Search

Soybean [Glycine max (L.) Merr.], an essential staple food and oil crop worldwide, boasts abundant vegetable proteins and fats beneficial for both human and animal consumption. However, the soybean pod borer (Leguminivora glycinivorella) (SPB) stands as the most destructive soybean insect pest in northeast China and other northeastern Asian regions, leading to significant annual losses in soybean yield and economic burden. Therefore, this study aims to investigate the introduction of a previously tested codon-optimized cry1c gene, cry1c*, into the soybean genome and assess its effect on the SPB infestation by generating and characterizing stable transgenic soybeans overexpressing cry1c*. The transgenic soybean lines that constitutively overexpressed cry1c* exhibited a significant reduction in the percentage of damaged seeds, reaching as low as 5% in plants under field conditions. Additionally, feeding transgenic leaves to the larvae of S. exigua, S. litura, and M. separta resulted in inhibited larval growth, decreased larval body weight, and lower survival rates compared to larvae fed on wild-type leaves. These findings showed that the transgenic lines maintained their resistance to SPB and other lepidopteran pests, especially the transgenic line KC1. Southern blotting and genome-wide resequencing analysis revealed that T-DNA integration occurred as a single copy between loci 50,868,122 and 50,868,123 of chromosome 10 in the transgenic line KC1. Therefore, the transgenic line KC1, overexpressing high levels of cry1c* in leaves and seeds, holds strong potential for commercial use in the integrated management of SPB and other lepidopteran pests. [ABSTRACT FROM AUTHOR]

Abstract Background Crop-wild hybridization has generated great concerns since gene flow can be an avenue for transgene escape. However, a rather limited number of studies on risk assessment regarding the dispersion of transgenes from GM soybean to populations of its wild relatives have been previously conducted. Results The results of the 3-year experiment demonstrated that hybrids between GM soybeans and wild soybean had lower seed germination and higher seed productivity than GM soybean. Both of these features of hybrid (especially F2 and F3) were similar to those of wild soybean. Furthermore, the foreign protein was stably expressed in hybrid EPSPS positive plants; however, no difference was observed in agronomic measurements between hybrids that are glyphosate sensitive or resistant, homozygous or heterozygous for the transgene, indicating that the presence of the EPSPS transgene does not affect the vigor of hybrid. In contrast, hybridization between GM soybean and wild soybean may have more impact on hybrid growth and fecundity, this increase in biomass and yield confers a potential competition benefit to hybrids. Conclusions Gene flow from GM soybean to wild soybean has the potential to promote the adaptability of hybrids and may increase the possibility of dispersal of transgenes in wild soybean relatives.

Fuelled by agribusiness, transgenic soybean crops, genetically modified to withstand pesticide use, have increased in use during the last 20 years in the Southern Cone of Latin America. Plantations are understood as examples of ‘modular simplifications’ in ‘patchy Anthropocene’ landscapes (Tsing et al. 2019), where the attempt to reduce diversity may have social and ecological feral effects as diseases and toxins spread. In Uruguay, as an agro-exporter country, soybean expansionist processes correlate with an increased use of pesticides. Based on an ethnographic study (2016–2018) carried out in the main Uruguayan agricultural region, this Research Article seeks to analyse the experiences of toxicity among agricultural workers and rural inhabitants in the soybeanisation context. I propose that pesticide effects transcend biomedical diagnoses of ‘intoxication’. I also contend that the experience of toxicity can be understood as occurring along a continuum in the daily life of sufferers, which encompasses chemical and biological processes, their affects, intersectional conflicts, lay concepts of illnesses, informal self-care networks, and unequal access to health services. This ethnography demonstrates that the experience of toxic suffering embodies inequalities in environmental health in the time of the Anthropocene and is shaped by structural vulnerabilities and politics of exposure.

The commercial cultivation of herbicide-resistant (HR) transgenic soybeans (Glycine max L. Merr.) raises great concern that transgenes may introgress into wild soybeans (Glycine soja Sieb. et Zucc.) via pollen-mediated gene flow, which could increase the ecological risks of transgenic weed populations and threaten the genetic diversity of wild soybean. To assess the fitness of hybrids derived from transgenic HR soybean and wild soybean, the F2 and F3 descendants of crosses of the HR soybean line T14R1251-70 and two wild soybeans (LNTL and JLBC, which were collected from LiaoNing TieLing and JiLin BaiCheng, respectively), were planted along with their parents in wasteland or farmland soil, with or without weed competition. The fitness of F2 and F3 was significantly increased compared to the wild soybeans under all test conditions, and they also showed a greater competitive ability against weeds. Seeds produced by F2 and F3 were superficially similar to wild soybeans in having a hard seed coat; however, closer morphological examination revealed that the hard-seededness was lower due to the seed coat structure, specifically the presence of thicker hourglass cells in seed coat layers and lower Ca content in palisade epidermis. Hybrid descendants containing the cp4-epsps HR allele were able to complete their life cycle and produce a large number of seeds in the test conditions, which suggests that they would be able to survive in the soil beyond a single growing season, germinate, and grow under suitable conditions. Our findings indicate that the hybrid descendants of HR soybean and wild soybean may pose potential ecological risks in regions of soybean cultivation where wild soybean occurs. [ABSTRACT FROM AUTHOR]

Background: Crop-wild hybridization has generated great concerns since gene flow can be an avenue for transgene escape. However, a rather limited number of studies on risk assessment regarding the dispersion of transgenes from GM soybean to populations of its wild relatives have been previously conducted. Results: The results of the 3-year experiment demonstrated that hybrids between GM soybeans and wild soybean had lower seed germination and higher seed productivity than GM soybean. Both of these features of hybrid (especially F2 and F3) were similar to those of wild soybean. Furthermore, the foreign protein was stably expressed in hybrid EPSPS positive plants; however, no difference was observed in agronomic measurements between hybrids that are glyphosate sensitive or resistant, homozygous or heterozygous for the transgene, indicating that the presence of the EPSPS transgene does not affect the vigor of hybrid. In contrast, hybridization between GM soybean and wild soybean may have more impact on hybrid growth and fecundity, this increase in biomass and yield confers a potential competition benefit to hybrids. Conclusions: Gene flow from GM soybean to wild soybean has the potential to promote the adaptability of hybrids and may increase the possibility of dispersal of transgenes in wild soybean relatives. [ABSTRACT FROM AUTHOR]

Soybean (Glycine max) is the main oilseed crop that provides vegetable oil for human nutrition. The main objective of its breeding research is to increase the total oil content. In the Kennedy pathway, Diacylglycerol acyltransferase (DGAT) is a rate-limiting enzyme that converts diacylglycerol (DAG) to triacylglycerol (TAG). Here, the AhDGAT3 gene was cloned from peanut and overexpressed in the wild-type (WT) Arabidopsis. The total fatty acid content in T3AhDGAT3 transgenic Arabidopsis seeds was 1.1 times higher on average than that of the WT. Therefore, AhDGAT3 was transferred into the WT (JACK), and four T3 transgenic soybean lines were obtained, which proved to be positive using molecular biological detection. Specific T-DNA insertion region location information was also obtained via genome re-sequencing. The results of high-performance gas chromatography showed that the contents of oleic acid (18:1) composition and total fatty acids in transgenic soybean plants were significantly higher than that of the WT. However, linoleic acid (18:2) was much lower compared to the WT. The agronomic trait survey showed that the quantitative and yield traits of AhDGAT3 transgenic soybean were better than those of the WT. These results suggest that fatty acids in transgenic soybeans, especially oleic acid and total fatty acid, are enhanced by the over-expression of AhDGAT3. [ABSTRACT FROM AUTHOR]

