Search

Background Obesity has been identified as an important risk factor for COVID-19 severity. Besides, several reports also suggested that obesity (or a higher BMI) may also be associated with a higher susceptibility to SARS-CoV-2 infection although this remains unclear. Going beyond BMI, our objective was to study several anthropometric characteristics in relation to the seroprevalence of SARS-CoV-2 infection in a large population-based sample. Methods 21,376 participants from the French NutriNet-Santé cohort study were included in the main analyses. An ELISA assay was used to detect anti-SARS-CoV-2 antibodies: 1027 participants were positive and 20,349, negative. Associations between a wide range of anthropometric characteristics (body mass index but also waist and hip circumference and body composition) and the seroprevalence of anti-SARS-CoV-2 antibodies were investigated using multi-adjusted logistic regressions. Results A positive yet unclear association was observed between BMI and SARS-CoV-2 seroprevalence in women (positive linear trend (P = 0.07) that was significant using restricted cubic splines (P = 0.04), but no association with standard categories of BMI). No association was observed in men. Waist circumference (P = 0.04) and waist-to-hip ratio (P = 0.01) associated with a higher seroprevalence in women while opposite trends were observed in men (P = 0.08 and 0.03 respectively). Body, trunk and visceral fat (all P < 0.05), but not lean or muscle mass, associated with higher seroprevalence, especially in women. Conclusions Our results highlight a higher susceptibility to SARS-CoV-2 infection in women with higher body fat, suggesting that central adiposity may be an important factor to consider for risk stratification in the population. Key messages A higher seroprevalence of SARS-CoV-2 infection was observed in women with a higher body fat, but not in men. Central adiposity may be a risk factor for SARS-CoV-2 infection and not only for COVID-19 severity.

Background Many hypotheses were raised regarding a role of nutrition in COVID-19 (susceptibility to infection, disease severity) based on the importance of macronutrients, vitamins or minerals for a proper functioning of the immune system. Our objective was to study the associations between dietary intakes and the seroprevalence SARS-CoV-2 infection in a large population-based sample. Methods Our analyses included 7766 adults from the French NutriNet-Santé cohort who provided at least 6 valid 24h dietary records in the two years preceding the start of the COVID-19 pandemic in France (February 2020). An ELISA assay was used to detect anti-SARS-CoV-2 antibodies: 311 participants were positive and 7455, negative. Associations between dietary intakes and the seroprevalence of anti-SARS-CoV-2 antibodies were investigated using multi-adjusted logistic regressions. Results A lower seroprevalence of SARS-CoV-2 infection was associated to higher intakes of vitamin B9 (HR = 0.84 (0.72-0.98)), vitamin C (HR = 0.85 (0.75-0.97)), vitamin K (HR = 0.86 (0.74-0.99)), dietary fibres (HR = 0.84 (0.72-0.97)), and fruit and vegetables (HR = 0.84 (0.74-0.97)). Higher intakes of calcium (HR = 1.17 (1.01-1.35)) and dairy products (HR = 1.19 (1.06-1.33)) associated to a higher seroprevalence of SARS-CoV-2 infection. No association was observed with other food groups or nutrients or with the overall diet. Conclusions Based on exhaustive seroprevalence data in a large population-based sample, our results suggested that higher intakes of vitamin C, folates, vitamin K, dietary fibres and fruit and vegetables were associated with a lower susceptibility to SARS-CoV-2 infection. Key messages Higher intakes of vitamin C, folates, vitamin K, dietary fibres and fruit and vegetables were associated to a lower susceptibility to SARS-CoV-2 infection, assessed with exhaustive seroprevalence data. Beyond its established role in the prevention of non-communicable diseases, nutrition could also contribute to prevent some infectious diseases such as COVID-19.

In 2019, a new coronavirus (2019-nCoV) infecting Humans has emerged in Wuhan, China. Its genome has been sequenced and the genomic information promptly released. Despite a high similarity with the genome sequence of SARS-CoV and SARS-like CoVs, we identified a peculiar furin-like cleavage site in the Spike protein of the 2019-nCoV, lacking in the other SARS-like CoVs. In this article, we discuss the possible functional consequences of this cleavage site in the viral cycle, pathogenicity and its potential implication in the development of antivirals., Highlights • The genomic sequence of 2019-nCoV indicates that the virus clusters with betacoronaviruses of lineage b. • 2019-nCoV S-protein sequence has a specific furin-like cleavage site absent in lineage b CoV including SARS-CoV sequences. • The furin-like cleavage site in the S-protein of 2019-nCoV may have implications for the viral life cycle and pathogenicity. • Campaigns to develop anti-2019-nCoV therapeutics should include the evaluation of furin inhibitors.

Introduction Le role epidemiologique et clinique des variants SARS-CoV-2 a demontre la necessite de techniques d’identification rapide a partir des prelevements cliniques. Nous avons developpe une technique de typage par clivage endonucleasique des heteroduplexes (ENUHCT). Elle repose sur le melange de deux produits PCR (une reference et un echantillon a etudier). Apres denaturation et rehybridation, on obtient des homoduplex (Ref/Ref, Var/Var) et potentiellement des heteroduplex (Ref/Var). La nuclease clive les heteroduplex creant des fragments de taille differente selon le nombre et la position des mutations. Par electrophorese capillaire, il est facile de detecter la presence de mutation(s) selon le nombre et a la taille des fragments. Materiels et methodes La preuve de concept a ete realisee avec des souches virales ( https://www.european-virus-archive.com/ ) cultivees en cellules Vero-E6 dans un laboratoire NSB3. Les extraits d’acides nucleiques correspondant a 500 prelevements cliniques identifies par sequencage ont ete etudies apres codage aveugle. Amplification PCR : les primers sens (TTACCAGATGATTTTACAGGC) et reverse (AGACTTTAGGTCCACAAAC) [400 nm] amplifient un fragment de 303 pb sous 25-μL avec 12,5 μL de 2X Reaction Mix, 0,5 μL de Superscript II RT/Platinum Taq Mix et 5 μL d’ARN de culture ou 3 μL d’ARN provenant d’echantillons biologiques (30 min/50 °C–2 min/94 °C, puis 40 fois 15 s/94 °C–20 s/55 °C–20 s/68 °C, puis 2 min/72 °C). Mismatch detection : les 2 produits de PCR sont melanges vol/vol. Apres denaturation/hybridation, les reactifs du Kit SURVEYOR (IDT) sont ajoutes suivant le protocole et incubes pendant 1 heure a 42 °C. Capillary electrophoresis : l’analyse des fragments est faite par electrophorese capillaire (Caliper GXII) sur puce ADNerkinElmer avec LabChip GX Reviewer. Sanger sequencing : les produits de PCR ont ete sequences par Genewiz. Resultats Les resultats obtenus sont en parfaite correspondance avec les resultats theoriques. En associant une souche europeenne avec variant UK on obtient 2 fragments (231/72 pb [mismatch en 501]) ; en associant variant UK et variant SA (180/123 pb [mismatch en 484]) ; en associant souche europeenne et variant SA on obtient 4 fragments (180/123/72/51 [mismatch en 484 et 501]). De meme, les resultats obtenus avec les prelevements cliniques nous ont permis d’identifier correctement les variants connus et d’identifier de nouveaux variants. Ces derniers ont ete confirmes par sequencage. Conclusion ENUHCT : – est simple, sensible, peu couteuse ; – permet de detecter les variants reconnus et de decouvrir des variants encore non repertories ; – peut etre appliquee a d’autres microorganismes ; – permet de typer plus de 1000 echantillons par jour.

