Search

Ethiopia is one of the most ethnically and culturally diverse countries. Here, the authors look at genetic and cultural variation in 1,214 Ethiopians to unravel the relationship between genetic admixture and cultural factors.

Since the 1960s, East African athletes, mainly from Kenya and Ethiopia, have dominated long-distance running events in both the male and female categories. Further demographic studies have shown that two ethnic groups are overrepresented among elite endurance runners in each of these countries: the Kalenjin, from Kenya, and the Oromo, from Ethiopia, raising the possibility that this dominance results from genetic or/and cultural factors. However, looking at the life history of these athletes or at loci previously associated with endurance athletic performance, no compelling explanation has emerged. Here, we used a population approach to identify peaks of genetic differentiation for these two ethnicities and compared the list of genes close to these regions with a list, manually curated by us, of genes that have been associated with traits possibly relevant to endurance running in GWAS studies, and found a significant enrichment in both populations (Kalenjin, P = 0.048, and Oromo, P = 1.6x10-5). Those traits are mainly related to anthropometry, circulatory and respiratory systems, energy metabolism, and calcium homeostasis. Our results reinforce the notion that endurance running is a systemic activity with a complex genetic architecture, and indicate new candidate genes for future studies. Finally, we argue that a deterministic relationship between genetics and sports must be avoided, as it is both scientifically incorrect and prone to reinforcing population (racial) stereotyping.

The human FMO2 (flavin-containing monooxygenase 2) gene has been shown to be involved in innate immunity against microbial infections, including tuberculosis (TB), via the modulation of oxidative stress levels. It has also been found to possess a curious loss-of-function mutation (FMO2*1/FMO2*2) that demonstrates a distinctive differentiation in expression, function and ethno-geographic distribution. However, despite evidences of ethnic-specific genetic associations in the inflammatory profile of TB, no studies were done to investigate whether these patterns of variations correlate with evidences for the involvement of FMO2 in antimicrobial immune responses and ethnic differences in the distribution of FMO2 polymorphisms except for some pharmacogenetic data that suggest a potentially deleterious role for the functional variant (FMO2*1). This genetic epidemiological study was designed to investigate whether there is an association between FMO2 polymorphisms and TB, an ancient malady that remains a modern global health concern, in a sub-Saharan Africa setting where there is not only a relatively high co-prevalence of the disease and the ancestral FMO2*1 variant but also where both Mycobcaterium and Homo sapiens are considered to have originated and co-evolved. Blood samples and TB related clinical data were collected from ascertained TB cases and unrelated household controls (n = 292) from 3 different ethnic groups in Ethiopia. Latent Mtb infection was determined using Quantiferon to develop reliable TB progression phenotypes. We sequenced exonic regions of FMO2.We identified for the first time an association between FMO2 and TB both at the SNP and haplotype level. Two novel SNPs achieved a study-wide significance [chr1:171181877(A), p = 3.15E-07, OR = 4.644 and chr1:171165749(T), p = 3.32E-06, OR = 6.825] while multiple SNPs (22) showed nominal signals. The pattern of association suggested a protective effect of FMO2 against both active and latent TB with distinct genetic variants underlying the TB-progression pathway. The results were robust for population stratification. Haplotype-based tests confirmed the SNP-based results with a single haplotype bearing the ancestral-and-functional FMO2*1 "C" allele ("AGCTCTACAATCCCCTCGTTGCGC") explaining the overall association (haplotype-specific-p = 0.000103). Strikingly, not only was FMO2*1 nominally associated with reduced risk to "Active TB" (p = 0.0118, OR = 0.496) but it also does not co-segregate with the 5'-3' flanking top high-TB-risk alleles. The study provides an evidence for the existence of an evolutionary adaptation to an ancient disease based on an ancestral genetic variant acting in a haplotypic framework in Ethiopian populations.