The field study was undertaken to examine the potential for adverse effects of transgenic soybean expressing bioactive human epidermal growth factor (with tolerance to the herbicide glufosinate, PPT) on the abundance and diversity of plant‐dwelling arthropods by comparing with those of a non‐GM parental cultivar, Gwangan soybean. Field surveys of soybean fields were carried out over two consecutive years, 2016 and 2017 at Ochang and Jeonju, Korea. The number of captured individuals associated with either of EGF and Gwangan soybean plants increased in 2017 compared with 2016 in both Ochang and Jeonju. During the survey period, the diversity and richness of the occurred insects and arachnids increased, dominance decreased, and the evenness of the insects remained static. The insects of Hymenoptera Order occurred most often comprised 25.4% of total captured insect pests. On the contrary, natural enemy from Hymenoptera Order and other insects from Diptera Order occurred more frequently (29.9% and 19.0%, respectively) in both the survey regions during the study periods. The score from PROXSCAL multidimensional scaling using combined data showed that the occurrence of insects and arachnids were separated due to their cultivation regions and years, irrespective of soybean cultivars. Consequently, the results indicated that there happened no notable change in the composition of arthropod communities in soybean agroecosystem due to GM event in soybean expressing EGF.

Soybean [Glycine max (L.) Merr.], an essential staple food and oil crop worldwide, boasts abundant vegetable proteins and fats beneficial for both human and animal consumption. However, the soybean pod borer (Leguminivora glycinivorella) (SPB) stands as the most destructive soybean insect pest in northeast China and other northeastern Asian regions, leading to significant annual losses in soybean yield and economic burden. Therefore, this study aims to investigate the introduction of a previously tested codon-optimized cry1c gene, cry1c*, into the soybean genome and assess its effect on the SPB infestation by generating and characterizing stable transgenic soybeans overexpressing cry1c*. The transgenic soybean lines that constitutively overexpressed cry1c* exhibited a significant reduction in the percentage of damaged seeds, reaching as low as 5% in plants under field conditions. Additionally, feeding transgenic leaves to the larvae of S. exigua, S. litura, and M. separta resulted in inhibited larval growth, decreased larval body weight, and lower survival rates compared to larvae fed on wild-type leaves. These findings showed that the transgenic lines maintained their resistance to SPB and other lepidopteran pests, especially the transgenic line KC1. Southern blotting and genome-wide resequencing analysis revealed that T-DNA integration occurred as a single copy between loci 50,868,122 and 50,868,123 of chromosome 10 in the transgenic line KC1. Therefore, the transgenic line KC1, overexpressing high levels of cry1c* in leaves and seeds, holds strong potential for commercial use in the integrated management of SPB and other lepidopteran pests.

Summary: The widespread application of isoproturon (IPU) can cause serious pollution to the environment and threaten ecological functions. In this study, the IPU bacterial N‐demethylase gene pdmAB was transferred and expressed in the chloroplast of soybean (Glycine max L. 'Zhonghuang13'). The transgenic soybeans exhibited significant tolerance to IPU and demethylated IPU to a less phytotoxic metabolite 3‐(4‐isopropylphenyl)‐1‐methylurea (MDIPU) in vivo. The transgenic soybeans removed 98% and 84% IPU from water and soil within 5 and 14 days, respectively, while accumulating less IPU in plant tissues compared with the wild‐type (WT). Under IPU stress, transgenic soybeans showed a higher symbiotic nitrogen fixation performance (with higher total nodule biomass and nitrogenase activity) and a more stable rhizosphere bacterial community than the WT. This study developed a transgenic (TS) soybean capable of efficiently removing IPU from its growing environment and recovering a high‐symbiotic nitrogen fixation capacity under IPU stress, and provides new insights into the interactions between rhizosphere microorganisms and TS legumes under herbicide stress. [ABSTRACT FROM AUTHOR]

Transgenic soybean (Glycine max) plants expressing mutant potyviral coat proteins that disrupt virion assembly exhibited non-strain-specific resistance against soybean mosaic virus., (© 2024 Institute of Botany, Chinese Academy of Sciences.)

The introduction of genetically modified (GM) soybean into farming systems raises great concern that transgenes from GM soybean may flow to endemic wild soybean via pollen. This may increase the weediness of transgenic soybean by increasing the fitness of hybrids under certain conditions and threaten the genetic diversity of wild soybean populations. Although pollen-mediated gene flow between GM crops and wild relatives is dependent on many factors, the sexual compatibility (SC) determined by their genetic backgrounds is the conclusive factor. The considerable genetic variation among wild soybean populations may cause compatibility differences between different wild and cultivated soybeans. Thus, an evaluation of the SC between transgenic soybean and different wild soybeans is essential for assessing the environmental consequences of cultivated soybean–wild soybean transgene flow. The podding and seed sets were assessed after artificial hybridization using transgenic glyphosate-resistant soybean as the paternal parent and 18 wild soybean populations as the maternal parents. Then, the average number of filled seeds produced in 200 flowers (AFS) was calculated for each wild soybean under natural self-pollination as well as under artificial crossing with transgenic soybean. Finally, the index of cross-SC was calculated (ICSC) as the ratio of the AFS of wild soybean artificially crossed with transgenic soybean and the AFS of naturally self-pollinated wild soybean. The results demonstrated that after self-pollination and crossing with transgenic soybean, the average podding rates of 18 wild soybean populations ranged within 96.50–99.50% and 4.92–18.03%, and the average filled seed numbers per pod varied from 1.70 to 2.69 and 0.20 to 0.48, respectively. The results showed that approximately 89% of wild soybeans displayed either medium or higher than medium SC with transgenic soybean (ICSC>1.0%). This implied the high possibility of gene flow via pollen from transgenic soybean to wild soybean.

The commercial cultivation of herbicide-resistant (HR) transgenic soybeans (Glycine max L. Merr.) raises great concern that transgenes may introgress into wild soybeans (Glycine soja Sieb. et Zucc.) via pollen-mediated gene flow, which could increase the ecological risks of transgenic weed populations and threaten the genetic diversity of wild soybean. To assess the fitness of hybrids derived from transgenic HR soybean and wild soybean, the F2 and F3 descendants of crosses of the HR soybean line T14R1251-70 and two wild soybeans (LNTL and JLBC, which were collected from LiaoNing TieLing and JiLin BaiCheng, respectively), were planted along with their parents in wasteland or farmland soil, with or without weed competition. The fitness of F2 and F3 was significantly increased compared to the wild soybeans under all test conditions, and they also showed a greater competitive ability against weeds. Seeds produced by F2 and F3 were superficially similar to wild soybeans in having a hard seed coat; however, closer morphological examination revealed that the hard-seededness was lower due to the seed coat structure, specifically the presence of thicker hourglass cells in seed coat layers and lower Ca content in palisade epidermis. Hybrid descendants containing the cp4-epsps HR allele were able to complete their life cycle and produce a large number of seeds in the test conditions, which suggests that they would be able to survive in the soil beyond a single growing season, germinate, and grow under suitable conditions. Our findings indicate that the hybrid descendants of HR soybean and wild soybean may pose potential ecological risks in regions of soybean cultivation where wild soybean occurs.