The GloPID-R (Global Research Collaboration for Infectious Disease Preparedness) chikungunya (CHIKV), o'nyong-nyong (ONNV) and Mayaro virus (MAYV) Working Group has been established to investigate natural history, epidemiology and clinical aspects of infection by these viruses. Here, we present a report dedicated to entomological aspects of CHIKV, ONNV and MAYV. Recent global expansion of chikungunya virus has been possible because CHIKV established a transmission cycle in urban settings using anthropophilic vectors such as Aedes albopictus and Aedes aegypti. MAYV and ONNV have a more limited geographic distribution, being confined to Africa (ONNV) and central-southern America (MAYV). ONNV is probably maintained through an enzootic cycle that has not been characterized yet, with Anopheles species as main vectors and humans as amplification hosts during epidemics. MAYV is transmitted by Haemagogus species in an enzootic cycle using non-human primates as the main amplification and maintenance hosts, and humans becoming sporadically infected when venturing in or nearby forest habitats. Here, we focused on the transmission cycle and natural vectors that sustain circulation of these viruses in their respective locations. The knowledge of the natural ecology of transmission and the capacity of different vectors to transmit these viruses is crucial to understand CHIKV emergence, and to assess the risk that MAYV and ONNV will expand on wide scale using anthropophilic mosquito species not normally considered primary vectors. Finally, the experts identified knowledge gaps and provided adapted recommendations, in order to address future entomological investigations in the right direction. ispartof: ANTIVIRAL RESEARCH vol:174 ispartof: location:Netherlands status: published

In recent decades, the invasive Aedes albopictus vector has spread across Europe and is responsible for numerous outbreaks of autochthonous arboviral disease. The aim of this study was to identify epidemiological and sociological risk factors related to individual levels of exposure to Aedes albopictus bites. A multidisciplinary survey was conducted with volunteer blood donors living in areas either colonised or not by Aedes albopictus in mainland France. Individual levels of exposure were evaluated by measuring the IgG level specific to Aedes albopictus saliva. The most striking risk factors concerned the localisation and characteristics of the dwelling. Individuals living in areas colonised prior to 2009 or recently colonised (between 2010 and 2012) had higher anti-salivary gland extract IgG levels compared with those who were living in areas not yet colonised by Ae. albopictus. The type of dwelling did not seem to impact the level of exposure to Aedes bites. People living in apartments had a higher anti-salivary gland extract IgG level than those living in individual houses but the difference was not statistically significant. Interestingly, the presence of air conditioning or window nets was associated with a noticeable reduction in bite intensity.

The GloPID-R (Global Research Collaboration for Infectious Disease Preparedness) Chikungunya (CHIKV), O'nyong-nyong (ONNV) and Mayaro virus (MAYV) Working Group is investigating the natural history, epidemiology and medical management of infection by these viruses, to identify knowledge gaps and to propose recommendations for direct future investigations and rectification measures. Here, we present the first report dedicated to diagnostic aspects of CHIKV, ONNV and MAYV. Regarding diagnosis of the disease at the acute phase, molecular assays previously described for the three viruses require further evaluation, standardized protocols and the availability of international standards representing the genetic diversity of the viruses. Detection of specific IgM would benefit from further investigations to clarify the extent of cross-reactivity among the three viruses, the sensitivity of the assays, and the possible interfering role of cryoglobulinaemia. Implementation of reference panels and external quality assessments for both molecular and serological assays is necessary. Regarding sero-epidemiological studies, there is no reported high-throughput assay that can distinguish among these different viruses in areas of potential co-circulation. New specific tools and/or improved standardized protocols are needed to enable large-scale epidemiological studies of public health relevance to be performed. Considering the high risk of future CHIKV, MAYV and ONNV outbreaks, the Working Group recommends that a major investigation should be initiated to fill the existing diagnostic gaps. ispartof: ANTIVIRAL RESEARCH vol:166 pages:66-81 ispartof: location:Netherlands status: published

Background Japanese encephalitis virus (JEV) is a leading cause of central nervous system (CNS) infections in Asia and results in significant morbidity and mortality. JEV RNA is rarely detected in serum or cerebrospinal fluid (CSF), and diagnosis of JEV infection is usually based on serological tests that are frequently difficult to interpret. Unlike serum or CSF, urine is relatively easy to obtain, but, to date, there has been minimal work on the feasibility of testing urine for JEV RNA. Methods We investigated the use of lysis buffer and a Microsep device to optimize urine storage for detection of JEV RNA by reverse transcription real-time polymerase chain reaction (RT-qPCR). The best of the studied methods was then evaluated in consecutive patients admitted to the hospital with suspected CNS infections in Laos. Results We demonstrated degradation of JEV RNA in urine after even short storage periods at 4°C or –80°C. Although there was no advantage in using a Microsep concentration device alone, immediate addition of lysis buffer to fresh urine improved the detection of JEV RNA at the limit of detection. Conclusions In 2 studies of 41 patients with acute encephalitis syndrome, 11 (27%) were positive for JEV IgM in CSF and/or serum, and 2 (4.9%) were JEV RT-qPCR positive from throat swabs. JEV RNA was not detected in any of these patients’ urine samples. However, lysis buffer was only used during a prospective study, that is, for only 17/41 (41%) patient urine samples. Our findings suggest a need for larger studies testing urine for JEV RNA, with urine collected at different times from symptom onset, and using lysis buffer, which stabilizes RNA, for storage.

