Search

Objective: To determine if the risk of post-cesarean wound morbidity in patients undergoing staple versus suture closure is modified by diabetic status. Methods: Secondary analysis of a randomized trial of skin closure with subcuticular 4-0 monocryl suture or surgical staples after cesarean delivery. The primary outcome was a composite of wound disruption or infection within 4–6 weeks. We compared the association between this outcome and skin closure method by diabetic status (also stratified by gestational or pregestational) using the Breslow–Day test for interaction. Results: Of 350 patients, 179 were randomized to staples and 171 to suture. Of the 67 (19.1%) diabetic patients, 35 were gestational and 32 pregestational. The incidence of composite wound morbidity in non-diabetics was 16.7% for staples and 3.6% for suture (p ≤ 0.001, RR: 4.6, 95% CI: 1.8–11.8); it was 5.7% for staples and 15.6% for sutures in diabetics (p = 0.25, RR: 0.4, 95% CI: 0.1–1.7). The corresponding Breslow–Daypvalue indicated a significant difference between diabetics and non-diabetics (p = 0.002). Stratified further by gestational and pregestational diabetes, the RRs were 0.3 (95% CI: 0.03–2.4) and 0.5 (95% CI: 0.05–5.0) compared to non-diabetics, respectively. Each diabetic sub-group was significantly different from non-diabetics (Breslow–Daypvalues for homogeneityp = 0.005 andp = 0.045, respectively). Conclusions: The use of staples compared with subcuticular suture for cesarean skin closure is associated with increased wound morbidity. While this is true for non-diabetics, further studies of diabetics are needed to evaluate for a null or opposite effect of closure type. [ABSTRACT FROM PUBLISHER]

Objective: Risk factors for post-cesarean wound infection, but not disruption, are well-described in the literature. The primary objective of this study was to identify risk factors for noninfectious post-cesarean wound disruption. Methods: Secondary analysis was conducted using data from a single-center randomized controlled trial of staple versus suture skin closure in women ⩾24 weeks' gestation undergoing cesarean delivery. Wound disruption was defined as subcutaneous skin or fascial dehiscence excluding primary wound infections. Composite wound morbidity (disruption or infection) was examined as a secondary outcome. Patient demographics, medical co-morbidities, and intrapartum characteristics were evaluated as potential risk factors using multivariable logistic regression. Results: Of the 398 randomized patients, 340, including 26 with disruptions (7.6%) met inclusion criteria and were analyzed. After multivariable adjustments, African-American race (aOR 3.9, 95% Cl 1.1-13.8) and staple - as opposed to suture - wound closure (aOR 5.4, 95% Cl 1.8-16.1) remained significant risk factors for disruption; non-significant increases were observed for body mass index ⩾30 (aOR 2.1, 95% Cl 0.6-7.5), but not for diabetes mellitus (aOR 0.9, 95% Cl 0.3-2.9). Results for composite wound morbidity were similar. Conclusions: Skin closure with staples, African-American race, and considering the relatively small sample size, potentially obesity are associated with increased risk of non-infectious post-cesarean wound disruption. [ABSTRACT FROM AUTHOR]