The introduction of herbicide-tolerant (HT) transgenic soybeans (Glycine max (L.) Merr.) into farming systems raises great concern that transgenes may flow to endemic wild soybeans (Glycine soja Sieb. et Zucc.) via pollen, which may increase the ecological risks by increasing the fitness of hybrids under certain conditions and threaten the genetic diversity of wild soybean populations. In order to demonstrate the potential risk of gene flow from the HT soybean to the wild soybean, the fitness of F2 and F3 hybrids obtained from two wild soybean populations (HLJHRB-1, JSCZ) collected from China and the HT soybean was measured under farmland and wasteland soil conditions, as well as with or without weed competition. Compared with their wild progenitors, the F2 and F3 hybrids of HLJHRB-1 displayed a higher emergence rate, higher aboveground dry biomass, more pods and filled-seed plants, as well as better composite fitness under four planting conditions. The F2 and F3 hybrids of JSCZ also displayed a higher emergence rate, higher aboveground dry biomass, more pods, and more filled seeds per plant under mixed planting, whereas these characteristics were lower under pure planting conditions in wasteland and farmland soil. Therefore, the composite fitness of JSCZ hybrids was higher or lower depending on the planting conditions. Furthermore, the soil microbial communities of the F3 of HLJHRB-1, JSCZ, and the wild soybean were investigated with 16S rDNA sequencing, which showed that low alpha diversity of rhizobacteria was relative to high fitness, and Rhizobium played an important role in promoting F3 plant growth. [ABSTRACT FROM AUTHOR]

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant. [ABSTRACT FROM AUTHOR]

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

Ukraine is among the world’s top ten soybean-producing countries. The significant prevalence of Roundup transgenic soybean varieties increases the likelihood of it becoming part of farm animal feed. Accordingly, it is important to study the effect of genetically modified soy on the body of animals and to develop ways to neutralize the deviations caused by its action. A study of the effect of traditional and transgenic soy on reproductive function, physiological, biochemical and economic parameters of lactating cows. Cows’ feed intake with the addition of conventional soya had no significant effect on litter size. In the group of animals that consumed transgenic soya, there was a tendency for a reduction in the total number of newborns and an increase in the number of stillborn calves. The use of transgenic soybeans by lactating cows promotes the increase of ALT activity and alkaline phosphatase concentration. Feeding genetically modified soy to cows does not change the chemical composition of milk and does not significantly affect daily milk yield. The addition of Nano argentum citrate to the diet of animals increased the average daily milk yield throughout the experimental period. At 10 days of Nano argentum use, the cows of the experimental group had higher daily milk yields by 10.5 %, and at 20 and 30 days – by 7.5 and 6.4 %, respectively. The corrective effect of the drug Nano argentum on physiological and biochemical parameters in animals that have used transgenic soy for a long time has been established. This indicates the detoxifying properties of the drug and allows to recommend it as a means of preventive protection of animals whose diet may include genetically modified soybeans

Abstract Background Antimicrobial peptides play important roles in both plant and animal defense systems. Moreover, over-expression of CaAMP1 (Capsicum annuum antimicrobial protein 1), an antimicrobial protein gene isolated from C. annuum leaves infected with Xanthomonas campestris pv. vesicatoria, confers broad-spectrum resistance to hemibiotrophic bacterial and necrotrophic fungal pathogens in Arabidopsis. Phytophthora root and stem rot (PRR), caused by the fungus Phytophthora sojae, is one of the most devastating diseases affecting soybean (Glycine max) production worldwide. Results In this study, CaAMP1 was transformed into soybean by Agrobacterium-mediated genetic transformation. Integration of the foreign gene in the genome of transgenic soybean plants and its expression at the translation level were verified by Southern and western blot analyses, respectively. CaAMP1 over-expression (CaAMP1-OX) lines inoculated with P. sojae race 1 exhibited enhanced and stable PRR tolerance through T2–T4 generations compared with the wild-type Williams 82 plants. Gene expression analyses in the transgenic plants revealed that the expression of salicylic acid-dependent, jasmonic acid-dependent, and plant disease resistance genes (R-genes) were significantly up-regulated after P. sojae inoculation. Conclusions These results indicate that CaAMP1 over-expression can significantly enhance PRR tolerance in soybean by eliciting resistance responses mediated by multiple defense signaling pathways. This provides an alternative approach for developing soybean varieties with improved tolerance against soil-borne pathogenic PRR.

Objective Near-infrared (NIR) spectroscopy and partial least squares-discriminant analysis (PLS-DA) were applied to discriminate soybean samples as being transgenic or non-transgenic. The rapid discrimination models for transgenic soybean were established, and the optimal model was selected. Methods Principal component analysis (PCA) was used to extract relevant features from the spectral data and remove anomalous samples. In experimental studies, 94 samples were used to build models and 41 samples were used as the validation to evaluate the performance of the developed models. The effects of sample morphology (intact or ground), wavelength range and spectral pretreatment method on the correctness of the model were discussed. Results Models for intact soybean samples obtain better judgment performance than models for ground samples. The best discriminant model for intact soybean samples possessed both 100.00% discriminant correct rate in calibration and validation sets at 9 403-5 438 cm-1 using second derivative (2nd). The best discriminant model for ground soybean samples also achieved both 100.00% discriminant correct rate in calibration and validation sets at 7 505-4 597 cm-1 using standard normal variate plus first derivative (SNV+1st). Conclusion By selecting sample morphology, wavelength range and spectral pretreatment method, the discrimination model can be optimized and the discriminant correct rate can be significantly improved.

The field study was undertaken to examine the potential for adverse effects of transgenic soybean expressing bioactive human epidermal growth factor (with tolerance to the herbicide glufosinate, PPT) on the abundance and diversity of plant‐dwelling arthropods by comparing with those of a non‐GM parental cultivar, Gwangan soybean. Field surveys of soybean fields were carried out over two consecutive years, 2016 and 2017 at Ochang and Jeonju, Korea. The number of captured individuals associated with either of EGF and Gwangan soybean plants increased in 2017 compared with 2016 in both Ochang and Jeonju. During the survey period, the diversity and richness of the occurred insects and arachnids increased, dominance decreased, and the evenness of the insects remained static. The insects of Hymenoptera Order occurred most often comprised 25.4% of total captured insect pests. On the contrary, natural enemy from Hymenoptera Order and other insects from Diptera Order occurred more frequently (29.9% and 19.0%, respectively) in both the survey regions during the study periods. The score from PROXSCAL multidimensional scaling using combined data showed that the occurrence of insects and arachnids were separated due to their cultivation regions and years, irrespective of soybean cultivars. Consequently, the results indicated that there happened no notable change in the composition of arthropod communities in soybean agroecosystem due to GM event in soybean expressing EGF. [ABSTRACT FROM AUTHOR]