SUMMARYWe explored age-dependent patterns in haemagglutination inhibition (HI) titre to seasonal [1956 A(H1N1), 1977 A(H1N1), 2007 A(H1N1)] and pandemic [A(H1N1)pdm09] influenza strains using serological data collected from an adult French influenza cohort. Subjects were recruited by their general practitioners from 2008 to 2009 and followed until 2010. We explored age-related differences between strain-specific HI titres using 1053 serological samples collected over the study period from 398 unvaccinated subjects. HI titres against the tested seasonal and pandemic strains were determined using the HI technique. Geometric mean titres (GMTs) were estimated using regression models for interval-censored data. Generalized additive mixed models were fit to log-transformed HI estimates to study the relationship between HI titre and age (age at inclusion and/or age at initial strain circulation). GMT against one strain was consistently highest in the birth cohort exposed to that strain during childhood, with peak titres observed in subjects aged 7–8 years at the time of initial strain circulation. Our results complete previous findings on influenza A(H3N2) strains and identify a strain-dependent relationship between HI titre and age at initial strain circulation.

Introduction L’implantation de l’Aedes albopictus, vecteur des virus de la dengue, du chikungunya et du zika, a rapidement progresse en France metropolitaine exposant de plus en plus de personnes au risque de transmission autochtone de ces arbovirus. Une surveillance renforcee est active depuis 2006 en France ou le vecteur est implante. La notification de cas entraine des investigations epidemiologiques et des mesures de lutte anti-vectorielle (LAV) visant a prevenir l’apparition de cas autochtones. Materiels et methodes Nous avons decrit les transmissions autochtones de ces arboviroses survenues en France metropolitaine entre 2006 et 2019, a partir des publications et documents d’investigation produits. Resultats Onze episodes de dengue (23 cas), trois de chikungunya (31 cas), et un de zika (3 cas) ont ete recenses, tous dans les territoires et pendant les periodes ou la densite vectorielle etait la plus importante. Les zones de circulation virale etaient limitees (rayon inferieur a 300 metres) et composaient essentiellement d’habitat individuel pavillonnaire. Les serotypes 1 et 2 pour la dengue, le lignage East Central South Africa pour le chikungunya, et un lignage asiatique pour le zika, etaient a l’origine des transmissions autochtones. Les mesures de lutte anti-vectorielle (LAV) ont ete efficaces : un seul des 57 cas autochtones est apparu apres leur mise en place. La survenue de neuf episodes etait due a un defaut d’identification du cas primaire importe, et pour six a une absence, ou a une insuffisance, des actions de LAV autour du cas primaire importe. Conclusion La transmission d’arbovirus en France metropolitaine est frequente et illustre le risque en Europe. Le dispositif de surveillance epidemiologique et les investigations menees autour des cas autochtones ont montre leur efficacite. Neanmoins, l’experience acquise et les causes d’emergences font ressortir des besoins d’evolution de cette surveillance et la sensibilisation des professionnels de sante doit etre renforcee.

Background Aedes albopictus, vector of dengue and chikungunya viruses, is implanted in mainland France, exposing to the risk of autochthonous transmission. Since 2006, epidemiological and entomological surveillance activities aim to prevent or limit the occurrence of autochthonous cases. We aimed to describe episodes of transmission and control measures implemented in order to reflect on surveillance activities. Methods We reviewed all publications and documents produced on autochthonous transmission episodes in France and surveillance protocols. We reviewed surveillance activities, investigation methods and control measures implemented. Results Between 2010 and 2018, eight episodes of autochthonous dengue fever transmission and three of chikungunya were recorded in mainland France. All of them occurred in the South east of France, between July and October, when vector density was the highest. Transmission areas were limited to single domestic houses located in discontinuous urban areas. Only two episodes happened in two distinct areas. Chikungunya episodes led to 31 cases and dengue fever episodes to 23 cases. Most cases were identified by door-to-door investigations set-up in transmission areas. We isolated serotypes 1 and 2 for dengue and East Central South Africa lineage for chikungunya in autochthonous cases. Adulticide vector control measures were effective in controlling transmission. Seven episodes of transmission were due to failure in identifying primary imported cases. Four episodes occurred because of the absence or the lack of vector controls measures around primary imported cases. Conclusions Surveillance activities, and autochthonous cases investigations, were effective in limiting the extent of transmission, but were highly demanding for surveillance actors. Identified causes of transmission highlight the need of regular awareness campaigns targeting physicians and biologists. Key messages Effectiveness of the surveillance system of dengue, chikungunya and zika viruses, and autochthonous cases investigations. Needs of awareness and training courses targeting health professionals to the risk represented by these viruses.

The European Virus Archive (EVA) was created in 2008 with funding from the FP7-EU Infrastructure Programme, in response to the need for a coordinated and readily accessible collection of viruses that could be made available to academia, public health organisations and industry. Within three years, it developed from a consortium of nine European laboratories to encompass associated partners in Africa, Russia, China, Turkey, Germany and Italy. In 2014, the H2020 Research and Innovation Framework Programme (INFRAS projects) provided support for the transformation of the EVA from a European to a global organization (EVAg). The EVAg now operates as a non-profit consortium, with 26 partners and 20 associated partners from 21 EU and non-EU countries. In this paper, we outline the structure, management and goals of the EVAg, to bring to the attention of researchers the wealth of products it can provide and to illustrate how end-users can gain access to these resources. Organisations or individuals who would like to be considered as contributors are invited to contact the EVAg coordinator, Jean-Louis Romette, at jean-louis.romette@univmed.fr., Highlights • The EVAg was created as an international organization aiming to provide a gold standard resource to the scientific community. • The EVAg operates as a non-profit consortium of 26 partners and 20 associated partners from EU and non-EU countries. • Members and associated members retain ownership of the viruses that they disseminate via the EVAg infrastructure. • The EVAg approach to quality management is directed by the project's own quality standard, based upon OECD guidelines. • The ultimate objective is to make the EVAg a permanent archive that can provide access to viruses and reagents globally.

Leishmaniasis is considered a rural disease in Europe. However, circumstantial evidence has indicated urban transmission of leishmaniasis and phleboviruses in the urban area of Marseille, France. To investigate this urban transmission, sandflies were trapped in 33 locations in the urban area (horse farms, public gardens and a residential area). Sandflies were always captured: 87.8% were Phlebotomus perniciosus, a vector of Leishmania infantum and Toscana and Massilia viruses. RT-PCR and cell culture inoculation identified the Massilia virus in 2/99 pools of sandflies, and PCR identified Leishmania in 5/99. No dual infection was observed, but both pathogens were detected in samples from the same trapping site.

Dengue fever represents a major public health problem. Both viral and host immune factors are involved in severe infections. Humans and mosquito-vectors are infected with diverse viral populations that may play a role in viral adaptation and disease pathogenesis. Our objective was to analyse the intra-host genetic variability of dengue virus type 1 (DENV-1) in the venous and capillary blood and its relationships with the clinical presentation of dengue fever. Early serum samples were collected in 2009 from ten DENV-1-infected patients hospitalized in Santa Cruz de la Sierra, Bolivia. Partial viral envelope sequences were analysed at the inter-host and intra-host level. For each patient, an average of 56 clone sequences was analysed both in the venous sector and the capillary sector (from right and left hands). The ten consensus sequences were highly similar. The intra-host DENV-1 genetic variability was significantly lower in the venous sector than in the capillary sector, and in patients with haemorrhagic symptoms than in those without haemorrhagic symptoms, particularly in capillary samples. No relation was found with sex, age, dengue IgG-serological status, day of serum sampling, or viral load. Significant relationships were found between the clinical presentation of dengue fever and the variability of viral populations within hosts, particularly in capillary samples. The observed variability of envelope sequences at the early phase of dengue infection was not critically influenced by the previous dengue serological status of patients. An important part of viral microevolution may occur in the capillary sector and influence the mechanisms of severe forms.

