Search

This research reports a new approach with lectin-based capacitive non-faradaic biosensor for the detection of prostate-specific membrane antigen (PSMA) as a promising diagnostic marker for determining prostate cancer. PSMA expression is significantly higher in malign hyperplasia, thus can be effectively employed to discriminate other benign prostatic diseases. Herein, the aluminium interdigitated electrode was fabricated and modified by a linker, 2-mercaptoacetate to form the self-assembled monolayer. Gold nanoparticles were used as a signal amplifier and supported the conjugation of Concanavalin A, for efficient capacitive sensing of PSMA. Scanning electron microscope observation effectively captured the surface modification on the aluminium surface by revealing the specific adherence of gold nanoparticles with Concanavalin A. Moreover, the successful surface modification was further validated by atomic force microscopy, Fourier transforms infrared spectroscopy, and X-ray photoelectron spectroscopy. The interaction analysis of Concanavalin A with PSMA by capacitive non-faradaic measurement exhibited a linear detection range from 10 pM to 100 nM and attained the detection limit and sensitivity of 10 pM and 1.65 nF/pM respectively as the comparable performance to the current sensing strategies. Furthermore, the fabrication and quantification of PSMA as demonstrated here are relatively simple and can be employed for the straightforward detection of other biomarkers.

Reduced graphene oxide (rGO) is widely utilised to develop various types of biosensors; however, producing self-assembled rGO nanoflake networks through single-droplet drop-casting remains inconsistent. In the present work, we systematically used three different methods to prepare rGO suspensions in order to produce large scale self-assembled rGO nanoflake networks through single-droplet drop-casting. The rGO suspensions were prepared using only deionised water with no added any chemicals/organic solvents, which we considered to be a low-cost method. Subsequently, the most effective preparation method was used to deposit rGO nanoflakes onto commercial gold interdigitated microelectrodes (Au-IDE) to examine their electrical performance. Assessment of the yields, developed methods, surface morphologies, spectroscopy and structural analyses of the as-prepared rGO nanoflakes were conducted. The results revealed that method-3 (involving sonication, centrifugation and post-sonication) produced large self-assembled rGO nanoflake networks with strong adhesion to glass substrates. Furthermore, the as-prepared rGO/Au-IDE modified sensors showed excellent electron mobility where the electrical conductivity was enhanced approximately ~ 1000 fold compared to the bare devices. The present work provided new insights for depositing large self-assembled interconnected rGO nanoflake networks through single-droplet drop-casting which will be beneficial for biosensor development and other downstream applications.

Field of generating a surface thin film is emerging broadly in sensing applications to obtain the quick and fast results by forming the high-performance sensors. Incorporation of thin film technologies in sensor development for the better sensing could be a promising way to attain the current requirements. This work predominantly delineates the fabrication of the dielectric sensor using two different sensing materials (Gold and Aluminium). Conventional photolithography was carried out using silicon as a base material and the photo mask of the dielectric sensor was designed by AutoCAD software. The physical characterization of the fabricated sensor was done by Scanning Electron Microscope, Atomic Force Microscope, High Power Microscope and 3D-nano profiler. The electrical characterization was performed using Keithley 6487 picoammeter with a linear sweep voltage of 0 to 2 V at 0.01 V step voltage. By pH scouting, I-V measurements on the bare sensor were carried out, whereby the gold electrodes conducts a least current than aluminium dielectrodes. Comparative analysis with pH scouting reveals that gold electrode is suitable under varied ionic strengths and background electrolytes, whereas aluminium electrodes were affected by the extreme acid (pH 1) and alkali (pH 12) solutions.

Recently, simulations of In0.48Ga0.52As-based Planar Barrier Diode (PBD) and Self-Switching Device (SSD) as millimeter-wave rectifiers were reported. Both PBD and SSD have a planar structure, but with different insulating shapes and working principles. In this work, a hybrid structure of the reported PBD and SSD in a parallel configuration is proposed, to exploit the advantages of each device. The advantages of high rectifying properties in the SSD and fast switching rate of the PBD are combined in this hybrid structure in order to obtain an improved rectification performance at zero-bias in the near terahertz frequency region. Analysis of the curvature co-efficient, γ, which is defined as the ratio of the second order to the first order derivative of the device’s I-V function was performed to evaluate the rectification performance. AC transient analyses were then executed in various frequencies to imitate the high-frequency signal inputs. By using this hybrid structure, the highest value of γ achieved has been improved to ~19 V-1at 70 mV, and ~6 V-1at zero-bias (compared to the previous results on PBDs). The estimated cut-off frequency obtained was ~360 GHz (0.36 THz), operating at zero-bias.

Lung cancer is one of the most serious threats to human where 85% of lethal death caused by non-small cell lung cancer (NSCLC) induced by epidermal growth factor receptor (EGFR) mutation. The present research focuses in the development of efficient and effortless EGFR mutant detection strategy through high-performance and sensitive genosensor. The current amplified through 250 µm sized fingers between 100 µm aluminium electrodes indicates the voltammetry signal generated by means of the mutant DNA sequence hybridization. To enhance the DNA immobilization and hybridization, ∼25 nm sized aluminosilicate nanocomposite synthesized from the disposed joss fly ash was deposited on the gaps between aluminium electrodes. The probe, mutant (complementary), and wild (single-base pair mismatch) targets were designed precisely from the genomic sequences denote the detection of EGFR mutation. Fourier-transform Infrared Spectroscopy analysis was performed at every step of surface functionalization evidences the relevant chemical bonding of biomolecules on the genosensor as duplex DNA with peak response at 1150 cm−1 to 1650 cm−1. Genosensor depicts a sensitive EGFR mutation as it is able to detect apparently at 100 aM mutant against 1 µM DNA probe. The insignificant voltammetry signal generated with wild type strand emphasizes the specificity of genosensor in the detection of single base pair mismatch. The inefficiency of genosensor in detecting EGFR mutation in the absence of aluminosilicate nanocomposite implies the insensitivity of genosensing DNA hybridization and accentuates the significance of aluminosilicate. Based on the slope of the calibration curve, the attained sensitivity of aluminosilicate modified genosensor was 3.02E-4 A M−1. The detection limit of genosensor computed based on 3σ calculation, relative to the change of current proportional to the logarithm of mutant concentration is at 100 aM.