Polymerase chain reaction (PCR) technology has become a standard technique for the detection of genetically modified organisms (GMOs). However, this method requires a PCR amplification process which is both expensive and time-consuming. Herein, we propose electric field-induced release and measurement (EFIRM) technology as an alternative method for GMO screening. The specificity and sensitivity of the EFIRM assay were proven to be comparable to those of the real-time PCR method for detecting genetically modified soybeans. After all the parameters had been evaluated, the actual evaluation of soybean samples from soybean cargoes was performed. An actual EFIRM screening was performed on 157 soybean cargo samples, which had 102 transgenic soybean samples containing the GTS-40-3-2 gene, through a blind trial at the Dalian port of China. Our results showed that 101 transgenic soybean samples were correctly detected, with only one false-negative case, and 55 non-transgenic soybean samples were detected as negative; this demonstrates that the EFIRM assay is an effective, accurate, simple, and economical novel method for detecting transgenic products, which may have a positive impact on the development of rapid on-site GMO monitoring platforms. [ABSTRACT FROM AUTHOR]

Modern agriculture has gained significant economic benefits worldwide with the use of genetically modified (GM) technologies. While GM crops provide convenience to humans, their biosafety has attracted increasing concern. In this study, the Illumina MiSeq was used to perform a high-throughput sequencing of the V3-V4 hypervariable regions of 16S rRNA gene (16S rDNA) amplicons to compare the rhizosphere bacterial communities of the EPSPS/GAT dual transgenic glyphosate-tolerant soybean line Z106, its recipient variety ZH10, and Z106 with glyphosate application (Z106G) during flowering, seed filling, and maturing stages under field settings. At each of the three stages, the alpha and beta diversity of rhizosphere bacterial communities revealed no significant differences between ZH10, Z106, and Z106G. However, some bacterial taxa demonstrated a greater proportional contribution, particularly the nitrogen-fixing rhizobium Ensifer fredii, in the rhizospheric soil of Z106 at the seed filling and maturing stages, when compared to ZH10 and Z106G. The present study therefore suggests that the EPSPS/GAT dual transgenic line Z106 and exogenous glyphosate application have a minimal effect on the composition of the soybean rhizosphere bacterial community but have no impact on the structure of the rhizosphere microbial community during a single planting season. [ABSTRACT FROM AUTHOR]

Abstract Background Cry8-like from Bacillus thuringiensis (Bt) encodes an insecticidal crystal (Cry) protein. Holotrichia parallela (Coleoptera: Scarabaeoidae), commonly known as the dark black chafer, is a troublesome pest of soybean (Glycine max). To test whether cry8-like can confer resistance against H. parallela to soybean, we introduced cry8-like from the Bt strain HBF-18 into soybean cultivar Jinong 28. Results Quantitative reverse transcription-PCR analysis demonstrated that cry8-like was expressed most highly in soybean leaves. In addition, Southern blot assays revealed that one copy of the integrated fragment was present in the transformed plants. Eight independent cry8-like transgenic lines were subsequently fed on by H. parallela. Under H. parallela feeding stress, the survival rates of the non-transgenic plants were 92% lower than those of the transgenic plants. The mortality rate of H. parallela increased when the larvae fed on the roots of T1 transgenic soybean plants. Moreover, the surviving larvae were deformed, and their growth was inhibited. Conclusions Collectively, our data suggest that transgenic soybean plants expressing the cry8-like gene are more resistant to H. parallela than non-transgenic plants and that transgenic expression of the cry8-like gene may represent a promising strategy for engineering pest tolerance. The events generated in this study could thus be utilized in soybean breeding programs.

Glyphosate is a highly efficient, broad-spectrum nonspecific herbicide that inhibits the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS)-mediated pathway of shikimic acid. The screening of glyphosate-resistant EPSPS gene is a major means for the development of new genetically modified glyphosate-resistant transgenic crop. Currently, the main commercialized glyphosate-resistant soybean contains glyphosate-resistant gene CP4-EPSPS. In this study, a G10-EPSPS gene was reported providing glyphosate resistance in Zhongdou 32. Here, G10-EPSPS gene was introduced into soybeans through Agrobacterium-mediated soybean cotyledon node. PCR, Southern blotting, semi-quantitative RT-PCR, qRT-PCR, and Western blotting were used, and the results revealed that G10-EPSPS had been integrated into the soybean genome and could be expressed steadily at both mRNA and protein levels. In addition, glyphosate resistance analysis showed that the growth of transgenic soybean had not been affected by concentrations of 900 and 2700 g a.e. ha−1 of glyphosate. All the results indicated that G10-EPSPS could provide high glyphosate resistance in soybeans and be applied in production of glyphosate-resistant soybean.

Genetically modified (GM) soybeans expressing Cry1A.105/Cry2Ab2/Cry1Ac (event MON 87701 × MON 89788 × MON 87751 × MON 87708) and Cry1Ac (event MON 87701 × MON 89788) from Bacillus thuringiensis Berliner (Bt) are valuable technologies for managing key lepidopteran pests of soybean in South America, but do not provide stand-alone protection against Spodoptera species. Here, we evaluated the use of these Bt soybeans and their integration with insecticides for managing Spodoptera species. Cry1A.105/Cry2Ab2/Cry1Ac soybean provided reasonable levels of protection against S. cosmioides, S. albula, and S. eridania. However, S. frugiperda had higher survival on this Bt soybean, and Cry1Ac soybean showed low lethality against all species evaluated. Spodoptera larvae that survived on Bt and non-Bt soybean showed comparable susceptibility to flubendiamide and thiodicarb in diet-overlay bioassays. Regardless of soybean plant type, the field doses of flubendiamide and thiodicarb were effective in controlling surviving Spodoptera larvae. We conclude that Cry1A.105/Cry2Ab2/Cry1Ac soybean is effective in controlling S. cosmioides and S. albula, and also has reasonable control of S. eridania, but not S. frugiperda. Cry1Ac soybean provided poor control of all Spodoptera species. Nonetheless, Spodoptera larvae surviving on both Bt and non-Bt soybean were controlled by flubendiamide and thiodicarb. Thus, integrated control tactics would provide effective management of Spodoptera species in Bt soybean fields in South America.

The introduction of herbicide-tolerant (HT) transgenic soybeans (Glycine max (L.) Merr.) into farming systems raises great concern that transgenes may flow to endemic wild soybeans (Glycine soja Sieb. et Zucc.) via pollen, which may increase the ecological risks by increasing the fitness of hybrids under certain conditions and threaten the genetic diversity of wild soybean populations. In order to demonstrate the potential risk of gene flow from the HT soybean to the wild soybean, the fitness of F2 and F3 hybrids obtained from two wild soybean populations (HLJHRB-1, JSCZ) collected from China and the HT soybean was measured under farmland and wasteland soil conditions, as well as with or without weed competition. Compared with their wild progenitors, the F2 and F3 hybrids of HLJHRB-1 displayed a higher emergence rate, higher aboveground dry biomass, more pods and filled-seed plants, as well as better composite fitness under four planting conditions. The F2 and F3 hybrids of JSCZ also displayed a higher emergence rate, higher aboveground dry biomass, more pods, and more filled seeds per plant under mixed planting, whereas these characteristics were lower under pure planting conditions in wasteland and farmland soil. Therefore, the composite fitness of JSCZ hybrids was higher or lower depending on the planting conditions. Furthermore, the soil microbial communities of the F3 of HLJHRB-1, JSCZ, and the wild soybean were investigated with 16S rDNA sequencing, which showed that low alpha diversity of rhizobacteria was relative to high fitness, and Rhizobium played an important role in promoting F3 plant growth.