Toscana virus (TOSV) is a neglected sandfly-borne pathogen in Mediterranean countries. Although discovered four decades ago, articles that describe the clinical aspects are scarce and consist mostly of case reports, with few series of cases. We studied retrospectively symptomatic TOSV infections in patients hospitalized in Marseille (France) from 2004 to 2011. Seventeen patients were classified as probable or confirmed cases. Fourteen cases (82%) occurred between June and September, and 3 cases in March, April and November. Two cases were potentially imported from Croatia and Tuscany. All patients presented with fever and neurological signs were observed such as aseptic meningitis (n = 6), muscular symptoms (n = 3), or encephalitis (n = 4). The outcome was always favorable. At the acute stage, anti TOSV IgM were observed in 14/17 patients, neutralization tests were positive for 3/8 patients, and RT-PCR confirmed TOSV infections in 5/8 CSF specimens.

International audience; Objectives: Cytomegalovirus (CMV) reactivation in intensive care unit patients may increase mortality and favour bacterial pneumonia. We developed a murine model to compare the severity of staphylococcal pneumonia after CMV reactivation and in CMV-negative mice. Methods: Balb/c mice were primo-infected with murine cytomegalovirus (MCMV n = 90) or received saline (control n = 90). After latency, all mice underwent caecal ligation and puncture to trigger MCMV reactivation in MCMV primary-infected mice. Surviving animals received an intra-nasal inoculation with methicillin-susceptible Staphylococcus aureus (MSSA) to induce pneumonia. Mortality, lung bacterial count, histology and interferon-alpha and gamma serum levels were compared in MCMV reactivated and control mice 2, 5 and 15 days after pneumonia. Results: AfterMSSA pneumonia, MCMV mice showed a trend towards a higher mortality (9.4% versus 0%; p 0.09) and a higher weight loss (2.2 (0.6-4.1 g) versus 0.7 (-0.3 to 1.3 g); p 0.005). The lung bacterial countwas higher in MCMV mice 2 days (5 x 10(3) (10(3) to 3 x 10(5)) versus 10(2) (0 to 4 x 10(2)) CFU/lung; p 0.007) and 5 days (2.5 x 10(4) (1.6 x 10(4) to 6.5 x 10(5)) versus 15 (10-40) CFU/lung; p 0.005) after MSSA pneumonia. 8/40 (20%) MCMV mice developed lung abscesses compared to 0% in control (p 0.011). Interferon-alpha serum levels 2 days after staphylococcal pneumonia were higher in MCMV mice. Conclusions: MCMV reactivation decreased lung bacterial clearance and favoured the development of staphylococcal abscessing pneumonia. CMV reactivation may be responsible for a higher susceptibility to bacterial sepsis. (C) 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Highlights ► EVA is a globally available virus collection serving academia, public health and industry. ► EVA is a unique, networked, quality-controlled non-profit virus archive that benefits science. ► EVA provides wide-ranging access to virus collections held in laboratories worldwide. ► Laboratories in developing countries contribute to the pool of quality-controlled reagents., The European Virus Archive (EVA) was conceived as a direct response to the need for a coordinated and readily accessible collection of viruses that could be made available to academia, public health organisations and industry, initially within Europe, but ultimately throughout the world. Although scientists worldwide have accumulated virus collections since the early twentieth century, the quality of the collections and the viruses collected may vary according to the personal interests and agenda of the scientists. Moreover, when laboratories are re-organised or closed, collections are no longer maintained and gradually cease to exist. The tragedy of 9/11 and other disruptive activities have also meant that some previously available biological reagents are no longer openly exchanged between countries. In 2008, funding under the FP7–EU infrastructure programme enabled the initiation of the EVA. Within three years, it has developed from a consortium of nine European laboratories to encompass associated partners in Africa, Russia, China, Turkey, Germany and Italy. There is every reason to believe that EVA will continue to expand and ultimately exist as a globally networked, quality-controlled non-profit archive for the benefit of science. Organizations or individuals who would like to be considered as contributors are invited to contact the EVA coordinator, Jean–Louis Romette, at jean-louis.romette@univmed.fr.

Many viruses are known to cause influenza‐like illness (ILI); however, in nearly 50% of patients, the etiologic agent remains unknown. The distribution of viruses in patients with ILI was investigated during the 2009 A/H1N1 influenza pandemic (A/H1N1p). From June 2009 to January 2010, 660 patients with suspected influenza were questioned and examined, and nasal swabs were collected. All patient samples were tested for influenza virus, and 286 negative nasal swabs were tested further for 18 other respiratory viruses using real‐time RT‐PCR. Two waves of ILI were observed in the epidemic curve (weeks 35–42 and 42–49). At least eight viruses co‐circulated during this period: human rhinovirus (HRV) (58), parainfluenza 1–4 viruses (PIV) (9), human Coronavirus (hCoV) OC43 (9), enterovirus (5), adenovirus (AdV) (4), and human metapneumovirus (hMPV) (2); however, 204 samples remained negative for all viruses tested. ILI symptoms, according to the Centers for Disease Control and Prevention criteria for ILI definition, were reported in 75% of cases. These patients had positive swabs for A/H1N1p, HRV, hCoV‐OC43, PIV, AdV, and hMPV without significant difference with non‐ILI patients. This study found that many respiratory viruses circulated during this period and that the A/H1N1p did not impact on the kinetics of other respiratory viruses. The proportion of non‐documented cases remains high. ILI could not distinguish A/H1N1p infection from that due to other respiratory viruses. However, in multivariate anlaysis, cough, chills, hyperemia, and dyspnea were associated significantly with influenza virus versus other respiratory viruses. J. Med. Virol. 84: 1071–1079, 2012. © 2012 Wiley Periodicals, Inc.

Enterovirus-positive samples diagnosed in Marseille (January 2009 to September 2011) were screened for EV71 by real-time RT-PCR. EV71 was detected in three children below the age of 2 years with no history of overseas travel; two of these cases were associated with severe clinical presentation. Viruses demonstrated genetic similarity to other European genogroup C2 strains. Strain MRS/09/3663 complete sequencing revealed 97.6% identity across the entire genome with a 2008 Singapore isolate, without signs of possible recombination events. To our knowledge, this is the first detection of EV71 infection in Marseille, France, that confirms the current circulation of EV71 in France.

