical Genetics, Harbin Medical University, Heilongjiang Higher Education Institutions, Harbin, China * These authors contributed equally to this work Correspondence to: Songbin Fu, email: fusb@ems.hrbmu.edu.cn Chunyu Zhang, email: zhangcy@ems.hrbmu.edu.cn Keywords: Sei-1, in vivo passage, DMs, amplification, met Received: March 30, 2016 Accepted: July 19, 2016 Published: August 01, 2016 ABSTRACT Background: Sei-1 is an oncogene capable of inducing double minute chromosomes (DMs) formation. DMs are hallmarks of amplification and contribute to oncogenesis. However, the mechanism of Sei-1 inducing DMs formation remains unelucidated. Results: DMs formation significantly increased during serial passage in vivo and gradually decreased following culture in vitro . micro nuclei (MN) was found to be responsible for the reduction. Of the DMs-carrying genes, Met was found to be markedly amplified, overexpressed and highly correlated with DMs formation. Inhibition of Met signaling decreased the number of DMs and reduced the amplification of the DMs-carrying genes. We identified a 3.57Mb DMs representing the majority population, which consists of the 1.21 Mb AMP1 from locus 6qA2 and the 2.36 Mb AMP2 from locus 6qA2-3. Materials and Methods: We employed NIH-3T3 cell line with Sei-1 overexpression to monitor and characterize DMs in vivo and in vitro . Array comparative genome hybridization (aCGH) and fluorescence in situ hybridization (FISH) were performed to reveal amplification regions and DMs-carrying genes. Metaphase spread was prepared to count the DMs. Western blot and Met inhibition rescue experiments were performed to examine for involvement of altered Met signaling in Sei-1 induced DMs. Genomic walking and PCR were adopted to reveal DMs structure. Conclusions: Met is an important promotor of DMs formation.

Polycystic kidney disease (PKD) is a life‑threatening inherited disease with a morbidity of 1:500‑1,000 worldwide. Numerous progressively enlarging cysts are observed in the bilateral kidneys of patients with PKD, inducing structural damage and loss of kidney function. The present study analyzed one family with PKD. Whole exome sequencing of the proband was performed to detect the pathogenic gene present in the family. Candidate gene segments for lineal consanguinity in the family were amplified by nest polymerase chain reaction, followed by Sanger sequencing. One novel duplication variant (NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX) and one missense mutation (c.G9022A:p.V3008M) were detected in PKD1. Additionally, the pathogenic substitutions in PKD1 published from the dataset were analyzed. Following analysis and confirmation, the duplication variant NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX in PKD1, within the polycystin‑1, lipoxygenase, α‑toxin domain, was considered to be the pathogenic factor in the examined family with autosomal dominant PKD. Additionally, based on the analysis of 4,805 pathogenic substitutions in PKD1 within various regions, the presence of the missense mutation in the N‑terminal domain of polycystin‑1 may present high pathogenicity in ADPKD.

Circadian locomotor output cycles kaput protein (CLOCK) is a core transcription factor of complex integrated feedback loops in mammalian circadian clock. More genes have been reported to be regulated by CLOCK, however little is known about the role of CLOCK-mediated miRNAs. To dissect this, we used microarray analysis to measure miRNAs expression in suprachiasmatic nuclei (SCN) of wild-type (WT) and ClockΔ19 mutant mice at two different time points. We found that miRNAs regulation in two time points was extensive (nearly 75% of the miRNAs expressed at each time point), and very little overlap, with only six miRNAs in common. Besides this, the predicted CLOCK regulated miRNAs at two time points participated in extremely diverse pathways. We validated nine miRNAs (miR-125a-3p, miR-144, miR-199a-5p, miR-199b*, miR-200a, miR-200b, miR-203, miR-449a, and miR-96), which were involved in the same signaling pathway-hippo signaling pathway. The rhythms of these miRNAs showed a broad distribution of phase, amplitude, and waveform in Clock mutation. And further analysis indicated that there may be three models of miRNA-mediated circadian rhythms and hippo signaling pathway. MiRNA, the small player, may play a hub role in connecting circadian rhythms and other pathways via its multiple target genes networks.

To address the incomplete problem in pulmonary parenchyma segmentation based on the traditional methods, a novel automated segmentation method based on an eight-neighbor region growing algorithm with left-right scanning and four-corner rotating and scanning is proposed in this paper. The proposed method consists of four main stages: image binarization, rough segmentation of lung, image denoising and lung contour refining. First, the binarization of images is done and the regions of interest are extracted. After that, the rough segmentation of lung is performed through a general region growing method. Then the improved eight-neighbor region growing is used to remove noise for the upper, middle, and bottom region of lung. Finally, corrosion and expansion operations are utilized to smooth the lung boundary. The proposed method was validated on chest positron emission tomography-computed tomography (PET-CT) data of 30 cases from a hospital in Shanxi, China. Experimental results show that our method can achieve an average volume overlap ratio of 96.21 ± 0.39% with the manual segmentation results. Compared with the existing methods, the proposed algorithm segments the lung in PET-CT images more efficiently and accurately.