Research, production, and use of genetically modified (GM) crops have split the world between supporters and opponents. Up to now, this technology has been limited to the control of weeds and pests, whereas the second generation of GM crops is expected to assist farmers in abiotic stress tolerance or improved nutritional features. Aiming to analyze this subject holistically, in this presentation we address an advanced technology for drought-tolerant GM crops, upscaling from molecular details obtained in the laboratory to an extensive network of field trials as well as the impact of the introduction of this innovation into the market. Sunflower has divergent transcription factors, which could be key actors in the drought response orchestrating several signal transduction pathways, generating an improved performance to deal with water deficit. One of such factors, HaHB4, belongs to the homeodomain-leucine zipper family and was first introduced in Arabidopsis. Transformed plants had improved tolerance to water deficits, through the inhibition of ethylene sensitivity and not by stomata closure. Wheat and soybean plants expressing the HaHB4 gene were obtained and cropped across a wide range of growing conditions exhibiting enhanced adaptation to drought-prone environments, the most important constraint affecting crop yield worldwide. The performance of wheat and soybean, however, differed slightly across mentioned environments; whereas the improved behavior of GM wheat respect to controls was less dependent on the temperature regime (cool or warm), differences between GM and wild-type soybeans were remarkably larger in warmer compared to cooler conditions. In both species, these GM crops are good candidates to become market products in the near future. In anticipation of consumers’ and other stakeholders’ interest, spectral analyses of field crops have been conducted to differentiate these GM crops from wild type and commercial cultivars. In this paper, the potential impact of the release of such market products is discussed, considering the perspectives of different stakeholders.

With the development and application of transgenic technology, enrichment and degradation of transgnic foreign protein in environment has become a public concern. Detection and monitoring of exogenous protein in the environment has become a direction of genetically modified organism research and supervision. In this study, transgenic soybean (5% GTS40-3-2) seeds containing CP4-EPSPS protein were treated by simulated natural degradation and protease K. Western blot, lateral flow test strip and enzyme linked immunosorbent assay (ELISA) were selected to detect the presence of CP4-EPSPS. The results showed that CP4-EPSPS was gradually degraded under simulated natural degradation conditions, and completely degraded in about 17 weeks. In the condition of protease K treatment, CP4-EPSPS was rapidly degraded in 9 hours. This study explored the degradation rule of CP4-EPSPS in natural environment. And it provided new ideas for the future research of rapid, safe and effective degradation of CP4-EPSPS. [ABSTRACT FROM AUTHOR]

Considering that the genetically modified soybean lectin gene is affected by the gene type, to improve the stability of the genetically modified soybean lectin gene, a method based on fluorescence quantitative PCR to analyze the genetic characteristics of the genetically modified soybean lectin was proposed. The common soybean varieties, Wangshuibai and Huangdou No. 3 were selected as materials for tissue-specific expression analysis. Under the background conditions of analyzing the genetically modified soybean lectin genes, fluorescent quantitative PCR was applied to the analysis of genetic characteristics. The characteristics of the genetically modified soybean lectin gene were analyzed in terms of location characteristics and expression characteristics. The results showed that the soybean lectin gene has a complex functional mechanism and may participate in a variety of stress-related regulatory or signal transduction pathways in different ways; Lectin2.1 transcripts are expressed in abundance in glume and lemma in seedling tips, Lectin2.2 was mainly expressed in the roots, and a small amount was expressed in leaves and lemma; Lectin2.1 and Lectin2.2 are highly similar in nucleic acid and amino acid composition, and have similar subcellular localization characteristics. [ABSTRACT FROM AUTHOR]

Copyright of Scientific Journal 'Animal Science & Food Technologies' is the property of National University of Life & Environmental Sciences of Ukraine and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Background: Antimicrobial peptides play important roles in both plant and animal defense systems. Moreover, over-expression of CaAMP1 (Capsicum annuum antimicrobial protein 1), an antimicrobial protein gene isolated from C. annuum leaves infected with Xanthomonas campestris pv. vesicatoria, confers broad-spectrum resistance to hemibiotrophic bacterial and necrotrophic fungal pathogens in Arabidopsis. Phytophthora root and stem rot (PRR), caused by the fungus Phytophthora sojae, is one of the most devastating diseases affecting soybean (Glycine max) production worldwide. Results: In this study, CaAMP1 was transformed into soybean by Agrobacterium-mediated genetic transformation. Integration of the foreign gene in the genome of transgenic soybean plants and its expression at the translation level were verified by Southern and western blot analyses, respectively. CaAMP1 over-expression (CaAMP1-OX) lines inoculated with P. sojae race 1 exhibited enhanced and stable PRR tolerance through T2–T4 generations compared with the wild-type Williams 82 plants. Gene expression analyses in the transgenic plants revealed that the expression of salicylic acid-dependent, jasmonic acid-dependent, and plant disease resistance genes (R-genes) were significantly up-regulated after P. sojae inoculation. Conclusions: These results indicate that CaAMP1 over-expression can significantly enhance PRR tolerance in soybean by eliciting resistance responses mediated by multiple defense signaling pathways. This provides an alternative approach for developing soybean varieties with improved tolerance against soil-borne pathogenic PRR. [ABSTRACT FROM AUTHOR]

Soybean (Glycine max L.) is the world's largest source of protein feed and the second largest source of vegetable oil. Water restriction is the main limiting factor to achieve maximum soybean yields. Therefore, development of varieties that maintain yield under environmental stresses is a major objective of soybean breeding programs. The HaHB4 (Helianthus annuus homeobox 4) gene from sunflower encodes for a transcription factor involved in the plant´s tolerance to environmental stress. The introduction of HaHB4 in soybean led to the development of event IND-ØØ41Ø-5 (HB4® soybean), which displayed higher yield in environments having low productivity potential, compared with the parental control variety. Compositional analyses of soybean event IND-ØØ41Ø-5 were conducted both in Argentina and the United Sates. A total of 44 components were analyzed in grain and 9 components in forage. Based on the results of these studies it was concluded that soybean event IND-ØØ41Ø-5 was compositionally equivalent to its non-transgenic parental control. [ABSTRACT FROM AUTHOR]

Soybean yield is limited primarily by abiotic constraints. No transgenic soybean with improved abiotic stress tolerance is commercially available. We transformed soybean plants with genetic constructs able to express the sunflower transcription factor HaHB4, which confers drought tolerance to Arabidopsis and wheat. One line (b10H) carrying the sunflower promoter was chosen among three independent lines because it exhibited the best performance in seed yield, and was evaluated in the greenhouse and in 27 field trials in different environments in Argentina. In greenhouse experiments, transgenic plants showed increased seed yield under stress conditions together with greater epicotyl diameter, larger xylem area, and increased water use efficiency compared with controls. They also exhibited enhanced seed yield in warm and dry field conditions. This response was accompanied by an increase in seed number that was not compensated by a decrease in individual seed weight. Transcriptome analysis of plants from a field trial with maximum difference in seed yield between genotypes indicated the induction of genes encoding redox and heat shock proteins in b10H. Collectively, our results indicate that soybeans transformed with HaHB4 are expected to have a reduced seed yield penalty when cultivated in warm and dry conditions, which constitute the best target environments for this technology. [ABSTRACT FROM AUTHOR]