Enteroviruses (EVs) constitute the most common cause of aseptic meningitis in both children and adults. Molecular techniques have now been recognized as the reference standard for the diagnosis of EV infections, and the rapidity of the molecular diagnosis of EV meningitis has been shown to be a determining factor in the management of patients. The rapid documentation of EV RNA in cerebrospinal fluid (CSF) is key to adapting patient management and the therapeutic regimen. To shorten the time needed for virological documentation, we implemented EV RNA detection in two point-of-care (POC) laboratories. Here, we present the results of the POC detection of EV RNA with the Xpert EV kit on the GeneXpert integrated system, and a comparison with the real-time RT-PCR (rtRT-PCR) assay routinely used in the core virology laboratory. From January to September 2009, a total of 310 CSF samples were tested. The rtRT-PCR gave 81 positive, 225 negative and four ‘indeterminate’ results. POC results were concordant in 81.6% (253/310). Most of the discrepancies consisted of ‘indeterminate’ results at the POC level (16%). Calculated performances (excluding the indeterminate results) of the Xpert EV kit on the GeneXpert system in POC settings were 100%, 98.9%, 97.6% and 100% for Sensibility, Specificity, positive predictive value and negative predictive value, respectively. Taken together, these results indicate that the implementation of POC detection of EV RNA can provide robust results in

Enteroviruses are frequent aetiological agents of central nervous system infections in humans. In 2000 and 2005, two large outbreaks of Echovirus 30 (a member of species human enterovirus B) were observed in the University Hospitals of Marseilles (France). Between the two epidemics, the diagnostic protocols for enterovirus infection were modified, moving from viral cultures and classic RT-PCR in 2000 to real-time RT-PCR in 2005. We compared some viral and epidemiological characteristics of the 2000 and 2005 outbreaks with special attention to diagnostic procedures and to the subsequent clinical management of patients. Despite similar virological and epidemiological characteristics during both outbreaks, our results show that real-time RT-PCR techniques used in 2005 noticeably shortened the period of time necessary to deliver diagnostic results and suggest that this was associated with a decrease in the duration of hospitalization for -positive cases. In conclusion, this study suggests that the improvement of enterovirus diagnosis had a major financial impact on the management of the 2005 epidemic in Marseilles and may constitute an interesting example of how new diagnostic methods in microbiology can be self-financed through improvement in patient management.

BACKGROUND: In the wake of the recent outbreak of Ebola virus disease (EVD) in several African countries, the World Health Organization prioritized the evaluation of treatment with convalescent plasma derived from patients who have recovered from the disease. We evaluated the safety and efficacy of convalescent plasma for the treatment of EVD in Guinea. METHODS: In this nonrandomized, comparative study, 99 patients of various ages (including pregnant women) with confirmed EVD received two consecutive transfusions of 200 to 250 ml of ABO-compatible convalescent plasma, with each unit of plasma obtained from a separate convalescent donor. The transfusions were initiated on the day of diagnosis or up to 2 days later. The level of neutralizing antibodies against Ebola virus in the plasma was unknown at the time of administration. The control group was 418 patients who had been treated at the same center during the previous 5 months. The primary outcome was the risk of death during the period from 3 to 16 days after diagnosis with adjustments for age and the baseline cycle-threshold value on polymerase-chain-reaction assay; patients who had died before day 3 were excluded. The clinically important difference was defined as an absolute reduction in mortality of 20 percentage points in the convalescent-plasma group as compared with the control group. RESULTS: A total of 84 patients who were treated with plasma were included in the primary analysis. At baseline, the convalescent-plasma group had slightly higher cycle-threshold values and a shorter duration of symptoms than did the control group, along with a higher frequency of eye redness and difficulty in swallowing. From day 3 to day 16 after diagnosis, the risk of death was 31% in the convalescent-plasma group and 38% in the control group (risk difference, -7 percentage points; 95% confidence interval [CI], -18 to 4). The difference was reduced after adjustment for age and cycle-threshold value (adjusted risk difference, -3 percentage points; 95% CI, -13 to 8). No serious adverse reactions associated with the use of convalescent plasma were observed. CONCLUSIONS: The transfusion of up to 500 ml of convalescent plasma with unknown levels of neutralizing antibodies in 84 patients with confirmed EVD was not associated with a significant improvement in survival. (Funded by the European Union's Horizon 2020 Research and Innovation Program and others; ClinicalTrials.gov number, NCT02342171.). ispartof: New England Journal of Medicine vol:374 issue:374 pages:33-42 ispartof: location:United States status: published

Little is known about the genetic relationships between European and other Old-World strains of West Nile virus (WNV) and persistence of WNV North of Mediterranean. We characterized the complete genomes of three WNV strains from France (horse-2000), Tunisia (human-1997) and Kenya (mosquito-1998), and the envelope, NS3 and NS5 genes of the Koutango virus. Phylogenetic analyses including all available full-length sequences showed that: (1) Koutango virus is a distant variant of WNV; (2) the three characterized strains belong to lineage 1, clade 1a; (3) the Tunisian strain roots the lineage of viruses introduced in North America. We established that currently available partial envelope sequences do not generate reliable phylogenies. Accordingly, establishing a large WNV sequence database is pivotal for the understanding of spatial and temporal epidemiology of this virus. For rapid completion of that purpose, colinearized E-NS3-NS5 gene sequences were shown to constitute a valuable surrogate for complete sequences.

International audience; Human parvovirus B19 occurs worldwide and causes mild or asymptomatic disease in the form of cyclic local epidemics usually occurring in late winter and early summer. In 2012, a dramatic increase in cases was observed in the Public hospitals system of Marseille, with a total of 53 cases reported. Here, we describe the characteristics of this outbreak and compare it with the local epidemiology of B19V infections observed during the 2002–2011 period.

Recombination events are known to occur in non-segmented RNA viruses like polioviruses or alphaviruses. Analysis of the subgenomic sequences of dengue virus type 1 (DENV-1) structural genes has recently allowed the identification of possible recombination breakpoints. Because DENV is a major human pathogen, this discovery might have important implications for virus pathogenicity, vaccine safety and efficiency, or diagnosis and, therefore, requires clear confirmation. We report the complete sequence determination of one Asian and two African strains of DENV-1 isolated from human patients. Rigorous sequence analysis provided strong evidence for the occurrence of intragenomic recombination events between DENV-1 strains belonging to different lineages. Singapore S275/90 strain appears to be the evolutionary product of a recombination event between viruses belonging to two distinct lineages: one lineage includes an African strain isolated in Abidjan (Ivory Coast) and the other includes isolates from Djibouti and Cambodia. The ‘Recombination Detection Program’, bootscanning and analysis of diversity plots provided congruent results concerning the existence of a two-switch recombination event and the localization of recombination breakpoints. Thus, the 5′ and 3′ genomic ends of the Singapore S275/90 strain were inherited from a Djibouti/Cambodia lineage ancestor and an internal fragment located in the envelope/NS1 region originated from an Abidjan lineage ancestor.