The universal burden of Parkinson’s disease (PD) has more than doubled over the past generation due to the increasing numbers of elderly individuals, with possible contributions from extended disease duration and environmental factors. PD affects the basal ganglia and the substantia nigra in deep parts of the brain. The nerve cells in the substantia nigra produce the neurotransmitter dopamine, which is responsible for the movement of the body. When PD affects the basal ganglia and the substantia nigra in the brain, there is abnormal neurotransmission in the body, leading to speech impairment, slowness of movement (bradykinesia), balance disorder, postural instability, tremor, and muscle rigidity. Even though the cause of this disease is still unknown, some studies revealed that α-synuclein is a major constituent of Lewy bodies, protein clumps that are the pathological hallmark of PD. Furthermore, different lines of research are under investigation with the involvement of other biological macromolecules, such as microRNA and DNA. Therefore, this paper reviews the current states and perspectives on PD, including its nature, features, and management, and the methods available to predict PD. The essence of this review is that PD requires more investigation and the development of suitable technologies to provide assistance to PD patients to improve their life.

Background: Ampicillin has been widely used as a broad-spectrum antibiotic for the treatment and prevention of human diseases with a low-toxicity. Ampicillin plays an important role in therapeutics, however, there might be some synthetically prepared compounds for the applications in agriculture, animals and even humans that eventually have resulted in major health issues. Objective: This research demonstrates the approach to improve the specific in vitro detection of ampicillin using titanium dioxide nanoparticle-based interdigitated device electrode. Methods: The fabrication of biosensor was performed using the conventional photolithography integrated process of an inductively-coupled plasma dry-etching. Surface modifications were applied on a 50 µm gapped interdigitated comb-like titanium dioxide nanoparticle modified electrode surface using 0.02 M of 3-Aminopropyl trimethoxysilane, which was diluted in 75% ethanol. A Schiff-base reaction using glutaraldehyde was followed to covalently immobilize streptavidin followed by a non-covalent immobilization of biotinylated-aptamer DNA probe (1 µM), having a sequence of 5’- CACGGCATGGTGGGCGTCGTG–biotin-3’. Results: These surface modifications with multiple self-assembling monolayers afford the additional control for stability. The immobilized aptamer DNA probe was interacted with the target, ampicillin at 10 mg/ml, resulting in the current field changes across the device. I-V relationship interpreted the selective binding of ampicillin and distinguished kanamycin from carbenicillin. Our sensing system was able to detect ampicillin in a linear range of 0.1 ng until 10 mg/ml with the limit of detection at 0.1 ng/ml. Conclusion: This sensing platform aimed to evaluate the purity of ampicillin, a promising beneficial approach towards the pharmaceutical industries.

In the advancement of the Internet of Things (IoT) applications, widespread uses and applications of devices require higher frequency connectivity to be explored and exploited. Furthermore, the size, weight, power and cost demands for the IoT ecosystems also creates a new paradigm for the hardware where improved power efficiency and efficient wireless transmission needed to be investigated and made feasible. As such, functional microwave detectors to detect and rectify the signals transmitted in higher frequency regions are crucial. This paper reviewed the practicability of self switching diodes as Radio Frequency (RF) rectifiers. The existing methods used in the evaluation of the rectification performance and cut-off frequency are reviewed, and current achievements are then concluded. The works reviewed in this paper highlights the functionality of SSD as a RF rectifier with design simplicity, which may offer cheaper alternatives in current high frequency rectifying devices for application in low-power devices.

Human immunodeficiency virus (HIV) is a life threatening, weakens the immune system upon infection, thus ultimately resulting in the fatal health issues. This situation necessitates the generation of different strategies for HIV detection. HIV-1 Tat, a transactivator of HIV gene expression, was chosen in this study as the target of a non-functional split aptamer. Implementation of split aptamer has been demonstrated in this work for colorimetric detection of HIV-1 Tat. An unmodified gold nanoparticle (GNP)-based colorimetric assay was used for the visible detection of the proof, displays color transitions from red to purple in relation to the dose-dependency of HIV-1 Tat against the split aptamer in ionic solutions. The visible color transition was characterized using UV–vis spectrophotometer showing spectrum shift and supported by Scanning Electron Microscopy observation. With addition of sodium chloride, the color of the solution started to change to purple and spectrum started to shift to higher wavelength due to aggregation at HIV-1 Tat concentration as low as 10 nM. Specificity test was conducted with duplexed split aptamer and HIV-1 p24 has shown slight color changes. With HIV-1 Nef, GNP solution retains the color similar to the control, which indicated the specific split aptamer interaction to HIV-1 Tat.

This article is clearly presenting the development of a biosensor for human factor IX (FIX) to diagnose the blood clotting deficiency, a so-called ‘Royal disease’ using an interdigitated electrode (IDE) with the zinc oxide surface modification. Gold nano-urchins (GNUs) with 60 nm in diameter was integrated into a streptavidin-biotinylated aptamer strategy to enhance the active surface area. Two different comparative studies have been done to validate the system to be practiced in the current work holds with a higher capability for the high-performance sense. Whereby, the presence and absence of GNUs in the aptasensing system for FIX interaction were investigated using the amperometric measurement, using a linear sweep voltage of 0–2 V at 0.01 V step voltage. The detection limit was 6 pM based on 3σ calculation when GNUs integrated aptamer assay was utilized for FIX detection, which shows 8 folds sensitivity enhancement comparing the condition in the absence of GNU and 50 folds higher than sensitive radio-isotope and surface plasmon resonance assays. Albeit, the surface and molecular characterizations were well demonstrated by scanning electron microscopy, atomic force microscopy, 3D nano-profilometry and further supports were rendered by UV–Vis spectroscopy and Enzyme-linked apta-sorbent assay (ELASA). Furthermore, the spiking experiment was done by FIX-spikes in human blood serum in order to demonstrate the stability with a higher non-fouling.

This paper primarily demonstrates the approach to enhance the sensing performance on antigen C-reactive protein (CRP) and anti-CRP antibody binding event. A nanogapped electrode structure with the gap of ~100 nm was modified by the anti-CRP antibody (Probe) to capture the available CRP. In order to increase the amount of antigen to be captured, a gold nanorod with 119 nm in length and 25 nm in width was integrated, to increase the surface area. A comparative study between the existence and non-existence of gold nanorod utilization was evaluated. Analysis of the sensing surface was well-supported by atomic force microscopy, scanning electron microscopy, 3D nano-profilometry, high-power microscopy and UV–Vis spectroscopy. The dielectric voltammetric analysis was carried out from 0 V to 2 V. The sensitivity was calculated based on 3σ and attained as low as 1 pM, which is tremendously low compared to real CRP concentration (119 nM) in human blood serum. The gold nanorod conjugation with antibody has enhanced the sensitivity to 100 folds (10 fM). The specificity of the CRP detection by the proposed strategy was anchored by ELISA and failure in the detection of human blood clotting factor IX by voltammetry. Despite, CRP antigen was further detected in human serum by spiking CRP to run-through the detection with the physiologically relevant samples.