Lunasin, a bioactive peptide with a variety of physiological functions, was overexpressed in soybean to generate a transgenic soybean. Polymerase chain reaction (PCR) analysis suggested that lunasin was successfully inserted into the soybean genome, and three transgenic lines, L12, L43, and L45, were selected for further study. Lunasin expression was characterized in the lines by Western blot and ultra-performance liquid chromatography with tandem mass spectrometry. Enzyme-linked immunosorbent assay showed that lunasin content in L12, L43, and L45 lines was 1.47 mg g−1, 1.32 mg g−1 and 1.98 mg g−1, respectively; these values were significantly higher than that in wild-type soybean (0.94 mg g−1). Lunasin enrichments from transgenic soybean (LET) exhibited stronger DPPH, ABTS+, and oxygen radical scavenging activity than lunasin enrichments from wild-type soybean (LEW). Further, LET presented superior anti-inflammatory activity on lipopolysaccharide-induced macrophage cells compared to LEW, and it significantly suppressed the release of nitric oxide (NO) and pro-inflammatory cytokines including interleukin-1 and -6. Moreover, LET showed higher anti-proliferation activity on MDA-MB-231 cells than LEW. Immunofluorescence staining showed that LET could internalize into NIH-3T3 cells, and localize in the nucleus. In conclusion, it is feasible and efficient to produce lunasin through a transgenic soybean expression system. Lunasin overexpressing soybean could be consumed as a functional food in the diets of patients with cancer and obesity in the future. [ABSTRACT FROM AUTHOR]

Research, production, and use of genetically modified (GM) crops have split the world between supporters and opponents. Up to now, this technology has been limited to the control of weeds and pests, whereas the second generation of GM crops is expected to assist farmers in abiotic stress tolerance or improved nutritional features. Aiming to analyze this subject holistically, in this presentation we address an advanced technology for drought-tolerant GM crops, upscaling from molecular details obtained in the laboratory to an extensive network of field trials as well as the impact of the introduction of this innovation into the market. Sunflower has divergent transcription factors, which could be key actors in the drought response orchestrating several signal transduction pathways, generating an improved performance to deal with water deficit. One of such factors, HaHB4, belongs to the homeodomain-leucine zipper family and was first introduced in Arabidopsis. Transformed plants had improved tolerance to water deficits, through the inhibition of ethylene sensitivity and not by stomata closure. Wheat and soybean plants expressing the HaHB4 gene were obtained and cropped across a wide range of growing conditions exhibiting enhanced adaptation to drought-prone environments, the most important constraint affecting crop yield worldwide. The performance of wheat and soybean, however, differed slightly across mentioned environments; whereas the improved behavior of GM wheat respect to controls was less dependent on the temperature regime (cool or warm), differences between GM and wild-type soybeans were remarkably larger in warmer compared to cooler conditions. In both species, these GM crops are good candidates to become market products in the near future. In anticipation of consumers' and other stakeholders' interest, spectral analyses of field crops have been conducted to differentiate these GM crops from wild type and commercial cultivars. In this paper, the potential impact of the release of such market products is discussed, considering the perspectives of different stakeholders. [ABSTRACT FROM AUTHOR]

A detrimental effect of glyphosate on soybean Mn nutrition has been reported, which could happen even when applying the herbicide to weeds infesting soybean crops. Three experiments were conducted to study the effect of glyphosate on Mn absorption kinetics, accumulation, distribution within the soybean plant and soybean response to Mn as affected by this herbicide. In a nutrient solution experiment, using the solution depletion technique, Mn uptake kinetics (Vmax, Km and Cmin) were determined for a conventional and its near-isogenic glyphosate-resistant counterpart cultivar as affected by glyphosate applied to the nutrient solution. In another nutrient solution experiment, differential Mn accumulation and distribution were studied for the same cultivars. In the third experiment, with Mn-deficient soil in pots, the response of glyphosate-resistant soybean cultivars to Mn application was studied in the presence of the herbicide. A few days after herbicide treatment, soybean plants developed yellowish leaves, a symptom that, in the field, could be misinterpreted as Mn deficiency. But there was no evidence of deleterious effects of glyphosate on Mn absorption, accumulation, distribution in the plant and response by soybean cultivars.

The need of soybean that reached up to 2,2 million tons per year has made Indonesia imports this commodity 1,62 million tons from countries that adopt Genetically Modified (GM) soybean. By the presence of GM soybeans in Indonesia, Genetically Modified Product (GMP) labelling has need to be done. Detection of GMP can be done by using PCR. The aim of this study was to determine the presence of trangenic genetic material in soy milk powder and soy formula products to classify as GMP. Another goal was to determine the optimum annealing temperature of the primers used. Based on this study, the optimum annealing temperature of the CaMV 35S primer and the EPSPS-CP4 primer was 60oC and 59oC. The NOS terminator primer’s optimum annealing temperature was not found. 6 soy milk powder samples and 5 soy formula samples are might be determined to be using transgenic soybeans due to the presence of EPSPS-CP4 genes and CaMV 35S promotor genes. Therefore, those 11 samples were classified as GMP. ABSTRAK Kebutuhan kedelai yang mencapai 2,2 juta ton/tahun memaksa Indonesia mengimpor sebanyak 1,62 juta ton. Sebagian besar kedelai impor berupa kedelai transgenik. Dengan munculnya kedelai transgenik di Indonesia, perlu adanya pelabelan Produk Rekayasa Genetika (PRG) untuk memenuhi hak-hak konsumen. Teknik yang dilakukan untuk mendeteksi PRG salah satunya menggunakan metode PCR. Penelitian ini bertujuan untuk mengetahui ada tidaknya gen transgenik pada produk susu bubuk kedelai dan formula soya, sehingga produk dapat digolongkan sebagai PRG atau tidak. Selain itu juga bertujuan untuk mengetahui suhu annealing optimum pada primer yang digunakan. Hasil penelitian didapatkan suhu annealing optimum primer CaMV 35S promotor adalah 60oC. Sedangkan untuk primer gen EPSPS-CP4 suhu annealing optimumnya 59oC. Untuk primer NOS terminator suhu annealing optimum tidak ditemukan. Dari amplifikasi DNA sampel, 6 sampel susu bubuk kedelai dan 5 sampel formula soya terdapat sisipan gen EPSPS-CP4 dan gen Promotor CaMV 35S. Dengan demikian 11 sampel tersebut dapat dikatakan sebagai PRG. Kata kunci: Produk rekayasa genetika; PCR; formula soya; susu kedelai bubuk; kedelai transgenik

Glyphosate tolerant soybeans represent a large portion of soybeans grown and fed to farm animals around the world. Despite their widespread use for many years, some have raised questions regarding their safety because the soybeans were genetically modified. The CP4 EPSPS gene which imparts resistance to topical application of the herbicide glyphosate was introduced into soybeans. Application of glyphosate to soybean fields will reduce weed pressure and increase soybean yield. To assess their safety on the rat reproduction system, male Sprague Dawley rats were fed either glyphosate-tolerant (GM) soybean (40-3-2) or near-isogenic, non-GM (A5403) (control) soybean meal. The processed soybean meal was added to formulated rodent diets at 20% (w/w) and fed to rats for 90 days. Some rats from the control group were separately administered mitomycin C for 40 days and served as positive controls in the sperm abnormality test. Body weights and behavior were monitored daily, serum enzymes and histologic and EM appearance of the testis, and sperm morphology were also examined. After 90 days of feeding, no adverse effects were observed in rats fed glyphosate-tolerant soybeans. [ABSTRACT FROM AUTHOR]