Following the outbreak of autochthonous chikungunya fever in humans in northern Italy, first reported 3 years ago (1) we have now witnessed two independent cases of autochthonous transmission of dengue fever and two cases of chikungunya fever in south-eastern France during September 2010. This worrying trend has raised serious concern among the health authorities, as Aedes albopictus, the Asian 'tiger mosquito', is the most likely transmission vector of both viruses, and this mosquito species is known to be spreading widely throughout many regions of southern Europe. The two cases of dengue fever occurred in patients (a 64-year-old male and an 18-year- old male) living in Nice in the same neighbourhood and know- ing each other. The two cases of chikungunya fever occurred in 12-year-old female patients also living in the vicinity of each other in Frejus, and attending the same high school. Both pre- sented with high fever, headache, lombalgia and arthralgia. These two patients lived in the same neighbourhood as the unique laboratory-documented imported case of the county, affecting a 7-year-old female patient returning from Asia. All four cases resulted in mild, self-resolving infections. The virological identification of these four cases of arbo- viral disease, with no travel history, and within the recorded area of dissemination of A. albopictus, along the 180-km region of the Mediterranean coast from Menton to Toulon (2): (i) demonstrates the first cases of autochthonous trans- mission of both viruses (dengue and chikungunya) in France; (ii) implies that A. albopictus, which is resident in this region, is the most likely competent vector for dengue virus (http:// www.sante-sports.gouv.fr/apparition-des-premiers-cas-auto chtones-de-dengue-en-france-metropolitaine.html); and (iii) raises important issues to be resolved in time for the next 'mosquito season', namely the adaptation of surveillance systems and the implementation of countermeasures to limit dispersal of the viruses and to limit the number of human cases of dengue or chikungunya fever. How alarmed should we be in Europe? Imported cases of dengue and chikungunya fever have long been reported in infected viraemic travellers (3) returning from tropical regions where the viruses are endemic or transiently epi- demic. Indeed, dengue virus ranks second only to the malar- ial parasite as an agent of systemic febrile illness in travellers to the tropics who are returning to Europe (4). However, during the past 5-10 years, the perceived risk of infection in Europe, particularly with these two arboviruses, has increased. This is because a competent mosquito vector was not previously present at a sufficient density in Europe to be able to initiate and generate secondary human cases of chikungunya or dengue fever among human populations. With the establishment and amplification of A. albopictus in Europe, and these cases of dengue and chikungunya fever in France, the perceived risk of epidemics caused by these viruses or other emerging arboviruses has increased dramati- cally. Consequently, in an attempt to prevent and monitor the appearance of autochthonous cases, the French authori- ties have elaborated a surveillance programme targeting both viruses in returning travellers during the summer period of vector activity (http://www.circulaires.gouv.fr/pdf/2010/05/cir_

In this study, the basis for the classification of virus isolates grouped within the genus Coltivirus, family Reoviridae, is discussed. Sequences of dsRNA segments from American (segments 9-12), European (segment 12) and Asian (segments 7-12) isolates were characterized and polythetic criteria were defined for their taxonomic classification. These criteria (including sequence analysis) permitted the different species to be distinguished and classified into two groups. In both groups, subgroups were defined according to the degree of homology between the genomic sequences. American and European isolates are classified within group A, which includes subgroups A1 (Colorado tick fever virus species) and A2 (Eyach virus species). Asian isolates are classified in group B, which includes subgroups B1 (JKT-7075 virus species) and B2 (JKT-6423 virus species). The proteins encoded by the sequenced genomic segments were analysed. This allowed the identification of dsRNA binding domains in the proteins encoded by segment 8 of subgroup B1 isolates and segment 12 of subgroup B2 isolates. A conserved pattern of amino acids in segment 7 of group B isolates matched sequences found in the catalytic domains of protein kinases.

The phylogenetic status of recently described isolates of hepatitis C virus (HCV) from Vietnam, Thailand and Indonesia (previously classified as types 7, 8, 9, 10 and 11) was re-analysed by the neighbour-joining method instead of the unweighted pair-group method with arithmetic mean (UPGMA) that was first used by the discoverers of these strains. The analysis of complete amino acid sequences and of nucleotide sequences of the envelope 1 (672 nt) and nonstructural 5B (1092 nt) genomic regions permitted the re-assignment of the type 7, 8, 9 and 1 1 isolates to type 6, and that of type 10 strains to type 3. Finally, this study made possible the classification of the previously described HCV strains (including these South-East Asian isolates) in six major types and at least 30 subtypes. It confirms that analysis of the E 1 and NS5B genomic regions using the neighbour-joining method is a reliable tool for the assignment of most new isolates.

International audience; Controversies over the effectiveness and safety of the pandemic influenza A(H1N1)pdm09 vaccine in 2009/10 may have altered the influenza vaccination coverage in France after the pandemic season. The purpose of this study was to determine whether the pandemic affected seasonal influenza vaccination behaviours in the general population by analysing vaccination behaviours from 2006/07 to 2011/12 among the 1,451 subjects of the Cohort for Pandemic Influenza (CoPanFlu) France.We found that vaccination behaviours in 2010/11 and 2011/12 significantly differed from behaviours before the pandemic, with the notable exception of the targeted risk groups for seasonal influenza-related complications. Among the population with no risk factors,the post-pandemic influenza vaccine coverage decreased, with people aged 15 to 24 years and 45to 64 years being most likely to abandon vaccination.Therefore, this study documents a moderate negative effect of the 2009/10 pandemic episode on vaccination behaviours in the French metropolitan population that was apparent also in the following two seasons.Moreover, it does not exclude that the general trend of reduced vaccination has also affected certain targeted groups at high risk for complications.

Fully automated easy-to-use integrated molecular systems have demonstrated their capability for rapid documentation of respiratory specimens, especially in point-of-care (POC) laboratories. In our previous study ([1][1]), the Xpert Flu test exhibited respective sensitivity (Se) and specificity (Sp)

As a partner of the European Virus Archive (EVA) FP7 infrastructure, our research group is maintaining and developing a large virus collection. To meet the standards of the quality management system adopted by all European Virus Archive partners, the detection and eradication of mycoplasma in cell culture supernatants (stored at -80 degrees C or freeze-dried) has to be improved. Although the methods for mycoplasma elimination from infected cell lines were largely described, the decontamination procedures of precious cell culture supernatants was poorly documented. In this study, a large panel of mycoplasma-contaminated virus stocks (enveloped and non enveloped, RNA and DNA viruses) was tested successfully for mycoplasma removal using two simple optimized methods. These easy-to-perform protocols, using respectively Plasmocin (TM) (InvivoGen, Cayla, France) and chloroform, were shown to remove mycoplasma completely from cell supernatant without incidence in viral infectivity.