Reduction of graphene oxide becomes an alternative way to produce a scalable graphene and the resulting nanomaterial namely reduced graphene oxide (rGO) has been utilized in a wide range of potential applications. In this article, the level of green reduction strategies, especially the solution-based reduction methods are overviewed based on recent progression, to get insights towards biomedical applications. The degrees of gaining tips with the solution-based green reduction methods, conditions, complexity and the resulting rGO characteristics have been elucidated comparatively. Moreover, the application of greenly produced rGO in electrochemical biosensors has been elucidated as well as their electrical performance in term of linear range and limit of detections for various healthcare biological analytes. In addition, the characterization scheme for graphene-based materials and the analyses on the reduction especially for the solution-based green reduction methods are outlined for the future endeavours.

Nanoparticles have been paid a great attraction in interdisciplinary sciences owing to their unique characteristics. Different nanoparticles were synthesized in metallic and non-metallic states, showing varied sizes for down-stream applications. Copper nanoparticle (CuNP) has a special attention due to its great electrical, catalytic, optical and mechanical properties. In this research, CuNP was prepared by the electrolytic deposition and characterized its morphological and structural behaviours by scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), X-ray powder diffraction (XRD), Fourier transform infrared spectroscopy (FTIR) and Raman spectroscopy. SEM displays the irregular agglomerated particles, whereas with TEM the sizes were determined as 40 ± 10 nm. The peaks with XPS analysis were noticed at 932.1 for Cu(2p3/2), 944.1 eV and 952.1 eV for Cu(2p1/2). Whereas, the representative peaks for copper were placed at 43.7°, 50.7° and 74.3°, corresponding to (111), (200) and (220) under XRD observations. CuNP vibration peaks were monitored at 1635 cm−1 with FTIR and a sharp peak at 617.6 cm−1 is representing Cu-O group due to the occurrence of Cu2O. The antimicrobial activity of the electrodeposited CuNP was proved against the fungus, Aspergillus niger. Further, ITO/CuNP/CuI/Cu (Indium Tin Oxide/Copper Nanoparticle/Copper Iodide/Copper) substrate solid-state photovoltaic cell was fabricated by CuNP electrodeposition on the CuI substrate. It was anchored by I–V characteristics, apparent that a rapid current enhancement after deposition of the CuNP.

This study described a “green chemistry” synthesis of titanium oxide nanoparticle (TiO2-NP) using environment-friendly reducing agents that were from Elodea canadensis. The obtained TiO2-NP has an intense surface plasmon reverberation band at ~ 250 nm with UV–visible spectroscopic investigation which showed the intactness of TiO2-NPs. The morphological behaviour of TiO2-NPs was watched beneath field-emission scanning electron microscopy and transmission electron microscopy, shown that TiO2-NPs have a spherical pattern with a normal estimate of ~ 25 nm in breadth. The occurrence of the critical elements was pinpointed by energy-dispersive X-ray spectroscopy study, which displays the predominant titanium and oxide elements. Further support with a defined morphology and size distribution was rendered by atomic force microscopy and 3D high-power microscopy analyses. X-ray powder diffraction and chosen area electron diffraction examinations affirmed that TiO2-NPs are crystal clear in macrocosm. X-ray photoelectron spectroscopy study was uncovered natural composition of the TiO2-NPs, displaying Ti 2p crested at 458.48 eV with C1s crest for the catalyst that was shaped into a C–H constitute at 284.88 eV. The O 1s spectra moreover were displayed with authoritative vitality at 532.28 eV. XRD analysis gave proportion phase as 75%:25% for anatase and rutile. DLS showed polydispersity index esteem of − 1.23, and zeta potential for green synthesized Ti2O-NPs was − 3.87 mV. A broad hydroxyl peak was identified, and prominent peaks were notified at 1631.78 cm−1 and 3454.51 cm−1 by Fourier-transform infrared spectroscopy analysis.

Mortality level is worsening the situation worldwide thru blood diseases and greatly jeopardizes the human health with poor diagnostics. Due to the lack of successful generation of early diagnosis, the survival rate is currently lower. To overcome the present hurdle, new diagnostic methods have been choreographed for blood disease biomarkers analyses with the conjunction of ultra-small ideal gold nanohybrids. Gold-hybrids hold varieties of unique features, such as high biocompatibility, increased surface-to-volume ratio, less-toxicity, ease in electron transfer and have a greater localized surface plasmon resonance. Gold-nanocomposites can be physically hybrid on the sensor surface and functionalize with the biomolecules using appropriate chemical conjugations. Revolutionizing biosensor platform can be prominently linked for the nanocomposite applications in the current research on medical diagnosis. This review encloses the new developments in diagnosing blood biomarkers by utilizing the gold-nanohybrids. Further, the current state-of-the-art and the future envision with digital monitoring for facile telediagnosis were narrated.

SiC nanomaterial (SiCNM) is known for its excellent properties and has great potential for a wide range of applications. In this article, preparation of SiCNMs from different types of graphite was performed by microwave-assisted synthesis. Different types of graphite which are graphite flake (GF) and expanded graphite (EG) were used to react with silica for the synthesis of SiCNMs in laboratory microwave furnace at 1400 °C. It was found that SiC nanowhiskers (SiCNWs) were formed when EG was used, while irregular shaped SiC nanoparticles (SiCNPs) were formed when GF was used. β-SiC appeared as the only phase in the XRD patterns for both SiCNMs formed using GF and EG. SiCNWs and SiCNPs have interplanar spacing of around 0.25 nm which is the axial direction of [111]. The difference of formation mechanism is believed to be the origin of different morphology of SiCNMs synthesized from different types of graphite.