Copyright of Informe Gepec is the property of Informe Gepec and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

ABSTRACT: This study aimed at evaluating the agronomic performance of Intacta RR2 soybean submitted to the application of glyphosate doses in post-emergence. For this, two experiments were conducted in two locations (Palotina and Marechal Cândido Rondon - Paraná state). Applications were carried out with increasing rates of glyphosate (0, 720, 1,440, 2,160, 2,880, 3,600, 4,320 g a.e. ha-1), constituting seven treatments with an experimental design in randomized blocks with four replications, totaling 28 plots for each location. The cultivar used for both experiments was Monsoy 6210 Intacta RR2 IPROTM. The analyzed variables were phytotoxicity at 3, 7, 14, 21 and 28 DAA, A-B and total chlorophyll index, final height, number of pods, 100-seed weight, and yield. A regression analysis was used. There was a positive behavior of the linear regression for phytotoxicity and a negative one for final height, number of pods, A-B and total chlorophyll index, and yield in the city of Palotina. In Marechal Cândido Rondon, there were adjustments of the positive linear regressions for phytotoxicity, and negative linear regressions for chlorophyll index, final height, number of pods and yield. Results show that the glyphosate increase from the dose 1,440 g a.e. ha-1 in the studied cultivar damaged the agronomic performance of the culture.

The kinetic and experimental analyses of the hydration process of transgenic soybeans (BRS 225 RR) are provided. The importance of the hydration process consists of the grain texture modifications which favor grinding and extraction of soybeans. The soaking isotherms were obtained for four different temperatures. Results showed that temperature affected transgenic soybeans´ hydration rate and time. Moisture content d.b. of the soybeans increased from 0.12 ± 0.01 kg kg-1 to 1.45 ± 0.19 kg kg-1 during 270 min. of process. Two models were used to fit the kinetic curves: an empirical model developed by Peleg (1988) and a phenomenological one, proposed by Omoto et al. (2009). The two models adequately represented the hydration kinetics. Peleg model was applied to the experimental data and the corresponding parameters were obtained and correlated to temperature. The model by Omoto et al. (2009) showed a better statistical fitting. Although Ks was affected by temperature (Ks = 0.38079 exp (-2289.3 T-1)), the equilibrium concentration remained practically unchanged.

The Panax ginseng TIP gene PgTIP1 was previously demonstrated to have high water channel activity by its heterologous expression in Xenopus laevis oocytes and in yeast; it also plays a significant role in growth of PgTIP1-transgenic Arabidopsis plants under favorable conditions and has enhanced tolerance toward salt and drought treatment. In this work, we first investigated the physiological effects of heterologous PgTIP1 expression in soybean cotyledon hairy roots or composite plants mediated by Agrobacterium rhizogenes toward enhanced salt tolerance. The PgTIP1-transgenic soybean plants mediated by the pollen tube pathway, represented by the lines N and J11, were analyzed at the physiological and molecular levels for enhanced salt tolerance. The results showed that in terms of root-specific heterologous expression, the PgTIP1-transformed soybean cotyledon hairy roots or composite plants displayed superior salt tolerance compared to the empty vector-transformed ones according to the mitigatory effects of hairy root growth reduction, drop in leaf RWC, and rise in REL under salt stress. Additionally, declines in K+ content, increases in Na+ content and Na+/K+ ratios in the hairy roots, stems, or leaves were effectively alleviated by PgTIP1-transformation, particularly the stems and leaves of composite soybean plants. At the whole plant level, PgTIP1-trasgenic soybean lines were found to possess stronger root vigor, reduced root and leaf cell membrane damage, increased SOD, POD, CAT, and APX activities, steadily increased leaf Tr, RWC, and Pn values, and smaller declines in chlorophyll and carotenoid content when exposed to salt stress compared to wild type. Moreover, the distribution patterns of Na+, K+, and Cl- in the roots, stems, and leaves of salt-stressed transgenic plants were readjusted, in that the absorbed Na+ and Cl- were mainly restricted to the roots to reduce their transport to the shoots, and the transport of root-absorbed K+ to the shoots was simultaneously promoted. PgTIP1 transformation into soybean plants enhanced the expression of some stress-related genes (GmPOD, GmAPX1, GmSOS1, and GmCLC1) in the roots and leaves under salt treatment. This indicates that the causes of enhanced salt tolerance of heterologous PgTIP1-transformed soybean are associated with the positive regulation on water relations, ion homeostasis, and ROS scavenging under salt stress both at root-specific and whole plant levels.

A 90-day sub chronic toxicity study was conducted in rats to evaluate the safety of genetically modified DAS-444Ø6-6 soybeans expressing herbicide tolerant proteins when compared with its conventional comparators (non-transgenic near isoline control soybean and three commercially available non-transgenic line control soybeans). Rats were given diets formulated with either 10% or 20% w/w of soybean meal and 1% or 2% hulls of DAS-444Ø6-6 soybean with an equivalent amount of hulls from an isoline non-transgenic control soybean for at least 90 days. In addition, three separate 20% w/w non-transgenic commercially available soybean varieties were also given to groups of rats to serve as reference controls. Animals were evaluated by cage-side and hand-held detailed clinical observations, ophthalmic examinations, body weights/body weight gains, feed consumption, hematology, prothrombin time, urinalysis, clinical chemistry, selected organ weights, and gross and histopathologic examinations. Under the conditions of this study, the genetically modified DAS-444Ø6-6 diets did not cause any treatment-related effects in rats following 90 days of dietary administration as compared with rats fed diets with soybean of isoline control or commercial reference controls and are considered equivalent to the diets prepared from conventional comparators. [ABSTRACT FROM AUTHOR]

With the increasing concern of potential health and environmental risk, it is essential to develop reliable methods for transgenic soybean detection. Herein, a simple, sensitive and selective assay was constructed based on homogeneous fluorescence resonance energy transfer (FRET) between CdTe quantum dots (QDs) and multiwalled carbon nanotubes@graphene oxide nanoribbons (MWCNTs@GONRs) to form the fluorescent “on-off-on” switching for simultaneous monitoring dual target DNAs of promoter cauliflower mosaic virus 35 s (P35s) and terminator nopaline synthase (TNOS) from transgenic soybean. The capture DNAs were immobilized with corresponding QDs to obtain strong fluorescent signals (turning on). The strong π–π stacking interaction between single-stranded DNA (ssDNA) probes and MWCNTs@GONRs led to minimal background fluorescence due to the FRET process (turning off). The targets of P35s and TNOS were recognized by dual fluorescent probes to form double-stranded DNA (dsDNA) through the specific hybridization between target DNAs and ssDNA probes. And the dsDNA were released from the surface of MWCNTs@GONRs, which leaded the dual fluorescent probes to generate the strong fluorescent emissions (turning on). Therefore, this proposed homogeneous assay can be achieved to detect P35s and TNOS simultaneously by monitoring the relevant fluorescent emissions. Moreover, this assay can distinguish complementary and mismatched nucleic acid sequences with high sensitivity. The constructed approach has the potential to be a tool for daily detection of genetically modified organism with the merits of feasibility and reliability. [ABSTRACT FROM AUTHOR]