The swine-origin H1N1 influenza A virus (pH1N1(2009)) started to circulate worldwide in 2009, and cases were notified in a number of sub-Saharan African countries. However, no epidemiological data allowing estimation of the epidemic burden were available in this region, preventing comprehensive comparisons with other parts of the world. The CoPanFlu-Mali programme studied a cohort of 202 individuals living in the rural commune of Dioro (southern central Mali). Pre-pandemic and post-pandemic paired sera (sampled in 2006 and April 2010, respectively) were tested by the haemagglutination inhibition (HI) method. Different estimates of pH1N1(2009) infection during the 2009 first epidemic wave were used (increased prevalence of HI titre of ≥ 1/40 or ≥ 1/80, seroconversions) and provided convergent attack rate values (12.4-14.9%), the highest values being observed in the 0-19-year age group (16.0-18.4%). In all age groups, pre-pandemic HI titres of ≥1/40 were associated with complete absence of seroconversion; and geometric mean titres were 20 in others. Important variations in seroconversion rate existed among the different villages investigated. Despite limitations resulting from the size and composition of the sample analysed, this study provides strong evidence that the impact of the pH1N1(2009) first wave was more important than previously believed, and that the determinants of the epidemic spread in sub-Saharan populations were quite different from those observed in developed countries.

In May 2012, a Coxsackievirus A24 haemorrhagic conjunctivitis was diagnosed in Marseille, France, in a traveller returning from the Comoros Islands. This case allowed identification of the cause of an ongoing outbreak of haemorrhagic conjunctivitis in Indian Ocean Islands, illustrating that returning travellers may serve as sentinels for infectious diseases outbreaks in tropical areas where laboratory investigation is limited.

We looked for evidence of antibodies to the 2009 influenza A/H1N1 pandemic virus in panels of sera from individuals living in metropolitan France, obtained either before, during or after the epidemic, using standard haemagglutination inhibition and microneutralization tests. The difference between seroprevalence values measured in post- and pre-epidemic panels was used as an estimate of seroconversion rate in different age groups (23.4% (0–24 years, age-group 0); 16.5% (25–34); 7.9% (35–44); 7.2% (45–54); 1.6% (55–64); and 3.1% (

In recent years, there have been increasing numbers of alerts for possible imported human cases infected with highly pathogenic viruses (HiPaVs). Striking examples include severe respiratory pathogens (e.g. the SARS or MERS coronavirus) [1] and haemorrhagic fever viruses (e.g. Ebola virus) [2]. Many countries have already implemented disease control measures that include the establishment of specialized facilities such as negative-air-pressure isolation rooms for the containment of patients, and reference diagnostic laboratories in which potentially infectious samples can be safely analysed to provide diagnosis and virus characterization. Additionally, protocols have been established for the transportation, reception and management of patients, and the corresponding shipment of biological samples to specialized reference laboratories. Clearly, the implementation and coordination of these health control measures is complex and expensive. However, importantly, their efficacy in detecting HiPaV patients and providing them with the best medical management remains unproven.

The 2C protein, which is an essential ATPase and one of the most conserved proteins across the Picornaviridae family, is an emerging antiviral target for which structural and functional characterization remain elusive. Based on a distant relationship to helicases of small DNA viruses, piconavirus 2C proteins have been predicted to unwind double-stranded RNAs. Here, a terminally extended variant of the 2C protein from echovirus 30 has been studied by means of enzymatic activity assays, transmission electron microscopy, atomic force microscopy and dynamic light scattering. The transmission electron-microscopy technique showed the existence of ring-shaped particles with similar to 12 nm external diameter. Image analysis revealed that these particles were hexameric and resembled those formed by superfamily 3 DNA virus helicases.

The alphaviruses were amongst the first arboviruses to be isolated, characterized and assigned a taxonomic status. They are globally very widespread, infecting a large variety of terrestrial animals, insects and even fish, and circulate both in the sylvatic and urban/peri-urban environment, causing considerable human morbidity and mortality. Nevertheless, despite their obvious importance as pathogens, there are currently no effective antiviral drugs with which to treat humans or animals infected by any of these viruses. The EU-supported project VIZIER (Comparative Structural Genomics of Viral Enzymes Involved in Replication, FP6 Project: 2004-511960) was instigated with an ultimate view of contributing to the development of antiviral therapies for RNA viruses, including the alphaviruses [Coutard, B., Gorbalenya, A.E., Snijder, E.J., Leontovich, A.M., Poupon, A., De Lamballerie, X., Charrel, R., Gould, E.A., Gunther, S., Norder, H., Klempa, B., Bourhy, H., Rohayemj, J., L'hermite, E., Nordlund, P., Stuart, D.I., Owens, R.J., Grimes, J.M., Tuckerm, PA., Bolognesi, M., Mattevi, A., Coll, M., Jones, TA., Aqvist, J., Unger, T., Hilgenfeld, R., Bricogne, G., Neyts, J., La Colla, P., Puerstinger, G., Gonzalez, J.P., Leroy, E., Cambillau, C., Romette, J.L., Canard, B., 2008. The VIZIER project: preparedness against pathogenic RNA viruses. Antiviral Res. 78, 37-46]. This review highlights some of the major features of alphaviruses that have been investigated during recent years. After describing their classification, epidemiology and evolutionary history and the expanding geographic distribution of Chikungunya virus, we review progress in understanding the structure and function of alphavirus replicative enzymes achieved under the VIZIER programme and the development of new disease control strategies. (C) 2009 Elsevier B.V. All rights reserved.

Some mammalian rhabdoviruses may infect humans, and also infect invertebrates, dogs, and bats, which may act as vectors transmitting viruses among different host species. The VIZIER programme, an EU-funded FP6 program, has characterized viruses that belong to the Vesiculovirus, Ephemerovirus and Lyssavirus genera of the Rhabdoviridae family to perform ground-breaking research on the identification of potential new drug targets against these RNA viruses through comprehensive structural characterization of the replicative machinery. The contribution of VIZIER programme was of several orders. First, it contributed substantially to research aimed at understanding the origin, evolution and diversity of rhabdoviruses. This diversity was then used to obtain further structural information on the proteins involved in replication. Two strategies were used to produce recombinant proteins by expression of both full length or domain constructs in either E. coil or insect cells, using the baculovirus system. In both cases, parallel cloning and expression screening at small-scale of multiple constructs based on different viruses including the addition of fusion tags, was key to the rapid generation of expression data. As a result, some progress has been made in the VIZIER programme towards dissecting the multi-functional L protein into components suitable for structural and functional studies. However, the phosphoprotein polymerase co-factor and the structural matrix protein, which play a number of roles during viral replication and drives viral assembly, have both proved much more amenable to structural biology. Applying the multi-construct/multi-virus approach central to protein production processes in VIZIER has yielded new structural information which may ultimately be exploitable in the derivation of novel ways of intervening in viral replication. (C) 2010 Elsevier B.V. All rights reserved.