OBJECTIVE: To estimate the relationship between 1-hour 50 g glucose challenge test values and perinatal outcomes. METHODS: This was a secondary analysis of data from a multicenter treatment trial of mild gestational diabetes mellitus. Women with glucose challenge test values of 135-199 mg/dL completed a 3-hour oral glucose tolerance test. Mild gestational diabetes mellitus was defined as fasting glucose less than 95 mg/dL and two or more abnormal oral glucose tolerance test values: 1-hour 180 mg/dL or more; 2-hour 155 mg/dL or more; and 3-hour 140 mg/dL or more. Our study included untreated women with glucose challenge test values of 135-139 mg/dL and 140-199 mg/dL and a comparison group with values less than 120 mg/dL. Primary outcomes included a perinatal composite (stillbirth, neonatal death, hypoglycemia, hyperbilirubinemia, neonatal hyperinsulinemia, and birth trauma), large for gestational age (LGA, birth weight above the 90th percentile based on sex-specific and race-specific norms), and macrosomia (greater than 4,000 g). RESULTS: There were 436 women with glucose challenge test values less than 120 mg/dL and 1,403 with values of 135 mg/dL or more (135-139, n=135; 140-199, n=1,268). The composite perinatal outcome occurred in 25.6% of those with glucose challenge test values less than 120 mg/dL compared with 21.1% for values of 135-139 mg/dL and 35.3% for values of 140-199 mg/dL. Rates of LGA by group were 6.6%, 6.8%, and 12.4%, respectively. Rates of macrosomia by group were 7.8%, 6.1%, and 12.1%, respectively. Compared with glucose challenge test values less than 120 mg/dL, the adjusted odds ratios (ORs) (95% confidence intervals [Cls]) for values of 140-199 mg/dL were 1.48 (1.14-1.93) for the composite outcome, 1.97 (1.29-3.11) for LGA, and 1.61 (1.07-2.49) for macrosomia. For glucose challenge test values of 135-139 mg/dL, adjusted ORs and 95% Cls were 0.75 (0.45-1.21), 1.04 (0.44-2.24), and 0.75 (0.30-1.66), respectively. The subcategories with glucose challenge test values of 140-144 mg/dL and 145-149 mg/dL also were associated with an increase in selected outcomes when compared with those with values less than 120 mg/dL. CONCLUSIONS: Glucose challenge test values of 135-139 mg/dL were not associated with adverse outcomes compared with values less than 120 mg/dL; however, glucose challenge test values of 140 mg/dL or more were associated with an increase in odds of the composite perinatal outcome, LGA, and macrosomia. [ABSTRACT FROM AUTHOR]

The article discusses the results of a study that compared the surgical staples and subcuticular suture to determine the risk of cesarean wound disruption or infection. The study showed 7.1 percent primary outcome incidence at hospital discharge for staples and 0.5 percent for suture. It concludes that compared with suture, staples closure is associated with increased composite wound morbidity after cesarean delivery.

Objetives. To establish the existence of concurrent infections by different dengue virus (DENV) serotypes in an outbreak in the Northwestern in Peru during 2008. Material and methods. 73 serum samples from patients with dengue were analyzed during an outbreak that occurred in Northwestern in Peru between May and June 2008. Molecular biology techniques were used to serotype the DENV, thus, firstly the viral RNA viral was extracted using Viral QIAamp RNA mini kit (Qiagen, Valencia, California, USA), then the viral cDNA fragments were reverse transcripted and amplified by means of the Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) and the RT-Nested PCR region techniques and finally, genetic sequencing of the viral cDNA fragments were performed using the Big Dye Terminator v.3,1 kit. Results. The 73 dengue cases presented infections by different serotypes: 34 (46.6%) by DENV-3, 29 (39.7%) by DENV-1, 4 (5.5%) by DENV-4, and 6 (8.2%) concurrent infections by DENV-1 and DENV-3. The most frequent clinical manifestations observed among dengue patients were fever and headache (100%), myalgia (94.5%), ocular pain (83.6%), arthralgia (78.1%), shivers (63.0%), nausea/vomiting (38.4%), positive tourniquet test (30.1%), and rash (20.5%). All patients with concurrent infections presented light clinical course of dengue fever (Df) except one patient who had moderate hemorrhagic manifestations. Conclusion. This is the first Peruvian report of patients with concurrent infections of two DENV serotypes without severe clinical manifestations. [ABSTRACT FROM AUTHOR]

Objetivo: identificar corredores y presencia de estacionalidad en la circulación de los serotipos de dengue se realizó mapas de calor de los serotipos de dengue según departamento año y mes. Métodos: se realizó un estudio descriptivo de la distribución geográfica y temporal de las muestras confirmadas de dengue por los métodos de RT-PCR y Aislamiento y Tipificación Viral registradas en el NETLAB entre los años 2010 y 2017 (hasta el primero de octubre) por el Laboratorio Nacional de Referencia del INS. Las bases de datos exportadas del sistema en formato Excel fueron consolidadas en el formato rda del software estadístico R versión 3.3.0, donde se realizó la limpieza y estructuración de la base de datos para efectos del estudio. Resultados: entre los años 2010 y 2017 se presenta un cambio en la distribución geográfica y temporal de los serotipos de dengue. Del 2010 al 2013 los serotipos 1 y 4 circulaban en la mayoría departamentos, a partir del año 2014 la propagación del serotipo 1 se acentuó en los departamentos del norte y en Madre de Dios solo el serotipo 4. Desde el 2011, el serotipo 2 se propagó en diferentes departamentos, desplazando al serotipo 1 hasta la actualidad. El patrón de propagación en los serotipos 2 y 3 es el mismo en los departamentos de la costa norte a partir del año 2014. Conclusiones: la distribución geográfica y temporal es una estrategia que identifica y dimensiona la circulación de los serotipos de dengue en los departamentos, y orienta la estrategia de control en zonas con la presencia de más de un serotipo circulante. [ABSTRACT FROM AUTHOR]