The present study aimed to determine how the learning and memory gradually change with the prolonged hindlimb unloading (HU) treatment in rats. Different HU durations (7 d, 14 d, 21 d, and 28 d) in Sprague-Dawley (SD) rats were implemented. Cognitive function was assessed using the Morris water maze (MWM) and the shuttle box test. Additionally, parameters about cholinergic activity and oxidative stress were tested. Results showed that longer-than-14 d HU led to the inferior performances in the behavioral tasks. Besides, acetylcholine esterase (AChE) activity, malondialdehyde (MDA) level in brain, reactive oxygen species (ROS), and 8-hydroxy-2-deoxyguanosine (8-OHdG) concentrations of HU rats were significantly increased. Furthermore, choline acetyltransferase (ChAT), superoxide dismutase (SOD), and catalase (CAT) activity in brain were notably attenuated. Most of these effects were more pronounced after longer exposure (21 d and 28 d) to HU, although some indicators had their own characteristics of change. These results indicate that cholinergic dysfunction and oxidative damage were involved in the learning and memory impairments induced by longer-than-14 d HU. Moreover, the negative effects of HU tend to be augmented as the HU duration becomes longer. The results may be helpful to present possible biochemical targets for countermeasures development regarding the memory deficits under extreme environmental conditions.

The circadian clock controls the physiological functions of many tissues including the liver via an autoregulatory transcriptional−translational feedback loop, of which CLOCK is a core positive component. In addition, many studies have indicated that microRNAs (miRNAs) regulate liver function. However, how CLOCK-regulated miRNAs are linked to liver function remains largely unknown. In this study, miRNAs expression profiles were performed in the liver ofClockΔ19mutant mice. Compared to wild type mice, totals of 61 and 57 putative CLOCK-regulated miRNAs were differentially expressed (fold change absolute value ≥2) at zeitgeber time 2 and zeitgeber time 14, respectively. According to the pathway analyses, the target genes of differentially expressed miRNAs were mainly involved in pathways in cancer, the PI3K-Akt signaling pathway and the MAPK signaling pathway. Protein−protein interaction analyses revealed that the hub genes were primarily associated with pathway in cancer and circadian rhythms. Expression validation showed that while the expression levels of miR-195 and miR-340 were up-regulated, the rhythms of these two miRNAs were always maintained. The expression level of nr1d2 mRNA was down-regulated. We identified a number of prospective CLOCK-regulated miRNAs that play roles in the various physiological processes of the liver, providing a reference to better understanding the potential regulatory mechanisms in the liver.

Purpose: Investigate the role of regulator of chromosome condensation 2 (RCC2) on lung adenocarcinoma (LUAD) metastasis. Experimental Design: Clinical specimens were used to assess the impact of RCC2 on LUAD metastasis. Mouse models, cytobiology, and molecular biology assays were performed to elucidate the function and underlying mechanisms of RCC2 in LUAD. Results: RCC2 expression was frequently increased in LUADs (88/122, 72.13%). It was confirmed by analysis of a larger cohort of TCGA RNA-seq data containing 488 LUADs and 58 normal lung tissues (P < 0.001). Importantly, increased level of RCC2 was significantly associated with T status of tumor (P = 0.002), lymph node metastasis (P = 0.004), and advanced clinical stage (P = 0.001). Patients with LUAD with higher expression of RCC2 had shorter overall survival. Cox regression analysis demonstrated that RCC2 was an independent poorer prognostic factor for patients with LUAD. Moreover, forced expression of RCC2 promoted intrapulmonary metastasis in vivo and significantly enhanced LUAD cell migration, invasion, and proliferation in vitro. Further study found that RCC2 induced epithelial–mesenchymal transition (EMT) and also stimulated the expression of MMP-2 and MMP-9. In addition, RCC2 was able to activate JNK, while inhibition of JNK suppressed the effect of RCC2 on LUAD cell migration, invasion, EMT, and the expression of MMP-2 and MMP-9. Conclusions: RCC2 plays a pivotal role in LUAD metastasis by inducing EMT via activation of MAPK–JNK signaling. Clin Cancer Res; 23(18); 5598–610. ©2017 AACR.

It has been demonstrated that simulated microgravity (SM) may lead to cognitive dysfunction. However, the underlying mechanism remains unclear. In present study, tail-suspension (30°) rat was employed to explore the effects of 28 days of SM on hippocampus-dependent learning and memory capability and the underlying mechanisms. We found that 28-day tail-suspension rats displayed decline of learning and memory ability in Morris water maze (MWM) test. Using iTRAQ-based proteomics analysis, a total of 4774 proteins were quantified in hippocampus. Of these identified proteins, 147 proteins were differentially expressed between tail-suspension and control group. Further analysis showed these differentially expressed proteins (DEPs) involved in different molecular function categories, and participated in many biological processes. Based on the results of PANTHER pathway analysis and further western blot verification, we observed the expression of glutamate receptor 1 (GluR1) and glutamate receptor 4 (GluR4) which involved in metabotropic glutamate receptor group III pathway and ionotropic glutamate receptor pathway were significantly induced by SM. Moreover, an increased concentration of glutamic acid (Glu) was also found in hippocampus while the concentrations of 5-hydroxytryptamine (5-HT), dopamine (DA), γ-amino acid butyric acid (GABA) and epinephrine (E) were decreased. Our finding confirms that 28-day SM exposure can cause degrading of the spatial learning and memory capability and the possible mechanisms might be related with glutamate excitotoxicity and imbalances in specific neurotransmitters.The goal of sending astronauts farther into space and extending the duration of spaceflight missions from months to years will challenge the current capabilities of bioastronautics. The investigation of the physiological and pathological changes induced by spaceflight will be critical in developing countermeasures to ensure astronauts to complete spaceflight mission accurately and effectively and return to earth safely. It has been demonstrated that spaceflight may lead to impairments in cognitive function which is crucial for mission success. Here we show that long-term simulated microgravity, the most potent environment risk factor during spaceflight, impairs the spatial learning and memory of rats and the underlying mechanism may be involved in glutamate excitotoxicity and imbalances in specific neurotransmitters release in hippocampus, which may provide new insight for the countermeasures of cognitive impairment during spaceflight.