Microfluidics explores the manipulation of fluid in small volume, a multidisciplinary field is imperative for DNA extraction. This study offers a simple yet substantial methodology for the fabrication of microfluidics structure-based polydimethylsiloxane (PDMS) biopolymer on a glass substrate with SU-8 photoresist for label-free detection of pathogenic genomic DNA. Two microfluidics designs for DNA detection were based on AutoCAD software, both contain two inlets and one outlet, with dimensions of 28 mm wide, and 18 mm long, and total surface area of 504 mm2. The designs were patterned in such particular sizes and dimensions to test fluid delivery and enhancement in biochemical processes in DNA extraction, while maintaining economical values as a disposable chip. Both microfluidics devices showed no leakage during fluid delivery, have heights of 97.97 and 103.44 μm, and surface roughness of 0.15 and 0.07 μm, respectively. DNA extraction from pathogenic fungus Ganoderma boninense was run on PDMS microfluidic device and UV–Vis analysis confirmed successful extraction with peaks found at 260–280 nm. Current–voltage (I–V) measurement confirmed the accuracy of microfluidic device for the specific pathogen with both real and synthetic samples of G. boninense illustrating the similar graph values of only 0.000005 A difference at 1.0 V after hybridization.

Nanofabricated gold nanoparticles (Au-NPs) on MoS2 nanosheets (Au-NPs/MoS2) in back-gated field-effect transistor (BG-FET) are presented, which acts as an efficient semiconductor device for detecting a low concentration of C-reactive protein (C-RP). The decorated nanomaterials lead to an enhanced electron conduction layer on a 100-μm-sized transducing channel. The sensing surface was characterized by Raman spectroscopy, ultraviolet–visible spectroscopy (UV-Vis), atomic force microscopy (AFM), scanning electron microscopy (SEM), and high-power microscopy (HPM). The BG-FET device exhibits an excellent limit of detection of 8.38 fg/mL and a sensitivity of 176 nA/g·mL−1. The current study with Au-NPs/MoS2 BG-FET displays a new potential biosensing technology; especially for integration into complementary metal oxide (CMOS) technology for hand-held future device application.

Cuprous oxide, a narrow bandgap p-type semiconductor, has been known as a potential material for applications in supercapacitors, hydrogen production, sensors, and energy conversion due to its properties such as non-toxicity, easy availability, cost effectiveness, high absorption coefficient in the visible region and large minority carriers diffusion length. In this study, Cu2O nanostructured thin film was fabricated by anodizing of Cu plates in ethylene glycol containing 0.15 M KOH, 0.1 M NH4F and 3 wt.% deionized water. The effects of anodizing voltage and temperature of electrolyte were investigated and reported. It was found that nanoporous Cu2O thin film was formed when anodizing voltages of 50 V and 70 V were used while a dense Cu2O thin film was formed due to the aggregation of smaller nanoparticles when 30 V anodizing voltage was used. Nanoplatelets thin film was formed when the temperature of electrolyte was reduced to 15 °C and 5 °C. X-ray diffraction confirmed the presence of Cu2O phase in thin film formed during anodizing of Cu plates, regardless of the anodizing voltage and temperature of electrolyte. Photoluminescence spectroscopy showed the presence of Cu2O peak at 630 nm corresponding to band gap of 1.97 eV. A mechanism of the formation of Cu2O thin film was proposed. This study reported the ease of tailoring Cu2O nanostructures of different morphologies using anodizing that may help widen the applications of this material

Characterization on an InGaAs-based self-switching diode (SSD) using technology computer aided design (TCAD) aimed for optimizing the electrical rectification performance of the device is reported. The rectifying performance is mainly contributed by a parameter known as the curvature coefficient which is derived from the current-voltage (I-V) behavior of the device. As such, the curvature coefficient of SSD was analyzed in this work, not only by varying the device’s geometrical structure, but also by implementing different dielectric relative permittivity of the device’s trenches, ranging from 1.0 to 10. Furthermore, the simulations were performed under temperature range of 300–600 K. The results showed that increased temperature degraded the SSD’s rectifying performance due to increased reverse current which can deteriorate the nonlinearity of the device’s I-V characteristic. Moreover, an improved curvature coefficient can be achieved using silicon dioxide (∼3.9) as the SSD trenches. The cut-off frequency of SSD with zero-bias curvature coefficient of ∼30 V−1 attained in this work was approximately 80 GHz, operating at unbiased condition. The results obtained can assist the design of SSD to efficiently operate as rectifiers at microwave and terahertz frequencies.

Early cancer diagnosis remains the holy-grail in the battle against cancers progression. Tainted with debates and medical challenges, current therapeutic approaches for prostate cancer (PCa) lack early preventive measures, rapid diagnostic capabilities, risk factors identification, and portability, i.e. the inherent attributes offered by the label-free biosensing devices. Electronic assisted immunosensing systems inherit the high sensitivity and specificity properties due to the predilection of the antigen–antibody affinity. Bioelectronic immunosensor for PCa has attracted much attentions among the researchers due to its high-performance, easy to prepare, rapid feedback, and possibility for miniaturization. This review explores the current advances on bioelectronic immunosensors for the detection of PCa biomarker revealed in the past decade. The research milestones and current trends of the immunosensors are reported to project the future visions in order to propel their “lab-to-market” realization.

The authors describe an impedimetric nanosensor for aptamer-mediated detection of ATP. A triangular junction of polysilicon substrate is used as a transducer. The aptamer was immobilized on the substrate via biotin-streptavidin interaction. ATP can be detected by this method in the 10 to 100 nM concentration range at room temperature and estimated the signal to noise ratio above the range of 3σ. It was applied to the detection of ATP in 1:1000 diluted human urine. The desired transducer is highly reproducible and specific. It is selective over closely related molecules such as guanosine triphosphate, cytidine triphosphate and uridine triphosphate. The method is perceived to represent a valuable tool for the diagnosis for infections and inflammations. The novelties shown in this study compared to other sensors are, consumption of low sample volume (~ 1 μl), non-invasive and suitable with AC and DC currents.

