Search

UMR BFP - Equipe Virologie UMR BFP - Equipe VirologieUMR BFP - Equipe Virologie; National audience

Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5′CGCTCAACATCCTTTTCAGGGTAG3′ and 5′CAAAGATGGCCAGGAA3′ (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the country. References: (1) D. Fargette et al. Annu. Rev. Phytopathol. 44:235, 2006. (2) Z. L. Kanyeka et al. Afr. Crop Sci. J. 15:201, 2007. (3) I. Ndikumana et al. New Dis. Rep. 23:18, 2011.

International audience

UMR BGPI - Equipe 2; National audience; Du fait de l’immobilité de leurs hôtes, l’immense majorité des virus de plante utilisent des vecteurs spécifiques pour passer d’un hôte à un autre. Ces « véhicules de transport » sont principalement des arthropodes et en grande majorité des pucerons, qui sont des insectes de type piqueur-suceur [1]. Pour les interactions virus-vecteur, la stratégie la plus communément utilisée par les virus de plante est la transmission dite non circulante, où les particules virales prélevées lors d’un repas dans les cellules infectées seront retenues au niveau de sites d’attachement dans les pièces buccales antérieures de l’insecte sans effectuer de passage à l’intérieur de son organisme. Ces particules virales seront ensuite relarguées de ces sites d’attachement lors de piqûres sur de nouvelles cellules hôtes et induiront ainsi l’infection dans de nouvelles plantes [2]. Si les mécanismes moléculaires de la transmission non circulante sont bien documentés en ce qui concerne le partenaire viral, les sites d’attachement correspondants dans les stylets du vecteur demeurent la principale « boîte noire » pour laquelle aucune donnée n’est disponible. Malgré l’importance de ce mode de transmission, l’existence même d’un récepteur spécifique n’a jamais été prouvée pour aucun virus. Dans une étude très récemment publiée [3], nous avons localisé précisément le récepteur du Caulifower mosaic virus (CaMV) et déterminé sa nature chimique.

International audience; The recessive gene rymv-1 responsible for the high resistance of Oryza sativa cultivar Gigante to Rice yellow mottle virus (Sobemovirus) was overcome by the variant CI4* which emerged after serial inoculations of the non-resistance-breaking (nRB) isolate CI4. By comparison of the full-length sequences of CI4 and CI4*, we identified a non-synonymous mutation at position 1729 localised in the putative VPg domain and developed an assay based on this single nucleotide polymorphism. The mutation G1729T was detected as early as the first passage in resistant plants and was found in all subsequent passages. Neither reversion nor additional mutation were observed. The substitution G1729T introduced by mutagenesis in the VPg of an nRB infectious clone is sufficient to induce symptoms in non-inoculated leaves of cultivar Gigante. This is the first evidence that VPg is a virulence factor in plants with recessive resistance against viruses outside the family Potyviridae.

International audience

International audience

International audience

International audience