The new influenza strain detected in humans in April 2009 has caused the first influenza pandemic of the 21st century. A cross‐reactive antibody response, in which antibodies against seasonal H1N1 viruses neutralized the 2009 pandemic influenza A (H1N1) virus (2009 pH1N1), was detected among individuals aged >60 years. However, factors other than age associated with such a cross‐reactive antibody response are poorly documented. Our objective was to examine factors potentially associated with elevated pre‐exposure viro‐neutralization and hemagglutination‐inhibition antibody titers against the 2009 pH1N1. We also studied factors associated with antibody titers against the 2007 seasonal H1N1 virus. One hundred subjects participating in an influenza cohort were selected. Sera collected in 2008 were analysed using hemagglutination inhibition and viro‐neutralization assays for the 2009 pH1N1 virus and the 2007 seasonal H1N1 virus. Viro‐neutralization results were explored using a linear mixed‐effect model and hemagglutination‐inhibition results using linear‐regression models for interval‐censored data. Elevated antibody titers against 2009 pH1N1 were associated with seasonal 2007 H1N1 infection (viro‐neutralization, p 0.006; hemagglutination‐inhibition, p 0.018). Elevated antibody titers were also associated with age in the viro‐neutralization assay (p

Clin Microbiol Infect 2010; 16: 322–325 Abstract We report here the results of a 7‐month survey of the influenza A/H1N1 pandemic in the Virology laboratory of the public hospitals of Marseille (April–November 2009). In total, 8 587 samples were analysed during this period, of which 1 974 (23%) were positive for the novel influenza variant. The analysis of results obtained using rapid influenza diagnostic tests (RIDTs) revealed a global sensitivity of 49.4% (vs. molecular qRT‐PCR detection), strongly correlated with age groups (varying from 30% to 58% for patients >40 age and 40 years old and

To date, the International Committee for Taxonomy of Viruses recognizes that the family Arenaviridae contains a unique genus Arenavirus that includes 22 viral species. There are nine additional arenaviruses that either have been discovered recently, or which taxonomic status remains pending. Arenaviruses have been classified according to their antigenic properties into two groups, the Lassa-Lymphocytic choriomeningitis (LCM) serocomplex and the Tacaribe serocomplex which has been further divided into four evolutionary lineages. Each arenavirus is more or less tightly associated with a mammal host. The distribution of the host dictates the distribution of the virus. Humans may become infected by arenaviruses through direct contact with infected rodents, including bites, or through inhalation of infectious rodent excreta and secreta. Lassa, Junin, Machupo, Guanarito, and Sabia viruses are known to cause a severe hemorrhagic fever, in western Africa, Argentina, Bolivia, Venezuela, and Brazil, respectively. Infection by LCM virus can result in acute central nervous system disease, congenital malformations, and infection in organ transplantation recipients. Detection of arenaviruses in their animal host can be achieved by virus isolation, and has recently taken advantage of PCR-based techniques. The approach based on consensus degenerate primers has shown efficient for both detection of known arenaviruses, and discovery of new arenaviruses.

We assessed the ability of a standard disinfection procedure to eliminate hepatitis C virus (HCV) from the air-water channel of hysteroscopes. The residual HCV RNA remaining after the disinfection procedure was measured by polymerase chain reaction. When correctly applied to hysteroscopes, the standard disinfection procedure was sufficient to eliminate the risk of HCV transmission.

Coutard, B. et al., Life-threatening RNA viruses emerge regularly, and often in an unpredictable manner. Yet, the very few drugs available against known RNA viruses have sometimes required decades of research for development. Can we generate preparedness for outbreaks of the, as yet, unknown viruses? The VIZIER (VIral enZymes InvolvEd in Replication) (http://www.vizier-europe.org/) project has been set-up to develop the scientific foundations for countering this challenge to society. VIZIER studies the most conserved viral enzymes (that of the replication machinery, or replicases) that constitute attractive targets for drug-design. The aim of VIZIER is to determine as many replicase crystal structures as possible from a carefully selected list of viruses in order to comprehensively cover the diversity of the RNA virus universe, and generate critical knowledge that could be efficiently utilized to jump-start research on any emerging RNA virus. VIZIER is a multidisciplinary project involving (i) bioinformatics to define functional domains, (ii) viral genomics to increase the number of characterized viral genomes and prepare defined targets, (iii) proteomics to express, purify, and characterize targets, (iv) structural biology to solve their crystal structures, and (v) pre-lead discovery to propose active scaffolds of antiviral molecules. © 2007 Elsevier B.V. All rights reserved., This work was supported by the VIZIER integrated project (LSHG-CT-2004-511960) of the European Union 6th Framework Programme (FP6)

SUMMARYDuring the 2003 rainy season, a follow-up survey in sentinel chickens was undertaken to assess the seasonal transmission of West Nile virus (WNV) in a sahelian ecosystem: the Ferlo (Senegal). The estimated incidence rate in chickens was 14% (95% CI 7–29), with a very low level of transmission between July and September, and a transmission peak occurring between September and October. Comparing these results with the estimate obtained from a previous transversal serological study performed on horses the same year in the same area, the relevance of sentinel chickens in estimating the WNV transmission rate is highlighted. Conventionally adult mosquito populations disappear during the dry season but WN disease was shown to be endemic in the study area. The mechanisms of virus maintenance are discussed.

Toscana virus (TOSV; Bunyaviridae, Phlebovirus) is transmitted by sandflies of the genus Phlebotomus in the Mediterranean area. One strain of TOSV was isolated from a total of almost 23 000 sandflies collected in Kabylia, Algeria. The complete genome was sequenced, and phylogenetic studies indicated that it was most closely related with TOSV strain from Tunisia within lineage A, which also includes Italian, French and Turkish strains. A seroprevalence study performed on 370 sera collected from people living in the same area showed that almost 50% possessed neutralizing antibodies against TOSV, a rate much higher than that observed in Southern Europe. Sandfly species distribution in the study area suggests that the vector of TOSV in this region belongs to the subgenus Larroussius. These data support the rapid implementation of the diagnosis of TOSV in clinical microbiology laboratories to estimate the burden in patients presenting with neuroinvasive infections and febrile illness.