The authors describe an electrochemical method for the determination of the blood clotting factor IX (FIX). A nanogapped dielectrode (with a

The increasing cases of dengue fever (DF) and dengue hemorrhagic fever (DHF) in the last decade have been reported worldwide. These conditions have led to huge economic loses and health complications. At present, no direct cure for DF and no efficient device to control or detect the Aedes mosquitoes that cause DF are available. Therefore, the fabrication of a device will reduce the probability of get infection since it works as a warning system, to exterminate Aedes mosquitoes as soon as discovered, and to evacuate the location until it be treated. This paper is the first to report the detection of the female Aedes mosquito in human habitations using a surface acoustic wave (SAW) sensor. The feasibility of an acoustic-based device that records differences in signals and noise levels from different mosquito species has been demonstrated in instructing frequency differences to detect female mosquitoes. The SAW sensor response was investigated with simulated and real Aedes mosquito signals. Decreased resonant peak amplitude was obtained with different wingbeat frequencies. The S11 magnitude was reduced by 0.6dB and 1.25dB with female and male Aedes mosquitoes, respectively. Furthermore, the SAW sensor exhibited good sensitivity in low sound pressure environments between 40 and 55dB, making it suitable for use inside an average home. Display Omitted Layard SAW sensor for female Aedes mosquito detection was fabricated and investigated.Decreased resonant peak amplitude was obtained with different wing beat frequencies.S11 magnitude was reduced by 0.6 and 1.25dB with female and male Aedes mosquitoes.The SAW sensor exhibited good sensitivity in low sound pressure environments.

Systematic Evolution of Ligands by EXponential enrichment (SELEX) is the method to select the specific aptamer against a wide range of targets. For this process, the initial library usually has a length of random sequences from ∼25 and it reaches over 100 bases. The lengthy sequences have disadvantages such as difficult to prepare, less stable and expensive. It is wise to prefer shorter version of aptamer for a wide range of applications including drug delivery process. It is a common practice to shorten the full-length aptamer by mapping analyses and it is tedious. Here, we used a crawling method to shorten the aptamer by different sequential deletion of bases from both 5′ and 3′ ends, assisted by Mfold web server application. Two different kinds of aptamer with varied lengths (randomized region of 30 and 74 bases) were desired for this study, generated against Influenza A/Panama/2007/1999 (H3N2) and gD protein of Herpes Simplex Virus-1. It was found that shortening the aptamer length by crawling pattern is possible with the assistance of Mfold web server application. The obtained results resemble the shortened aptamer derived by mapping analyses. The proposed strategy is recommended to predict the shorter aptamer without involving any wet experimental section.

Novel ZnO combined structures were obtained using the radio frequency (RF) sputtering method. The effects of two different substrates, Si and 128° YX LiNbO 3 , on the structural, morphological, and optical properties of ZnO films were investigated. Field emission scanning electron microscopy clearly revealed the formation of a mixed flake-corolla lobe-like structure. The grain size of the obtained structure depended on the substrate type. Two different X-ray diffraction peaks were obtained for ZnO growth on LiNbO 3 , at the (200) and (201) diffraction planes, respectively.

This study describes the fabrication of three different gap-fingered aluminum-interdigitated electrodes (AlIDEs) on the silicon substrate based on photolithographic method, followed by integration of the gold nanorod–zinc oxide nanocomposite. The IDE masks were designed using AutoCAD software with the gaps of 10, 20, and 30 μm for design 1, 2, and 3, respectively. The morphological and electrical characterizations were subsequently performed using 3D-nanoprofiler, atomic force microscopy, high-power microscopy (HPM), scanning electron microscopy (SEM), and I–V. Validation of the fabricated surfaces (AlIDEs with/without gold nanorod–zinc oxide nanocomposite) against the electrolytes was performed at different pHs which are ranging from 1 to 12. SEM revealed the following gaps, 18.4, 20, and 40.5 μm for bare 1, 2, and 3, respectively. The measurements on I–V for bare AlIDEs indicated the electrolyte influences at different pH solutions, which were almost similar in terms of current variations except at highly acidic and alkaline. AlIDEs were well fabricated and the smaller the gap displayed the better the sensitivity, hence device 1 AlIDE has a good performance. Using different pH solutions which ranging from pH 1–12, before and after AlIDEs were coated with zinc oxide and gold nanorod. The responses of the devices were similar, fluctuating from highly acidic region to highly alkaline region in the cases of AlIDEs bare 1 and 3. Bare 2 AlIDE displayed similar responses with the AlIDE that was deposited with gold nanorod. With these results, we can conclude that deposition of gold nanorod on the device brought about the orderly response to the different pH and with the increment from acidic to alkaline increases, the proportional changes with the current were noticed.

Biosensor with insensitive electrolyte variation is one of the basic norms to be investigated for developing a high-performance disease diagnostic with a non-biofouling. On the other hand, the optimum dimension of biosensor plays a significant factor to be considered for generating a biosensensing system with a least influence by the buffering agents. In this research, interdigitated aluminium electrode (AlIDE) with four different microscale gap sizes, 400, 100, 60 and 45 µm were fabricated through a photolithography technique on the silicon substrate. The accuracy of the device fabrication was justified by the morphological examination using field emission scanning electron microscopy, high-power microscopy and 3D-nano profilometer. The current amplified by four devices under bare condition was 2.55E−3 A at 2 V explains the accuracy of the device fabrication and the uniformity in the electric flow. Electrolyte scouting was executed on the fabricated AlIDEs with the pH ranges between 1 and 12, the results interpret small gap sized AlIDEs (60 and 45 µm) show the variation in the current with different pH solutions due to the ionic flux. The insensitivity of zeolite nanoparticle (~ 10 nm size) attached AlIDE with 400 µm and 100 µm at different pH solutions were analyzed. Linear current curves with least variations were attained from pH 1 to 11. At 2 V voltage supply, the amount of current generated by AlIDE with and without zeolite attachment during pH scouting were same (1E−4 A), with the same microscale gap sizes. However, there was no current fluctuation observed with zeolite attached AlIDE during pH scouting analysis. Further, the chemically functionalized zeolite nanoparticle behaves better than unmodified one and gold nanoparticle with the similar modifications. The results obtained in the present research denotes that microscale gap size was altered to nanoscale gap size in the presence of nanomaterials on the AlIDE sensing surface, enhances the sensitivity of the device and improves the insensitivity of device to the electrolytes. Thus, optimum microscale gap sized AlIDE is easier to fabricate, could be utilized for medical diagnostics with insensitive pH variation through the advanced physiochemical properties of nanomaterials.

The pragmatic outcome of a lung cancer diagnosis is closely interrelated in reducing the number of fatal death caused by the world's top cancerous disease. Regardless of the advancement made in understanding lung tumor, and its multimodal treatment, in general the percentage of survival remain low. Late diagnosis of a cancerous cell in patients is the major hurdle for the above circumstances. In the new era of a lung cancer diagnosis with low cost, portable and non-invasive clinical sampling, nanotechnology is at its inflection point where current researches focus on the implementation of biosensor conjugated nanomaterials for the generation of the ideal sensing. The present review encloses the superiority of nanomaterials from zero to three-dimensional nanostructures in its discrete and nanocomposites nanotopography on sensing lung cancer biomarkers. Recent researches conducted on definitive nanomaterials and nanocomposites at multiple dimension with distinctive physiochemical property were focused to subside the cases associated with lung cancer through the development of novel biosensors. The hurdles encountered in the recent research and future preference with prognostic clinical lung cancer diagnosis using multidimensional nanomaterials and its composites are presented.