Differences in levels of lignin in the plant between conventional and transgenic cultivars RR has been reported by several authors, however, there are few studies evaluating the influence of spraying of glyphosate on the lignin in the plant and RR soybean seeds. The aim of this study was to evaluate the physiological quality of RR transgenic soybean seeds and the lignin contents of plants sprayed with the herbicide glyphosate. The assays were conducted both in greenhouse and field in the municipality of Lavras, MG, in the agricultural year 2007/08. The experiment was arranged in a splitplot design with four replicates, considering the treatments hand weeding and herbicide glyphosate as plots, and five RR soybean cultivars (BRS 245 RR, BRS 247 RR, Valiosa RR, Silvânia RR and Baliza RR) as splitplots. In the greenhouse, the cultivars tested were BRS 245 RR and Valiosa RR in a randomized block design with four replicates. The sprayings were carried out at stages V3, V7 and early R5 (3L/ha). The 1000 seed weight, mechanical injury, germination and germination velocity index, emergence velocity index, accelerated aging, electrical conductivity and water soaking seed test, lignin content in the seed coat, in the stem and legumes were determined. The spraying of glyphosate herbicide, in greenhouse and field, did not alter the physiological quality of seeds and the lignin contents in the plant.Diferenças nos teores de lignina na planta entre cultivares transgênicos RR e convencionais, tem sido relatadas, por vários autores, no entanto, são escassos os trabalhos avaliando a influência da aplicação do glifosato sobre os teores de lignina na planta e em sementes de soja RR. Neste sentido, objetivou-se, com este trabalho, avaliar a qualidade fisiológica de sementes de soja transgênica RR e os teores de lignina de plantas submetidas à pulverização com o herbicida glifosato. Os ensaios foram conduzidos em casa de vegetação e em campo, no município de Lavras, MG, na safra 2007/08. O delineamento experimental, utilizado em campo, foi o de parcelas subdivididas, com quatro repetições, considerando-se como parcelas os tratamentos capina e herbicida glifosato, e, como subparcelas, cinco cultivares RR de soja (BRS 245 RR, BRS 247 RR, Valiosa RR, Silvânia RR e Baliza RR). No ensaio de casa de vegetação, utilizaram-se os cultivares BRS 245 RR e Valiosa RR, em delineamento de blocos casualizados, com quatro repetições. As aplicações com herbicida glifosato foram realizadas nos estádios de desenvolvimento V3, V7 e início de R5 (3 L/ha). Determinou-se o peso de 1000 sementes, dano mecânico, germinação e índice de velocidade de germinação, índice de velocidade de emergência, envelhecimento acelerado, condutividade elétrica e teste de imersão de sementes em água, além dos teores de lignina no tegumento das sementes, no caule e nos legumes. A aplicação do herbicida glifosato, em campo e em casa de vegetação, não alterou a qualidade fisiológica de sementes de soja RR nem os teores de lignina na planta.

Molecular characterization of sequences flanking exogenous fragment insertions is essential for safety assessment and labeling of genetically modified organisms (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. About 21 Gb sequence data (~21× coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundary of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of the genomic insertion site of the G2-EPSPS and GAT transgenes will facilitate the use of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS is a cost-effective and rapid method of identifying sites of T-DNA insertions and flanking sequences in soybean.

Com a introdução da soja resistente ao glifosato, ocorreu mudança no manejo da cultura, principalmente com relação ao manejo das plantas invasoras. Este trabalho foi desenvolvido com o objetivo de avaliar os efeitos da aplicação de diferentes manejos de herbicidas e fungicidas sobre o rendimento de grãos e os componentes do rendimento da soja. O experimento foi conduzido no ano agrícola 2006/2007, na área experimental do Departamento de Fitotecnia da Universidade Federal de Santa Maria. Foram utilizadas quatro cultivares de soja Roundup ReadyTM ('NK Mireya 4.2 RR', 'Fundacep 55 RR', 'NK Mágica 7.3 RR' e 'A 8100 RG'), dois manejos de herbicida (Clethodim + Bentazon e outro com glifosato), dois manejos de doenças constituídos com a aplicação de fungicida (Tebuconazole + Tiofanato Metílico) e sem o tratamento. O delineamento experimental utilizado foi o de blocos ao acaso com parcela subsubdivididas, com quatro repetições. Foram avaliados o rendimento de grãos e os componentes do rendimento. As cultivares responderam diferentemente ao manejo de herbicidas e fungicidas para produção de grãos; as cultivares que foram afetadas pelo manejo de herbicida obtiveram maior produtividade com a aplicação de glifosato, efeito que também foi observado com a aplicação de fungicida. As cultivares mais e menos produtivas apresentaram o maior e o menor peso de grãos, respectivamente. A aplicação de fungicida aumentou o índice de colheita.With the introduction of the resistant soybeans to the glyphosate changed the management of the culture, mainly for management of the weed. This work was developed with the objective of evaluate the effect of the different management systems of herbicides and fungicides in grain yield and yield components of the soybean. The experiment was carried in the agricultural year of 2006/2007, at the Experimental Area of Department of Phytotecny of the Santa Maria Federal University. It was used, four soybean cultivars Roundup ReadyTM ('NK Mireya 4.2 RR', 'Fundacep 55 RR', 'NK Mágica 7.3 RR' and 'A 8100 RG'), two herbicide management (Clethodim + Bentazon and with glyphosate) and two fungicides management with application (Tebuconazole + Tiofanato Metílico) and without treatment. The experiment design was randomized blocks with splitsplitplot plot, with four replications. It was evaluated the grain yield and components of yield. The cultivars showed different responses to the management of herbicide and fungicides, for grain yield, cultivars that were affected by the herbicide management showed higher productivity with the application of glyphosate. The effect also was observed with the application of fungicide. The cultivars more and less productive presented the highest and lowest grain weight respectively. Fungicide application increased the harvest index.

Na agricultura moderna, diversas tecnologias auxiliam no aumento daprodutividade, sendo o herbicida uma delas, mas existem consequências atreladas ao seu uso, como os diversos efeitos sobre organismos não alvos. Neste trabalho, objetivou-se verificar esses efeitos sobre agentes fitopatogênicos, assim como avaliar o efeito do herbicida glyphosate sobre diversas doenças, em plantas de soja transgênicas.Verificou-se forte ação fungicida com o uso do herbicida glyphosate, assim como os outros avaliados “in vitro”, sobre os fungos testados, e os mesmos resultados foram observados nas plantas em condição de campo.In modern agriculture, several technologies have helped increase productivity, and herbicide is one of them. However, there are consequences linked to its use, such as the various effects on non-target organisms. The purpose of this work was to verify these effects on phytopathogenic agents, as well as assess the effect of glyphosate on diseases in transgenic soybean. There was a strong fungicide action using glyphosate herbicide as well as with the others evaluated in vitro regarding fungi tested. The same results were observed in plants in field conditions.