Our objective was to determine the genotype of the dengue virus type 2 (DENV-2) that circulated in the Amazon region of Peru between November 2010 and January 2011. We analyzed eight samples collected during dengue surveillance activities in the cities of Iquitos, yurimaguas, Trujillo, Tarapoto and Lima between November 2010 and January 2011 that were sent to Insitituto Nacional de Salud. The viruses were isolated in C6/36 HT cell line. Viral RNA was extracted and the serotype (RT - PCR multiplex) and genotype (RT-Nested PCR of the region E/NS1) were determined. finally, the E/ NS1 amplicons were sequenced and analyzed by phylogeny. The phylogenetic analysis revealed the introduction of a different lineage which entered in Peru by the end of 2010. These isolates found in Iquitos and other cities in Peru are closely related to DENV-2 isolates that circulated in Brazil during 2007 and 2008, associated with severe dengue cases and deaths. In conclusion, we detected the introduction of a different lineage of DENV-2 America / Asia genotype in Peru that could be associated with the presence of more severe cases. [ABSTRACT FROM AUTHOR]

Objetivo: analizar la filogenia de la secuencia parcial de la glicoproteína de la envoltura E2 del virus Mayaro de aislamientos virales de 7 muestras serológicas de pacientes de regiones: Madre de Dios, San Martin y Loreto; detectados por el Laboratorio de Referencia Nacional de Metaxenicas Virales. Métodos: se realizó un estudio descriptivo, analizando la secuencia parcial de la glicoproteína de la proteína E2 de envoltura, para lo cual se aisló el virus en células vero CCL-81, obteniéndose la cepa viral de 7 muestras de suero de pacientes provenientes de las regiones Madre de Dios, San Martin, y Loreto, para luego proceder a extraer el ARN por medio del Kit QIAamp Viral RNA Mini Kit (QIAGEN), siguiendo las indicaciones del fabricante. Para la identificación de los genotipos virales, se utilizó RTPCR convencional para la amplificación de la región E2/ E3 del genoma del MAYV mediante el uso de los primers MayF1 (5'CTTCCCATGTTTCCAACCGAG 3') y MayB2 (5' GCCAGGATAAAGTGTCCCATTGTG 3'), estos amplificados posteriormente fueron secuenciados. El análisis de las secuencias de nucleótidos obtenidas, se realizó utilizando el programa Chromas Lite version 2.1 (2012, Technelysium Pty Ltd, South Brisbane, Queensland, Australia). Y para el ensamblaje se utilizó el programa MEGA 6.06, hasta llegar a una secuencia consenso. Resultados: las 7 secuencias del MAYV procedentes de Madre de Dios, San Martin y Loreto durante el año 2017 se agrupan dentro del genotipo D. Seis secuencias de este estudio mostraron estrecha relación con secuencias de MAYV encontrado en Bolivia del año 2006 y Loreto-Yurimaguas 2011. Una secuencia de Madre de Dios a diferencia de las otras secuencias en estudio mostro mayor afinidad con secuencias de MAYV de Bolivia del año 2002 y Venezuela 2010. Conclusiones: en todos los casos se conserva estrecha relación con secuencias de MAYV encontrado en Bolivia. Lo cual sugiere la continua dispersión de MAYV entre Bolivia y el Perú. Nuestros resultados evidencian la necesidad de establecer un sistema de vigilancia genética. Se requiere más estudios de epidemiologia molecular para comprender mejor la dispersión de esta infección. [ABSTRACT FROM AUTHOR]