This study represents the surface charge transduction, an efficient and inexpensive biosensor with modifications by silica-alumina entities and determination of gene sequence hybridization. The sensing surface was made by the planar aluminium interdigitated electrode on silicon substrate. Silica and alumina nanoparticles were engineered on the planar transducer surface and the device sensitivity was investigated. The morphology of silica and alumina particles was characterized through the high-resolution election microscopic analyses and revealed the spherical shaped nanoscale sizes at the range of 45–100 nm. The elemental compositions of silica and alumina nanomaterial were affirmed through energy disperse spectroscopy as prominent peaks of Si, Al and O were observed. Selected area electron diffraction analysis of silica and alumina justified their crystalline and amorphous nature, respectively. XRD analysis revealed the expending cristobalite state of silica crystal and γ -alumina for planar electrode surface enhancement. Fourier transform infrared spectroscopy peak observed at 1094 cm−1 revealed the asymmetric stretching of silica nanoparticles whereas the projecting peak observed at 806 cm−1. Additionally, Al–O stretch and Al–O–Al bending modes were justified with the peaks at 585 and 825 cm−1, respectively. Band gap values of silica and alumina computed were 6.75 eV and 3.20 eV, respectively. The results of DNA probe immobilization and complementation have affirmed that silica modified transducer shows the lowest detection at 10 aM whereas alumina modified transducer displayed insignificant current signal and failed to detect DNA hybridization. To investigate the effect of silica entity and its nanocomposite in detecting DNA hybridization, aluminosilicate nanocomposite was deposited on transducer and attained highly sensitive gene detection. Based on the coefficient regression value, aluminosilicate nanocomposite modified planar transducer has shown good device sensitivity (R2 = 0.96) in contrast to silica and alumina entities.

The remarkable properties of graphene have directly accelerated the graphene research. Due to its unique and remarkable characteristics, graphene can be potentially used in various applications. Chemical Vapour Deposition (CVD) has been identified as a promising and important method for preparation and production of graphene due to its good film uniformity and large scale production. Herein, we demonstrated that reaction parameters including the reaction duration and reaction temperature could affect the quality, quantity and morphology of synthesized samples. Energy Dispersive X-ray (EDX) results indicated that the carbon content on the graphene-like samples increased with the increasing reaction duration. Scanning electron microscopy (SEM) images showed that thicker carbon clusters were grown when a longer reaction time was used. X-ray diffraction (XRD) pattern indicted carbon existed in the samples synthesized. The comparison between different reaction parameters can assist in selecting the optimum growth parameters of graphene-like samples.

Cardiovascular disease (CVD) is a major threat to global health, estimated to be the cause 30 % (17.3 million in 2008) of deaths every year, and the number of deaths caused by CVD is expected to increase further, reaching 23.3 million by 2030. Hence, there is a growing demand for simpler sample extraction, rapid screening results, and intervention of the subsequent analysis in emergency units. In this paper, we reviewed CVD biomarkers in blood- and saliva-based specimens. The history of cardiac biomarkers indicates that in the beginning, cardiac troponin I (cTnI) was a widely accepted 'gold standard' marker due to its high specificity and selectivity. Considering the advantages of salivary-based cardiac biomarkers, we examined correlations between non-invasive (salivary) and invasive (blood) diagnoses, and it was found that C-reactive protein (CRP) provides a better correlation. Despite the low abundance of salivary CRP, several reports displayed the detection limit down to pg/ml using existing technologies. Thus, salivary CRP has the potential to be used for future forefront diagnostics for the early assessment of cardiac risks.

Silicon carbide (SiC) is an important ceramics for engineering and industrial applications due to its advantage to withstand in high temperatures. In this article, a demonstration of SiC nanowhiskers synthesis by using microwave heating has been shown. The mixtures of raw materials in the form of pellets were heated, using a laboratory microwave furnace, to 1400 °C for 40 minutes at a heating rate of 20 °C/min. The characterization process proved that the mixture of graphite and silica in the ratio of 1:3 is an ideal composition for synthesizing single phase β-SiC nanowhiskers. Vapor-solid mechanism was suggested to explain the formation of SiC nanowhiskers by the proposed microwave heating.

This article describes a sensitive impedimetric method for the determination of human blood coagulation factor IX protein (FIX) which is present in extremely low concentration in serum. An interdigitated electrode (IDE) whose surface was layered with zinc oxide was modified with two kinds of probes. One is an antibody, the other an aptamer against FIX. A comparative study between anti-FIX aptamer and anti-FIX antibody showed the aptamer to possess higher affinity for FIX. A sandwich aptamer assay was worked out by using the FIX-binding aptamer on the surface of the IDE. It has a detection limit as low as 10 pM which makes it 4 to 30-fold more sensitive than any other method reported for FIX. Moreover, to practice detection in clinical samples, FIX was detected from the human blood serum by spiking. In our perception, the sensitivity of the ZnO-modified IDE presented here makes it a promising tool for sensing clinically relevant analytes that are present in very low (sub-pM) concentrations.

Silicon carbide nanomaterials, especially silicon carbide nanotubes (SiCNTs), are known as excellent materials for high-power and high-temperature harsh environment electronics applications because of the unique properties of SiCNTs, such as a high thermal stability, good chemical inertness and excellent electronic properties. In this article, we presented a novel synthesis of SiCNTs by microwave heating a blend of silicon dioxide (SiO 2 ) and multi-walled carbon nanotubes (MWCNTs) at a ratio of 1:3 at temperatures of 1350 °C, 1400 °C and 1450 °C. The effects of different heating temperatures on the synthesis of SiCNTs were studied. X-ray diffraction revealed the presence of single phase β-SiC for syntheses conducted at 1400 °C and 1450 °C. Meanwhile, field-emission scanning electron microscopy images showed that no residual silicon dioxide or MWCNTs was observed with syntheses conducted at 1400 °C and 1450 °C. High-magnification transmission electron microscopy revealed that the tubular structure of the MWCNTs was preserved and that SiCNTs had a lattice fringe spacing of 0.261 nm corresponding to the (111) plane of β-SiC. Photoluminescence spectroscopy showed the presence of a β-SiC peak at a wavelength of 465 nm, and the band gap energy of SiCNTs was 2.67 eV. Fourier transform infrared spectroscopy analysis revealed that the absorption band of the Si–C bond was detected at 803 cm −1 . The purity of SiCNTs synthesized at 1400 °C and 1450 °C is high, as indicated by the low weight loss in thermo-gravimetric analysis.

Thin films of reduced graphene oxide–multiwalled carbon nanotube (rGO–MWCNT) composites were demonstrated as sensing membrane electrodes for single-stranded DNA (ssDNA) detection. The morphology of the rGO–MWCNT composite thin films was observed via field emission scanning electron microscopy. The GO sheet and MWCNTs were clearly obtained, and the MWCNTs were uniformly distributed on the surface of the GO. The chemical bonding of the rGO–MWCNTs was examined using Fourier transform infrared spectroscopy. The element compositions of carbon, silicon, and oxygen were confirmed via energy-dispersive X-ray spectroscopy and X-ray powder diffraction analysis. The biosensor demonstrated high sensitivity to the ssDNA target with a linear range from 500 to 100 pM. Furthermore, the biosensor demonstrated good selectivity, reproducibility, and long-term stability for DNA detection. Since, the biosensor responded very-well and demonstrated excellent detection capabilities, it is highly recommended to be used in detecting specific biomarkers and other targeted proteins.

The 16 kDa heat shock protein (16 kDa HSP) against Mycobacterium tuberculosis (MT), expressed during the growth phase of MT, is a potential target in diagnostic tests for tuberculosis (TB). We describe here a method for impedimetric determination of the antigen by using a nanogapped dielectric surface consisting of a silver support coated with a thin finger-shaped coating made from zinc oxide and gold and patterned through a lift-off process. The electrode was characterized by scanning electron microscopy, field emission scanning electron microscopy, atomic force microscopy, and energy-dispersive X-ray spectroscopy. Surface chemical functionalization and immobilization of antibody against the 16 kDa HSP was evidenced by FTIR. In order to improve the detection limit, the antigen was conjugated to 10 nm gold nanoparticles. The resulting biosensor is capable of detecting the 16 kDa HSP in concentrations as low as 100 fM. The method covers a wide analytical range that extends from 100 fM to 1 nM.

Conventional methods for the synthesis of silicon carbide were well studied and these methods included carbothermal reduction, mechanical milling, sol-gel process and others. However, conventional methods have limitations such as high energy consumption, presence of impurities and long reaction times. In this paper, microwave heating was applied for the first time for the synthesis of silicon carbide nanotube owing to the advantages of microwave heating such as shorter reaction time, uniform heat distribution and low cost. Mixture of silicon dioxide and carbon nanotube in the ratio of 1:3 as suggested by previous study were mixed in ultrasonic bath using ethanol as liquid medium for 2 hours and then dried on hot plate to evaporate ethanol. The mixture was then cold pressed into 3mm pellet and placed into an alumina crucible filled with silica sand acts as sand insulator and SiC susceptor. The pellet was heated to 1400°C with heating rate of 30°C/min for 40 minute. X-ray diffraction pattern verified the presence of single β-SiC phase in silicon carbide nanotubes. Meanwhile, scanning electron microscopy revealed that tubular structure of carbon nanotube was retained after microwave irradiation and energy dispersive x-ray spectroscopy shown the silicon carbide nanotube consist of only elemental C and Si and thus indicated that silicon carbide nanotubes were successfully synthesized through microwave irradiation.

In this study, porous anodic alumina was formed by anodizing of aluminum alloy AA6061 in oxalic acid with concentration ranged from 0.1 M to 1.0 M respectively. AA6061 alloys were anodized at 40 V and 25°C for 60 minutes. FESEM images show that the uniformity of the pores arrangement of porous anodic alumina depends significantly on the concentration of oxalic acid. Well-ordered porous anodic alumina was formed in oxalic acid of 0.3 M, 0.5 M and 0.7 M while disordered porous anodic alumina were formed when the oxalic acid of 0.1 M and 1.0 M were used as electrolytes. EDX analysis revealed that the only peaks corresponding to aluminum and oxygen were detected. Pore size was found to increase with the concentration of oxalic acid while the interpore distance remained almost unchanged although the concentration of oxalic acid increased from 0.1 M to 0.7 M. Atypical anodic alumina without pores arrangement was formed when 1.0 M oxalic acid was used for anodizing.

The Chinese traditional joss paper has been recycled and silica and aluminium nanocomposite production is reported in the current research, using an alkalinization procedure. Characterization of silica and aluminium nanocomposite extracted was performed using field-emission transmission electron microscope (FETEM), field-emission scanning electron microscope (FESEM), UV–visible spectroscopy, high-power optical microscopy (HPM) and 3D nano profiler, indicates the size, shape and particle distribution, eventually reveals the purity of silica and aluminium nanocomposite synthesized. The silica-aluminium nanocrystal synthesized from joss paper waste was found to be ~ 15 nm size range under FETEM analysis and FESEM analysis revealed the uniform spherical shape. The energy disperse spectroscopy (EDX) data attained from FESEM analysis affirmed the synthesis of silica-aluminium nanocomposite with greater purity since the ratio of silicon to aluminium observed in EDX spectra was 13.24 to 7.96. HPM indicated the size of agglomerated aluminosilicate is 36.74 μm whereas 3D nano profiler has proven that the height of nanocrystal synthesized from joss paper waste is 234.37 μm. Band gap value of 3.84 eV, calculated using UV–vis absorbance readings further affirmed the size of nanocomposite which is in good agreement with presented results.

The Cu2Zn1źxCdxSnS4 quinternary alloy nanostructures with different Cd contents were grown using spin coating technique on porous silicon (63.93 %) substrate. The structural properties of Cu2Zn1źxCdxSnS4/PS were investigated by X-ray diffraction and field emission-scanning electron microscope (FE-SEM). The optical properties studied through photoluminescence technique, indicated that the band gap is shifted as Cd content increases from 1.84 eV at x = 0 to 1.76 eV at x = 1. The electrical characterization of the Ag/n-PS/Cu2Zn1źxCdxSnS4/Ag diode through current to voltage (I---V) characterization shows the highest photo-response of (value if any) at Cu2Zn0.4Cd0.6SnS4 composition.

This paper are focused to characterize the difference CNTs deposit on Titanium Oxide (TiO 2 ) as metal sensing for formaldehyde molecule detection. The sensor was fabricated by using two types of CNTs which is Single wall carbon nanotube (SWCNT) and Multi wall carbon nanotube (MWCNT) for measuring the most suitable device for detecting the formaldehyde gas. Characterization of difference IDE pattern is demonstrated by various measurements.

Interdigitated Electrode are known as one of the hallmark of biosensors because of its numerous applications. Biosensors projects to be preferable devices especially in hospitals and other medical faculties as well as in other interdisciplinary fields because of its small size and high sensitivity. Since size plays a salient role in sensitivity and selectivity, in this research, 140 nm IDEs and 50μm IDEs were used to test the electrical characterization using current-voltage (I-V) for comparison. The morphological of IDEs were taken by using High Power Microscope with 50x magnification and Scanning Electron Microscope (SEM). Aim of this research is to test electrical characterization on bare aluminium IDEs and IDEs doped with pH solution for both nano Interdigitated Electrode (nIDEs) and also micro Interdigitated Electrodes (μIDEs). Each IDE was tested to achieve a stable pattern of electrical measurements and results were obtained by current-voltage graph. The pH solutions used for this research from pH 2 to pH 12 were dropped on nano IDEs as well as micro IDEs and conductivity was tested using two-point probe and based on the results it was proven that the conductivity of both types of IDEs differs depending on their finger gap size.

Efficient micromixing is required for fast reaction and improved mixing performance for DNA extraction in microfluidic devices. This study outlines a simple, low cost approach for prototyping design and fabrication of PDMS microfluidics micromixers for DNA extraction. The design is plotted using AutoCAD software and the master template is fabricated using a negative photoresist, SU-8, on a microscopic glass slide. PDMS was used for replication of microfluidics channels to create a microfluidics chip due to its biocompatibility as well as other advantages pertaining to high performance of fluid delivery and biochemical reactions. High power microscopy (HPM) results show successful, insignificant difference in size

This paper was studies about the effect of difference fabrication of TiO 2 nanoparticle sensor on surface morphological structure and electrical properties for detection of formaldehyde. Two type of deposition method are used to deposit TiO 2 nanoparticle layer on IDE/Si/SiO 2 substrate. The fabrication of IDE was done by using conventional photolithography process. In the second method, the solution TiO 2 was directly deposited by using e-beam evaporator. The fabricated of sensor was further validated through characterization on morphological surface inspection and electrical properties of the device. The roughness of TiO 2 film was demonstrated that the latter method is preferable due surface uniformity approximately 70 nm in grain size to provide resistance barrier to allow current flow when interface with the formaldehyde. The result was demonstrated by various measurement.

Anxiety is a psychological problem that often emerges during the normal course of human life. The detection of anxiety often involves a physical exam and a self-reporting questionnaire. However, these approaches have limitations, as the data might lack reliability and consistency upon application to the same population over time. Furthermore, there might be varying understanding and interpretations of the particular question by the participant, which necessitating the approach of using biomarker-based measurement for stress diagnosis. The most prominent biomarker related to stress, hormone cortisol, plays a key role in the fight-or-flight situation, alters the immune response, and suppresses the digestive and the reproductive systems. We have taken the endeavour to review the available aptamer-based biosensor (aptasensor) for cortisol detection. The potential point-of-care diagnostic strategies that could be harnessed for the aptasensing of cortisol were also envisaged.

One-dimensional silicon carbide nanomaterial (SiCNM) is the leading potential material for high temperature, high power and harsh environment components and devices. This is due to the outstanding properties of the one-dimensional SiCNMs such as high mechanical properties, high hardness, good chemical inertness and excellent electronic properties. In this paper, we reported the successful synthesis of one-dimensional SiCNMs from blend of SiO2 particles with two types of CNTs, namely MWCNTs and SWCNTs by using microwave heating and the effect of types of CNTs on the synthesis of one-dimensional SiCNMs. The result of x-ray diffraction, field emission scanning electron microscopy, high resolution transmission electron microscopy, energy dispersive x-ray spectroscopy, photoluminescence spectroscopy, Fourier transform infrared spectroscopy and thermo-gravimetric analysis revealed that high purity of β-SiC nanotube was obtained from blend of SiO2 particles and MWCNTs while solid SiC nanowire was synthesized from blend of SiO2 particles and SWCNTs and associated with the presence of residual of unreacted SiO2 particles. This clearly shows that types of one dimensional SiCNMs (hollow or solid) can be controlled by using different types of CNTs and thus this study proposed a high efficiency microwave heating method for the synthesis of one-dimensional SiCNMs with controllable morphology.

Amylase is an important and indispensable enzyme that plays a pivotal role in the field of biotechnology. It is produced mainly from microbial sources and is used in many industries. Industrial sectors with top-down and bottom-up approaches are currently focusing on improving microbial amylase production levels by implementing bioengineering technologies. The further support of energy consumption studies, such as those on thermodynamics, pinch technology, and environment-friendly technologies, has hastened the large-scale production of the enzyme. Herein, the importance of microbial (bacteria and fungi) amylase is discussed along with its production methods from the laboratory to industrial scales.

Among many methods to synthesize Zinc Oxide (ZnO) thin films, the most commonly used method is sol gel technique. In this study, we have used sol gel approach deposited on silicon substrate. To investigate the structural and electrical properties of ZnO thin films, silicon substrates were coated at 1, 3, 5 and 7 layers of ZnO thin film. For characterization purposes, SEM and Current-Voltage measurements were observed and recorded to optimize the morphological and electrical aspects of the ZnO respectively. From the results recorded, it is justified that the more grain particles present on the substrate the higher the current conducted. However, an excessive amount of grain particles can cause crowding effect and thus, alter the electrical and surface characteristics of the sample.

Soft lithography describes the moulding of polymers using master templates, a technology that is widely used in microfluidics fabrication. This study outlines a quick and low cost soft lithography processing using negative photoresist (PR) SU-8 on glass substrate to create a master template for subsequent Polydimethylsiloxane (PDMS) replication in overall microfluidics fabrication. Two types of negative PR, SU-8 5 and SU-8 2015 are used in this study to increase the adhesion of the resist. Inkjet transparent mask is used as microfluidic photomask instead of expensive chrome mask and the design was made on AutoCAD software. Results from high power microscopy (HPM) and 3D profilometer show successful fabrication with